ID: 1173331124

View in Genome Browser
Species Human (GRCh38)
Location 20:42077248-42077270
Sequence GGGGTCCTTGGGCCTCTAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173331124_1173331134 8 Left 1173331124 20:42077248-42077270 CCTTCTAGAGGCCCAAGGACCCC 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1173331134 20:42077279-42077301 CCAGATTCTTCACCCCAGAAAGG 0: 1
1: 1
2: 1
3: 24
4: 204
1173331124_1173331136 20 Left 1173331124 20:42077248-42077270 CCTTCTAGAGGCCCAAGGACCCC 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1173331136 20:42077291-42077313 CCCCAGAAAGGATGCAATGTTGG 0: 1
1: 0
2: 0
3: 19
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173331124 Original CRISPR GGGGTCCTTGGGCCTCTAGA AGG (reversed) Exonic