ID: 1173332725

View in Genome Browser
Species Human (GRCh38)
Location 20:42088456-42088478
Sequence CTCCAGAACTAGAATTAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173332721_1173332725 -6 Left 1173332721 20:42088439-42088461 CCTTCATTCTCTCCTTCCTCCAG 0: 1
1: 2
2: 9
3: 182
4: 1825
Right 1173332725 20:42088456-42088478 CTCCAGAACTAGAATTAGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 190
1173332720_1173332725 18 Left 1173332720 20:42088415-42088437 CCTGAGAAGTCACATGTGAAAAT 0: 1
1: 0
2: 3
3: 30
4: 307
Right 1173332725 20:42088456-42088478 CTCCAGAACTAGAATTAGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 190
1173332718_1173332725 27 Left 1173332718 20:42088406-42088428 CCATCTCACCCTGAGAAGTCACA 0: 1
1: 0
2: 1
3: 17
4: 294
Right 1173332725 20:42088456-42088478 CTCCAGAACTAGAATTAGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 190
1173332719_1173332725 19 Left 1173332719 20:42088414-42088436 CCCTGAGAAGTCACATGTGAAAA 0: 1
1: 0
2: 1
3: 30
4: 268
Right 1173332725 20:42088456-42088478 CTCCAGAACTAGAATTAGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173332725 Original CRISPR CTCCAGAACTAGAATTAGAA GGG Intronic
900864742 1:5260311-5260333 CCCCAGAACTAGTCTTGGAATGG + Intergenic
905420544 1:37840523-37840545 CTCCAGAACTACAACTTGATTGG + Intronic
908433279 1:64079998-64080020 CTCCAGATCCACAATGAGAAGGG - Intronic
910644999 1:89504967-89504989 TGCCAGAAGTAGAATTGGAAAGG - Intergenic
913239300 1:116815407-116815429 GTGCAGAAATAGAACTAGAAGGG - Intergenic
914096459 1:144548171-144548193 CTCTAGAAAAAAAATTAGAAAGG - Intergenic
914797387 1:150931858-150931880 CTCTCAAACTAGGATTAGAAGGG - Intronic
914811465 1:151031763-151031785 CTCAAGAACTTGAACTAGGATGG - Intronic
916995211 1:170289578-170289600 CTCCAGAACTACAAAAATAAAGG - Intergenic
919123344 1:193367866-193367888 CAAGAGAACCAGAATTAGAAGGG - Intergenic
919941726 1:202291682-202291704 TTCCACAGCTAGTATTAGAAGGG - Intronic
920042141 1:203106476-203106498 TTTCAAAACTAGAAGTAGAAAGG - Intronic
921558528 1:216628469-216628491 CTCCAGAAGTAAAATCATAAGGG - Intronic
922150523 1:222999243-222999265 GTGAATAACTAGAATTAGAAGGG + Intronic
923739112 1:236639630-236639652 ATACAGAAATAGAATCAGAAGGG + Intergenic
924259820 1:242217772-242217794 CAAGAGAACTAGAATTAGAAGGG + Intronic
1066300139 10:34088995-34089017 CTCCAGAGTTAGACGTAGAAAGG - Intergenic
1069289857 10:66765125-66765147 CTCCAGAACTAGAAGATGAAAGG - Intronic
1070897883 10:80000709-80000731 CCCCAGAAATAGAAATAGCAAGG + Intergenic
1071397750 10:85239779-85239801 TGCCAGAACTAGAACTAGAGGGG - Intergenic
1071438984 10:85673138-85673160 CAAGAGAACTAGAATTAGAAAGG + Intronic
1072858736 10:98979729-98979751 CTACAGAACAACAAATAGAAAGG + Intronic
1073813670 10:107180446-107180468 CTCCAGAACTATTAGTTGAAAGG + Intergenic
1074309359 10:112308862-112308884 GTCCAGAAAAAGAAGTAGAAGGG - Intergenic
1075431673 10:122388924-122388946 CAAAAGGACTAGAATTAGAAGGG - Intronic
1075432767 10:122402754-122402776 CTCCAGAAATAGAATCAGTGAGG + Intronic
1078918779 11:15807208-15807230 CCCCAGAACTGGAATTTGTAGGG + Intergenic
1079334351 11:19558390-19558412 CTCCAGCACGAGAGTCAGAATGG + Intronic
1082046605 11:47734587-47734609 CTCAAAGAGTAGAATTAGAATGG + Intronic
1082735119 11:56846627-56846649 CTCCAGCAGTAGAAATGGAAAGG + Intergenic
1086399681 11:86450249-86450271 CTCCAGGAAGAGAATAAGAATGG - Intronic
1088143418 11:106646412-106646434 ATCCAGAACTAGATTTGCAAAGG - Intergenic
1090339845 11:126007741-126007763 CTCCAGAACTTTTATTAAAAGGG + Intronic
1091107305 11:132934684-132934706 TTCCAGAAGTAGAAGTTGAAAGG - Intronic
1092742392 12:11642515-11642537 CACCATAACTAGAATCATAAAGG - Intergenic
1093044697 12:14429354-14429376 CACAAGAAATAGAATGAGAAAGG - Intronic
1093883990 12:24438708-24438730 CAAGAGAACTAGAATTAGAAGGG + Intergenic
1096751235 12:53760251-53760273 CCCCAGAAATAAAATTAAAAGGG - Intergenic
1097676202 12:62604144-62604166 CTGCAGAACTGGCATTAGAGGGG + Intergenic
1099199824 12:79662527-79662549 GTCTAGAACTAGAATGTGAATGG - Intronic
1100359902 12:93867113-93867135 CTCAAGAATTAGAAGTAGCAGGG - Intronic
1100721684 12:97365782-97365804 CTCCAGAACTGATTTTAGAAAGG + Intergenic
1101170997 12:102093039-102093061 CTTCAGAGCAAGAATTAAAAGGG + Intronic
1102941948 12:116950737-116950759 CTGCAGAACTAGTTTTAGAAAGG + Intronic
1105965125 13:25376768-25376790 CTCCATCATTAGATTTAGAAAGG - Intronic
1106573891 13:30956555-30956577 GGCCAGAACTAGAATTAACATGG + Intronic
1106631961 13:31483569-31483591 CTGCAGAGATAGAAGTAGAAGGG + Intergenic
1108400460 13:50036953-50036975 CTACAGAACAAGAATTCCAAGGG + Intergenic
1108798139 13:54058607-54058629 TTCTAGAATTAGAATAAGAAAGG + Intergenic
1110447351 13:75601047-75601069 CAAGAAAACTAGAATTAGAAGGG + Intronic
1111597149 13:90427220-90427242 CTCTAAAACTAGGAATAGAAGGG - Intergenic
1112242632 13:97697030-97697052 CTCCATAACTATAATTACTAAGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1112937712 13:104821864-104821886 ATCCTGAACTAGAATTTGATTGG + Intergenic
1113384246 13:109833627-109833649 CTCTAGAACTAGAGTTGGGAAGG - Intergenic
1115434072 14:33353879-33353901 ATCCAGAACTAGAATCGGATAGG - Intronic
1115627787 14:35212157-35212179 CAAGAGAACTAGAATTAGAAGGG - Intronic
1117074136 14:52084356-52084378 TAAGAGAACTAGAATTAGAAGGG - Intergenic
1118553062 14:66978581-66978603 CAAAAGAACTACAATTAGAAGGG - Intronic
1119202074 14:72762562-72762584 CTCTCAAACTAGAAATAGAAGGG + Intronic
1119536722 14:75408974-75408996 CTCCAGAACTGAAATCTGAAGGG + Intergenic
1121705005 14:95985525-95985547 CAAGAGAACTAGAATTAGAAGGG - Intergenic
1121994558 14:98592305-98592327 CTCCAGTACAATAAATAGAAAGG + Intergenic
1122361642 14:101170627-101170649 CTCGAGAACTAGTTTTCGAATGG + Intergenic
1127143033 15:55996066-55996088 CTCAAGAACAAGAGATAGAAGGG - Intergenic
1127863488 15:63013317-63013339 TTCCAGACCTAGATTTAGAGTGG + Intergenic
1130617522 15:85425987-85426009 CTTCAAAAATAGCATTAGAAAGG - Intronic
1131559414 15:93426512-93426534 TTCCAGAACAAGTTTTAGAAGGG - Intergenic
1132078883 15:98847677-98847699 TTCTGGAACTAGAAGTAGAAAGG - Intronic
1132194718 15:99904858-99904880 CTCCAAAAGGAGAATTCGAAAGG + Intergenic
1133506585 16:6418304-6418326 CTCCATTACTATAATGAGAATGG - Intronic
1133684811 16:8156237-8156259 CAAGAGAACTAGAATTAGAAGGG + Intergenic
1135482215 16:22830329-22830351 CTACACCACTAGAATGAGAAAGG - Intronic
1136423726 16:30154505-30154527 CACCAAAACAAAAATTAGAAAGG + Intergenic
1138983870 16:62303291-62303313 CTCCTGAACTAGAATTCAGAGGG + Intergenic
1143449643 17:7028226-7028248 TTCCAGACCTAGAATTACAGGGG - Exonic
1144369293 17:14574768-14574790 CTCCAGAACTACATTTCTAATGG + Intergenic
1144390770 17:14791477-14791499 CTCCAGAAATAAAATAAGCAAGG - Intergenic
1146543774 17:33720266-33720288 CTCCAGAAGCAGAATTAAGAAGG + Intronic
1151177487 17:72300777-72300799 CTCCAGGACAAGAATTGGACTGG + Intergenic
1155089059 18:22488708-22488730 TTCCAGAACTGGACTTCGAATGG + Intergenic
1156711475 18:39951925-39951947 GTAGAAAACTAGAATTAGAAGGG - Intergenic
1159933901 18:74344920-74344942 CTCCAGGAGTAGAATTGGTATGG + Intronic
1161642435 19:5432729-5432751 CACCAGAATCAGAATCAGAAAGG + Intergenic
1165547448 19:36552919-36552941 CTCCAGACAAAGAATTAGTATGG - Intronic
1165966212 19:39583015-39583037 CTCCTGAACTAGAATGGGAAGGG - Intergenic
1165977827 19:39692659-39692681 CTCCAGACCCACAATAAGAAGGG - Intergenic
1168534884 19:57160601-57160623 CTCCAGGACTGGAAGTAAAAAGG - Intronic
1168633210 19:57973391-57973413 CTCTAGTACTCAAATTAGAAGGG + Intronic
925508013 2:4590976-4590998 CAAGAGAAGTAGAATTAGAAAGG + Intergenic
928586565 2:32764919-32764941 ATACAGAACTATAATTAGAAGGG - Intronic
928936266 2:36681764-36681786 TTCCAGAAATAGAAGGAGAAAGG + Intergenic
930256679 2:49101354-49101376 CTCCAGAACTGGGAGTAGATGGG + Intronic
931322808 2:61188317-61188339 CTGCAGAGATAGAAGTAGAAGGG + Exonic
932857284 2:75249250-75249272 CAAAAGAACTAGAATTAGAAGGG - Intergenic
934931115 2:98424687-98424709 CTCAAAAACTAGGAATAGAAGGG + Intergenic
936551643 2:113447850-113447872 TAAGAGAACTAGAATTAGAAGGG - Intronic
938123136 2:128647680-128647702 CTCCAGAAGCAGAATAAGAGAGG - Intergenic
939663767 2:144923852-144923874 AAAGAGAACTAGAATTAGAAGGG + Intergenic
942176810 2:173342529-173342551 CTCTTGAGCTAGAATTTGAAAGG - Intergenic
942315954 2:174696729-174696751 CTCCAGGACTAATATTAGAAAGG - Intergenic
942422857 2:175825788-175825810 CTCCAGAGCTAGTATTGTAATGG - Intergenic
943567273 2:189530865-189530887 CTCCCAAAGTAGAATGAGAAGGG + Intergenic
943685631 2:190814864-190814886 ATACAGAACTAGAAATAGCATGG + Intergenic
944409236 2:199421095-199421117 CTCCAGAAATACACTCAGAAGGG + Intronic
945855070 2:215059153-215059175 CCCCAGAATTAGAATTACATGGG + Intronic
947020634 2:225671465-225671487 CAAGAAAACTAGAATTAGAAAGG - Intergenic
948496527 2:238353526-238353548 TTCCAGAACTAGACTTGCAAAGG - Intronic
1171425336 20:25045263-25045285 GTACTGAACTAGAACTAGAACGG + Intronic
1173332725 20:42088456-42088478 CTCCAGAACTAGAATTAGAAGGG + Intronic
1174300958 20:49581901-49581923 CTCCAGATCTAGAAGTGGGAAGG - Intergenic
1175436339 20:58952760-58952782 CTCCAAAACTAGGAACAGAAGGG + Intergenic
1175478621 20:59295443-59295465 CTCCAGAACCAGCAGCAGAATGG - Intergenic
1175744493 20:61445627-61445649 CTCTAGAACTAAAAGTAGAATGG - Intronic
1176978111 21:15347472-15347494 CTCCAAAACTAGCAGGAGAAAGG + Intergenic
1183002899 22:34876440-34876462 CTACAGAAGAAGAAATAGAAGGG + Intergenic
1183342616 22:37290100-37290122 CTACAGATGTAGAATTGGAATGG - Intronic
949809907 3:7995708-7995730 TGACAGAACTAGAATTAGAAAGG + Intergenic
950643667 3:14364407-14364429 TAGCAGAACTAGAATTAGAACGG - Intergenic
953376832 3:42435932-42435954 ATCCAGATGTAGAATTAGATTGG + Intergenic
955946404 3:64198703-64198725 CTACAGAACTGGAATGAGGAAGG + Intronic
955969916 3:64428416-64428438 CAAGAGAAATAGAATTAGAAGGG + Intronic
957774487 3:84738334-84738356 CCACAGAACTATAATTAGAAAGG - Intergenic
958608140 3:96386998-96387020 TTCCAGCACTATAATTTGAAAGG + Intergenic
963946345 3:151149921-151149943 CAAGAGAACTAGAATTAGAAGGG - Intronic
964538665 3:157755218-157755240 CTTCTGAACTAAAATCAGAAAGG + Intergenic
965725155 3:171707915-171707937 CACAAAACCTAGAATTAGAAGGG + Intronic
965878311 3:173355541-173355563 CTCAAAAACTAGAAATGGAAGGG - Intergenic
966048079 3:175577677-175577699 CTCCAAAAAAAGAATTAAAATGG + Intronic
966405306 3:179591362-179591384 CCCCAAAACTGCAATTAGAAGGG - Intronic
966503508 3:180673003-180673025 CTAGAGAACTAGAATCAAAAGGG + Intronic
970104867 4:12570245-12570267 CTCCAAAACCAGAATTAAAGAGG + Intergenic
971552015 4:27969228-27969250 CCCCACAACCAGAATAAGAAGGG + Intergenic
973957709 4:56079289-56079311 TTCCAGAAATAAAATCAGAAAGG - Intergenic
974890648 4:67878456-67878478 CACCACAACTATAATTAGATAGG + Intronic
975855384 4:78618903-78618925 CTCCAGAACTATATCTAGAGTGG - Intergenic
977695455 4:99960005-99960027 CTAAAGAACTAAAATTTGAATGG + Intergenic
978920806 4:114181031-114181053 CTCAAGAACTAGAGCTAGAATGG + Intergenic
979167403 4:117553223-117553245 CTAAAGCAATAGAATTAGAAGGG + Intergenic
983867865 4:172789759-172789781 CTTTAGAACCAGAATCAGAAAGG + Intronic
985292877 4:188404505-188404527 CCACAGAACTTGAAATAGAAAGG - Intergenic
985342541 4:188970664-188970686 CACCAGAAATAGAGCTAGAATGG - Intergenic
986283363 5:6341672-6341694 CTTCATAACTAGAATTTTAATGG + Intergenic
986925309 5:12741379-12741401 CAAGAGAACTAGAATTAAAAGGG + Intergenic
987172274 5:15271121-15271143 CTGCAGAGCTAGAGTGAGAAAGG - Intergenic
987582263 5:19809370-19809392 CTTAAGATATAGAATTAGAATGG + Intronic
987726759 5:21712173-21712195 CTGAAGCACTAGAATTAGAAGGG + Intergenic
988433444 5:31146221-31146243 CTTTAAAACTAGAACTAGAAGGG + Intergenic
989225252 5:39020038-39020060 CAAGAGAACTAGAATTAGAGGGG + Intronic
990365249 5:55063899-55063921 TTCTAAAACTTGAATTAGAAAGG + Intergenic
990669779 5:58115001-58115023 CTCCAAAACTAGTAACAGAAAGG - Intergenic
992429800 5:76698344-76698366 CACCAGCACTAGAATTAAAGTGG + Intronic
992820996 5:80495867-80495889 TAAGAGAACTAGAATTAGAATGG + Intronic
993935010 5:93988359-93988381 CTACAAAACGAGAATGAGAATGG - Intronic
995232824 5:109789369-109789391 CTCCTAAACTTGAATTTGAATGG + Intronic
995339426 5:111041083-111041105 CAAGAGAACTATAATTAGAAGGG - Intergenic
995347035 5:111133186-111133208 CCCCAGATCTAGAAGTAAAAGGG + Intergenic
999111944 5:149129033-149129055 TTACAGAACCAGAATTTGAATGG - Intergenic
1009530698 6:64810209-64810231 CTCCAGAAATAAAAACAGAAGGG + Intronic
1009627609 6:66156060-66156082 CAAGAGAACTAGAATTAGAATGG + Intergenic
1012099282 6:95010226-95010248 CTCAAGCTCTAGAATTAGACAGG - Intergenic
1013182968 6:107733537-107733559 CTTGAGAACTAGGGTTAGAATGG - Intronic
1014632070 6:123801040-123801062 CGGCAGAATTAGAATTTGAAGGG - Intergenic
1015258406 6:131206608-131206630 ATACAGAACTAGAATTGTAATGG + Intronic
1018164726 6:161082547-161082569 GTCCAGAACTAGAATAAAAGTGG - Intronic
1019138882 6:169930587-169930609 CTCCTGAACAAGAATTACAATGG + Intergenic
1019336908 7:489272-489294 CTCAACAACTAGGAATAGAAGGG + Intergenic
1022193864 7:28044671-28044693 CTCCAGCCATAGAATCAGAAAGG - Intronic
1022578274 7:31520645-31520667 CCCTAGACCTAGAATCAGAATGG + Intronic
1023756216 7:43419681-43419703 CTACAAAACTAGGAATAGAAGGG + Intronic
1026626005 7:71993070-71993092 CACCAGAACTATATTTGGAATGG - Intronic
1027635016 7:80660775-80660797 ATCCAGATCCAGATTTAGAATGG - Intronic
1028137317 7:87235797-87235819 CAAGAGAACTAGAACTAGAAGGG - Intergenic
1028257793 7:88621860-88621882 CTCAAGAACTGGAATAAGACAGG + Intergenic
1028964766 7:96789911-96789933 CTTGAGAACTAGAACTAGATGGG - Intergenic
1033823781 7:145164661-145164683 CCCCAGAACTGTAATTCGAATGG + Intergenic
1033934824 7:146571658-146571680 CTGCAGAACTCGATGTAGAATGG - Intronic
1034210919 7:149361781-149361803 CAGGAGAACTAGAATTAGGAGGG + Intergenic
1034636719 7:152573149-152573171 ATCCAGAGCTAAAATTAGGAGGG + Intergenic
1035154811 7:156903834-156903856 TTGCAGACCTAGAATTAGGATGG - Intergenic
1036405832 8:8454593-8454615 GTTCAGAACAAGAATTTGAATGG - Intergenic
1038712798 8:29963540-29963562 TTCCAGAACAAGATTGAGAATGG - Intergenic
1041162962 8:55063480-55063502 CTCCAAAAATAGATTTACAAAGG + Intergenic
1043299916 8:78715681-78715703 CAAAAGAACTAGAATCAGAAGGG + Intronic
1044895629 8:96888515-96888537 CTCCAGCACCAGCTTTAGAAAGG - Intronic
1045493521 8:102688842-102688864 ATTCAGAATTAGAATAAGAAAGG - Intergenic
1045669593 8:104534359-104534381 CTCTGGAACTGGAATTAGAGAGG + Intronic
1046964667 8:120150876-120150898 CCTTAGAACTAGAATTAGGAAGG + Intronic
1047936605 8:129786635-129786657 CTCCTGAATCAGAATTAAAAAGG + Exonic
1049901354 9:169282-169304 TAAGAGAACTAGAATTAGAAGGG + Intronic
1051437507 9:17048525-17048547 CTCCAGAACCTGAGCTAGAATGG - Intergenic
1053744392 9:41179596-41179618 TAAGAGAACTAGAATTAGAAGGG + Intronic
1054349662 9:64009500-64009522 TAAGAGAACTAGAATTAGAAGGG + Intergenic
1054482880 9:65685620-65685642 TAAGAGAACTAGAATTAGAAGGG - Intronic
1054683953 9:68251654-68251676 TAAGAGAACTAGAATTAGAAGGG - Intronic
1055812933 9:80171947-80171969 CTAGAAAACTAGAATTAAAATGG + Intergenic
1058595639 9:106612461-106612483 CTCCAGAACTAGTAGTGGCAAGG + Intergenic
1060943875 9:127558511-127558533 CTCCAGAACTAGGACGAGGAAGG + Intronic
1186108647 X:6231942-6231964 CTCCACAATTAGATTTAAAATGG - Intergenic
1186887571 X:13929837-13929859 CTCTAAAACTATACTTAGAAAGG + Intronic
1187677779 X:21734773-21734795 TTACAGAACAAGAATCAGAAAGG - Intronic
1188468759 X:30513420-30513442 CTCCAAAACTTAAATTAAAATGG + Intergenic
1188823211 X:34799605-34799627 CACTAGAACTGGAATTAGTAGGG + Intergenic
1188855514 X:35190335-35190357 CAAGAGAACTAGAATTAGAAGGG - Intergenic
1189504147 X:41594307-41594329 CTCCCGAACAAGAAGGAGAAGGG - Intronic
1189684741 X:43552171-43552193 TTACTGAACTAGAATTACAAAGG - Intergenic
1194385758 X:93252846-93252868 CTCTAAAACTAGAATTACCATGG - Intergenic
1195587914 X:106586906-106586928 AACCCGAACTATAATTAGAAGGG + Intergenic
1196129654 X:112141560-112141582 CTCCAAAAGCAGAATTAGAGGGG - Intergenic
1197659988 X:129160210-129160232 CTGCCAAACTAGAATTAGAAGGG - Intergenic
1198489902 X:137129072-137129094 TAAGAGAACTAGAATTAGAAGGG - Intergenic
1200038683 X:153350126-153350148 CTCTAGAACTAGAAAGAGATTGG + Exonic
1202371434 Y:24199423-24199445 CTCCAGAAATAAAAATAAAAAGG + Intergenic
1202499351 Y:25470692-25470714 CTCCAGAAATAAAAATAAAAAGG - Intergenic