ID: 1173327011

View in Genome Browser
Species Human (GRCh38)
Location 20:42043113-42043135
Sequence GTGTTCTGTGGACCACACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173327011_1173327013 -10 Left 1173327011 20:42043113-42043135 CCAGAGTGTGGTCCACAGAACAC No data
Right 1173327013 20:42043126-42043148 CACAGAACACTTGCATCACCTGG No data
1173327011_1173327014 -9 Left 1173327011 20:42043113-42043135 CCAGAGTGTGGTCCACAGAACAC No data
Right 1173327014 20:42043127-42043149 ACAGAACACTTGCATCACCTGGG No data
1173327011_1173327015 -8 Left 1173327011 20:42043113-42043135 CCAGAGTGTGGTCCACAGAACAC No data
Right 1173327015 20:42043128-42043150 CAGAACACTTGCATCACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173327011 Original CRISPR GTGTTCTGTGGACCACACTC TGG (reversed) Intergenic
No off target data available for this crispr