ID: 1173334462

View in Genome Browser
Species Human (GRCh38)
Location 20:42101527-42101549
Sequence TGGACCTGATGACAAGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173334452_1173334462 13 Left 1173334452 20:42101491-42101513 CCTAATCCCAAACCAGGGTAGGG No data
Right 1173334462 20:42101527-42101549 TGGACCTGATGACAAGAAAGTGG No data
1173334455_1173334462 6 Left 1173334455 20:42101498-42101520 CCAAACCAGGGTAGGGTGAAGCC No data
Right 1173334462 20:42101527-42101549 TGGACCTGATGACAAGAAAGTGG No data
1173334450_1173334462 14 Left 1173334450 20:42101490-42101512 CCCTAATCCCAAACCAGGGTAGG No data
Right 1173334462 20:42101527-42101549 TGGACCTGATGACAAGAAAGTGG No data
1173334456_1173334462 1 Left 1173334456 20:42101503-42101525 CCAGGGTAGGGTGAAGCCCCTTC No data
Right 1173334462 20:42101527-42101549 TGGACCTGATGACAAGAAAGTGG No data
1173334447_1173334462 26 Left 1173334447 20:42101478-42101500 CCAGGAACATGACCCTAATCCCA No data
Right 1173334462 20:42101527-42101549 TGGACCTGATGACAAGAAAGTGG No data
1173334454_1173334462 7 Left 1173334454 20:42101497-42101519 CCCAAACCAGGGTAGGGTGAAGC No data
Right 1173334462 20:42101527-42101549 TGGACCTGATGACAAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173334462 Original CRISPR TGGACCTGATGACAAGAAAG TGG Intronic