ID: 1173337603

View in Genome Browser
Species Human (GRCh38)
Location 20:42125434-42125456
Sequence CTAACCACTGAGATTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173337599_1173337603 7 Left 1173337599 20:42125404-42125426 CCAGATTCATGACTTTATTGGCC 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1173337603 20:42125434-42125456 CTAACCACTGAGATTGAGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173337603 Original CRISPR CTAACCACTGAGATTGAGCC TGG Intronic
901147490 1:7075956-7075978 AAAATCACTGAGATTGGGCCGGG - Intronic
901375518 1:8835581-8835603 CTTACCACTGAGCTCCAGCCTGG + Intergenic
901377857 1:8852644-8852666 CTTACCACTGAAATCCAGCCTGG - Intergenic
902178714 1:14671089-14671111 CTAATCACAGATGTTGAGCCAGG + Intronic
908982838 1:69979167-69979189 CTGGCCACAGAGATTGATCCAGG - Intronic
909691788 1:78416194-78416216 CACACCACTGAGTTTAAGCCTGG + Intronic
910758532 1:90714417-90714439 CTAAGGACTGAGAGTGACCCTGG - Intronic
915000072 1:152580661-152580683 CCAACCAATGACATTGAACCTGG + Intronic
916404957 1:164489153-164489175 CTAAAAACTGAGAAGGAGCCGGG + Intergenic
916435358 1:164772830-164772852 CTAACCACTTATCATGAGCCAGG - Intronic
917528462 1:175810892-175810914 CTCACCCCAGAGATAGAGCCTGG + Intergenic
919224070 1:194671341-194671363 CTAACCACTGAACTCCAGCCTGG + Intergenic
920060609 1:203224615-203224637 GTAATCTGTGAGATTGAGCCTGG - Intronic
1065093612 10:22259998-22260020 CTAACAACTCACATTTAGCCAGG + Intergenic
1065102873 10:22348248-22348270 CAAAGCACTGGGATTGCGCCCGG + Intronic
1065492256 10:26293813-26293835 CTAACACCTGATATTGAGCTGGG - Intronic
1071249236 10:83799658-83799680 CAGTCCACTGAGATTGAACCAGG - Intergenic
1075515532 10:123105034-123105056 CCAACCACTGCCATGGAGCCTGG + Intergenic
1078390659 11:10932737-10932759 CGAACCACTGAACTTCAGCCTGG + Intergenic
1078392039 11:10943743-10943765 CTACCCACTGAGTCTGGGCCTGG - Intergenic
1078714468 11:13826732-13826754 CTAACCTCAGAGATTGGGTCAGG + Intergenic
1079188395 11:18257177-18257199 CTAACTAATCAGATTGAGACAGG + Intergenic
1081385828 11:42471694-42471716 CTGACCACTGTGAATGAGCCAGG + Intergenic
1083732656 11:64661121-64661143 CTATTCACTGAGATGGAGCCTGG + Exonic
1085875392 11:80401692-80401714 CTAACCACTTACATTGAGGATGG - Intergenic
1087382051 11:97417778-97417800 CTAAACACTGAGAATAACCCAGG - Intergenic
1087690948 11:101320226-101320248 ATCACCACTGAGATTGGGCTGGG + Intergenic
1088514685 11:110617939-110617961 GTCATCACTGAGAGTGAGCCGGG + Intronic
1089013603 11:115149080-115149102 CTGACCACAGGGATGGAGCCGGG + Intergenic
1089718940 11:120394261-120394283 CAAACCACTGCCCTTGAGCCTGG - Intronic
1090369800 11:126241591-126241613 CGAACCACTGAACTTCAGCCTGG - Intronic
1090398976 11:126436288-126436310 CTAACCCCTTAGCTTTAGCCTGG + Intronic
1092555030 12:9549533-9549555 CATACCACTGAGCTTCAGCCTGG + Intergenic
1094479342 12:30869398-30869420 CTAAGGACTGAGATGAAGCCAGG - Intergenic
1094517066 12:31141150-31141172 CATACCACTGAGCTTCAGCCTGG - Intergenic
1095411315 12:41927704-41927726 CTAACCACTGCAGTGGAGCCAGG + Intergenic
1100563144 12:95769223-95769245 GTAAACAGTGAGATTGAGCTGGG + Intronic
1104140238 12:125981017-125981039 CCAACCACAGAGATTAAGCCAGG + Intergenic
1110441015 13:75525245-75525267 CTACCCACAGTGTTTGAGCCAGG + Intronic
1111547626 13:89763397-89763419 CTAACCTCTCAGAATGAGCTTGG - Intergenic
1115833266 14:37365920-37365942 CAACCTACTGAGATTGAGCCAGG - Intronic
1119433308 14:74582311-74582333 CTGACCACTGAGGCTGAGTCTGG + Intronic
1121446028 14:93979797-93979819 CTCACCACTGCGCTTCAGCCTGG - Intergenic
1122930088 14:104929126-104929148 CTAAACACTCAGACTGTGCCTGG + Intronic
1123159007 14:106259189-106259211 CTCACCACTGAGCTCCAGCCTGG + Intergenic
1123207753 14:106729570-106729592 CTCACCACTGAGCTCCAGCCTGG + Intergenic
1123212773 14:106776589-106776611 CTCACCACTGAGCTCCAGCCTGG + Intergenic
1131702780 15:94957380-94957402 CCAGCCACTGAGATTGTGTCTGG + Intergenic
1132143872 15:99415336-99415358 CTACCCACCGAGGTGGAGCCTGG - Intergenic
1135594432 16:23730770-23730792 CGCACCACTGTGCTTGAGCCTGG + Intergenic
1136281631 16:29215946-29215968 CTAGCCACTGAAATAAAGCCAGG + Intergenic
1139492765 16:67295423-67295445 CTAGCCTCTGAGACTGAGTCCGG - Intronic
1141708647 16:85684460-85684482 ATAACCACTGCAATTCAGCCTGG + Intronic
1146970539 17:37068240-37068262 CTAAGCACGGAAATTGACCCTGG - Intergenic
1148338283 17:46856338-46856360 GCATCCACTGAGAGTGAGCCTGG - Intronic
1149293921 17:55243500-55243522 CAAACCTCTGAGCTGGAGCCAGG - Intergenic
1151122858 17:71811947-71811969 CTACCCCCTGAGATTGAACCAGG + Intergenic
1153015939 18:582763-582785 CCAACCACTGGGCTTCAGCCTGG - Intergenic
1153563601 18:6396913-6396935 CTAACCAATGAGTTAAAGCCAGG + Intronic
1154051763 18:10967059-10967081 CTCACCACTGCACTTGAGCCTGG - Intronic
1156112970 18:33749746-33749768 CAAACCTATGAGGTTGAGCCTGG + Exonic
1159056982 18:63476096-63476118 CTAACCACTGTACTTCAGCCTGG - Intergenic
1159959849 18:74546902-74546924 CTAACCTGTGAGCTTGACCCTGG - Intronic
1160710253 19:548207-548229 CAAATCACTGTGGTTGAGCCTGG + Intronic
1165612529 19:37168275-37168297 CTGACCGCTGAGAGTTAGCCTGG + Intronic
1168256200 19:55166673-55166695 CTGACCAATGAGAGTGAGCGAGG + Intronic
925326268 2:3024291-3024313 CCAACCCCTGAGGTTCAGCCTGG - Intergenic
927623058 2:24682482-24682504 CTATGCACTGAGATGGAGCCAGG - Intronic
930062219 2:47299593-47299615 CTCACCACTGAACTTCAGCCTGG + Intergenic
931115372 2:59161051-59161073 GTAACCACTGAGAAGGAACCTGG + Intergenic
933866937 2:86528364-86528386 ATAACCACTGTGCCTGAGCCTGG - Intronic
934870166 2:97857260-97857282 GTAACCACTGGGCTGGAGCCCGG + Intronic
938682686 2:133707559-133707581 TTAACCCCTGGGATTTAGCCTGG + Intergenic
940248651 2:151648583-151648605 CTAACCACTGATATTGTGTATGG + Intronic
941345617 2:164365058-164365080 TTAGCGACTGAGATTGAGCTGGG + Intergenic
942701064 2:178711057-178711079 CAAACCTGTGAGAATGAGCCTGG + Exonic
946245019 2:218382532-218382554 CCACCCAGTGAGATTGAGTCTGG - Intronic
1169807244 20:9571925-9571947 ATAACCACAGAGATAAAGCCTGG + Intronic
1173337603 20:42125434-42125456 CTAACCACTGAGATTGAGCCTGG + Intronic
1174132078 20:48352254-48352276 CTAACCACTGTGATTGATTCAGG - Intergenic
1174291728 20:49513624-49513646 CTAACCCCTGAGAATGAGAGAGG - Intronic
1174954299 20:55079810-55079832 CTAAGCACTGAGAGTGGGCTGGG + Intergenic
1178602581 21:34007701-34007723 CTTACCACTATGATTGAGCCAGG - Intergenic
1180171652 21:46062138-46062160 CTCAGCTCTGAGATGGAGCCTGG - Intergenic
1184111143 22:42396079-42396101 CTACCAACTGGGATTGGGCCTGG - Intronic
1184972467 22:48036030-48036052 CCAAGCACTAAGATTGGGCCGGG + Intergenic
949116021 3:324680-324702 CAAGCCACTGCGCTTGAGCCTGG - Intronic
952254302 3:31682260-31682282 CTGAACTATGAGATTGAGCCTGG + Intronic
956762970 3:72459696-72459718 CTTAGCACTGAAATTGAGTCAGG + Intergenic
957178237 3:76840966-76840988 CTAACCACTCAGATAGAGATAGG - Intronic
959955031 3:112227104-112227126 AAACCTACTGAGATTGAGCCAGG + Intronic
964319736 3:155482472-155482494 TTAACAAATGAGAATGAGCCGGG - Exonic
967219791 3:187238891-187238913 CAAAACACTGTGATTGAACCAGG - Intronic
968242343 3:197101833-197101855 CTCACCACTGCACTTGAGCCTGG - Intronic
968601451 4:1511865-1511887 CTAACCACAGTGATTGGTCCAGG + Intergenic
969828401 4:9776357-9776379 CTCGCCACTGATATTCAGCCTGG + Intronic
970416637 4:15864211-15864233 CGCACCACTGAGATCCAGCCTGG + Intergenic
971245071 4:24920052-24920074 CTAAGCACTGTGAGGGAGCCAGG - Intronic
972909930 4:43802035-43802057 CAACCTACTGAGATTGAACCAGG + Intergenic
979212680 4:118124540-118124562 AGAAGCACTGAGATTGAGCCGGG + Intronic
981415027 4:144482973-144482995 CTTACCACAGAGATGGAGTCAGG - Intergenic
981802115 4:148670080-148670102 CTAAACACTGAGCTTGACCCTGG + Intergenic
983062087 4:163172233-163172255 ATAACCACAGAGAGTGAGACTGG - Intergenic
986370667 5:7077334-7077356 GGAAGCACTGAGAGTGAGCCTGG - Intergenic
986806691 5:11314137-11314159 CTACCTCCTAAGATTGAGCCAGG - Intronic
987533885 5:19159680-19159702 CTCTACACTGAAATTGAGCCAGG - Intergenic
987729930 5:21756862-21756884 TCAACCACTGAAATTGAGGCAGG + Intronic
988418938 5:30981775-30981797 CTCACCATTGAGATTAAGCCTGG + Intergenic
992687107 5:79209741-79209763 CTAAGCATGGAGATTGACCCTGG - Intronic
995070022 5:107909765-107909787 CTGAGCACAAAGATTGAGCCAGG + Intronic
995110009 5:108418352-108418374 ATGCCCACTGAGAGTGAGCCAGG - Intergenic
997091118 5:130859899-130859921 CTCATCACTGAGATAGATCCTGG + Intergenic
1004316438 6:14592216-14592238 ATAACCACTCAGATTGAGGGTGG - Intergenic
1004577365 6:16910048-16910070 ATGACCACTGAGATAAAGCCTGG + Intergenic
1005613836 6:27553691-27553713 CTCACCACGGAGGTGGAGCCCGG + Intergenic
1008055507 6:46941627-46941649 ATAACCACTGAGATAGAGCATGG + Intronic
1013189719 6:107791916-107791938 CTAACCACTGCGCTCCAGCCTGG + Intronic
1015151472 6:130043772-130043794 CTCACCACTGAGGATGAGCTAGG - Intronic
1016331860 6:142961161-142961183 GTAACCACTCAGATTGAGGGTGG - Intergenic
1018861947 6:167717404-167717426 CTAAACACTGTAATTTAGCCAGG - Intergenic
1019746988 7:2706217-2706239 CGCACCACTGCGCTTGAGCCTGG - Intronic
1019846441 7:3507654-3507676 CTAACCACTTAGAATGTGTCAGG - Intronic
1024413113 7:49070429-49070451 CTAACCAGTGAGACTGAACTGGG + Intergenic
1024675806 7:51636993-51637015 CTATCCACTGAACTTCAGCCTGG - Intergenic
1025945456 7:66100908-66100930 CAAACCACTGCACTTGAGCCTGG + Intronic
1029211522 7:98912364-98912386 CTCACCACTGTGAGTGTGCCTGG + Intronic
1031212531 7:118848795-118848817 TTAACCACTACGATAGAGCCTGG - Intergenic
1031647569 7:124245485-124245507 CAAACCACTGCGCTTCAGCCTGG - Intergenic
1033670240 7:143485582-143485604 CATGCCACTGAGCTTGAGCCAGG - Intergenic
1035319162 7:158017411-158017433 CCAAGCACTGGGATGGAGCCTGG - Intronic
1038262393 8:26007675-26007697 CAAACCACAGAGCTGGAGCCAGG + Intronic
1040012971 8:42677573-42677595 GTTACCACTGAGATTCAGCATGG - Intergenic
1042158749 8:65870742-65870764 CATACCACTGAGTTTCAGCCTGG - Intergenic
1045298922 8:100893996-100894018 CGAACCACTGGAAGTGAGCCAGG + Intergenic
1046816566 8:118590562-118590584 GTATCAACTGAGATTGAGCGGGG + Intronic
1047087756 8:121537847-121537869 CTCATCACTGAGATTGATCTTGG - Intergenic
1047847525 8:128824413-128824435 CACTCCACTGATATTGAGCCTGG + Intergenic
1056713739 9:89011850-89011872 CTAACCAGTGAGGATGAGTCAGG - Intergenic
1059576112 9:115490511-115490533 CTATGGACTGAGATTAAGCCTGG + Intergenic
1059749060 9:117230672-117230694 TGAACCAAAGAGATTGAGCCAGG + Intronic
1059833597 9:118126177-118126199 TTAACCACTCAGATTGAGGGTGG - Intergenic
1188026007 X:25210066-25210088 CACACCACTGCGCTTGAGCCTGG - Intergenic
1188374591 X:29412225-29412247 CAAACCACTGTGCTTCAGCCTGG + Intronic
1188467163 X:30495020-30495042 CCAACCACTGAGACTGAGGTGGG - Intergenic
1193061439 X:77212375-77212397 ATAAACACTGAGATTGCCCCAGG - Intergenic
1193347073 X:80416005-80416027 ACAACAACTGAGATTGAACCAGG - Intronic
1193944190 X:87711774-87711796 CAACCCACTGAGATTGAATCAGG + Intergenic
1193970797 X:88049610-88049632 CAACCTACTGAGATTGAACCAGG + Intergenic
1196271021 X:113710923-113710945 CTAACCACTGAGACTGAGCTGGG - Intergenic
1196293758 X:113976365-113976387 ATAGCCACTGTAATTGAGCCTGG - Intergenic