ID: 1173337929

View in Genome Browser
Species Human (GRCh38)
Location 20:42128082-42128104
Sequence ACATAGCAGCTCCATTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173337929_1173337934 4 Left 1173337929 20:42128082-42128104 CCCCTCAAATGGAGCTGCTATGT 0: 1
1: 0
2: 2
3: 13
4: 118
Right 1173337934 20:42128109-42128131 CCTGGCCAGTTGCTCCATCTTGG 0: 1
1: 0
2: 2
3: 74
4: 717
1173337929_1173337937 30 Left 1173337929 20:42128082-42128104 CCCCTCAAATGGAGCTGCTATGT 0: 1
1: 0
2: 2
3: 13
4: 118
Right 1173337937 20:42128135-42128157 GTGCTATTCTCTCTAACTAGAGG 0: 1
1: 0
2: 1
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173337929 Original CRISPR ACATAGCAGCTCCATTTGAG GGG (reversed) Intronic
900487206 1:2928657-2928679 GCAAAGCCGCTGCATTTGAGGGG - Intergenic
901141492 1:7036074-7036096 AGATAGCAGCTGCCTCTGAGAGG + Intronic
901550157 1:9990004-9990026 ACACAGCAGGTCCAAGTGAGTGG + Intergenic
911699121 1:100930311-100930333 AAATAGCAGCTTAATTTTAGAGG + Intronic
912381086 1:109248692-109248714 CCAAGGCAGCTTCATTTGAGAGG - Intergenic
915193697 1:154173310-154173332 ACATGGAATTTCCATTTGAGGGG - Intronic
917406723 1:174714630-174714652 ACATAGTAGCTCCAGTACAGTGG + Intronic
917534121 1:175862498-175862520 ACTTAGTATCTCCATTTCAGAGG + Intergenic
917617948 1:176765582-176765604 ACTTTGCAGCTCCATCTGGGAGG - Intronic
918350536 1:183651390-183651412 ACATAGCACTTCCATATGAGAGG - Intronic
920362086 1:205425997-205426019 ACAGAGCAGCTCCACTCCAGGGG + Intronic
922382012 1:225039458-225039480 ACATAACAGATACATTTGATGGG - Intronic
924917916 1:248593000-248593022 AAATAGCAGCTCCATAGAAGAGG + Exonic
1062887688 10:1031100-1031122 AAATTGCAGATTCATTTGAGAGG + Intergenic
1063245333 10:4212138-4212160 ACATACCAGCAACATGTGAGTGG - Intergenic
1065979969 10:30884193-30884215 ACAATACAGCTTCATTTGAGTGG - Intronic
1069287965 10:66740543-66740565 ACATGGCAGTTCCATTTAAGTGG + Intronic
1070159180 10:73855364-73855386 ACAGACCAGCTCCATTAGGGAGG + Intronic
1070700392 10:78597787-78597809 ACATGGAAGCTCCATTTGTTTGG + Intergenic
1070788189 10:79174427-79174449 AGATTGCACCTCCATTTGATGGG + Intronic
1072326112 10:94300396-94300418 ACACAGCACAGCCATTTGAGTGG - Intronic
1072723877 10:97799694-97799716 CCCTGGCAGCTCCATGTGAGTGG - Intergenic
1072780246 10:98245874-98245896 ACAGTGCAGCTCCATTTGAAAGG + Intergenic
1076505256 10:130968491-130968513 ATAAAGAAGCTCCATTTGAGAGG - Intergenic
1077178600 11:1202528-1202550 ACATAGCAGCACCAGTAGAGTGG + Intergenic
1077182861 11:1224304-1224326 ACAGAGCAGCTTCATGTTAGGGG + Intronic
1077430673 11:2514440-2514462 ACACAGCAGCTCCATTTCCAGGG + Intronic
1078890594 11:15553604-15553626 ACATAGAAGTTACATTGGAGAGG + Intergenic
1080968856 11:37246222-37246244 ACAAAGCAGCTCCAACTGGGTGG - Intergenic
1089388134 11:118081223-118081245 ACATACCAGATCTATCTGAGGGG + Intronic
1090258544 11:125302760-125302782 ACACGGCACCTCCCTTTGAGGGG - Intronic
1091771474 12:3154801-3154823 TCATGGCAGGTCCATGTGAGAGG - Intronic
1091949546 12:4581457-4581479 AAATTGCAGCTGCCTTTGAGAGG + Intronic
1092296247 12:7201345-7201367 ACATATCAGCTATATTTGGGAGG + Intronic
1094233029 12:28129909-28129931 ACATATAATCTCCATTAGAGAGG + Intergenic
1095355413 12:41267344-41267366 ACATGCCAGCTCCAGTTGATTGG - Intronic
1098778013 12:74646878-74646900 ACAAAGCAGTTCCTTTTCAGTGG - Intergenic
1098936964 12:76490988-76491010 ACACAGCAGGTCCAAGTGAGTGG + Intronic
1100353218 12:93804403-93804425 ATATACCAGCTACATCTGAGGGG + Intronic
1101217290 12:102596900-102596922 ACATAGCAGGACCAAGTGAGTGG - Intergenic
1104758435 12:131283010-131283032 CCATTGCAGCTCCATTTGGAGGG + Intergenic
1106029810 13:25989972-25989994 ACAAAGCACCTCCCTTAGAGCGG + Intronic
1106901008 13:34355143-34355165 ACATAGCTCTTCCATTTCAGGGG - Intergenic
1120356784 14:83444271-83444293 TCATAAGAGCTTCATTTGAGAGG + Intergenic
1126396028 15:48218591-48218613 TCACACCAGCTCCATTTTAGAGG + Intronic
1130232829 15:82109672-82109694 ACATGGCAGCTCCATACAAGGGG - Intergenic
1131345126 15:91639561-91639583 CCACAGCAGCTACATTGGAGGGG + Intergenic
1131733447 15:95306370-95306392 GAATAGCAGCTCCTTTTGTGGGG + Intergenic
1131977123 15:97958163-97958185 ACATTGTAGAGCCATTTGAGTGG - Intergenic
1135764050 16:25162100-25162122 ACATAGCAGTTCCACTTTCGTGG + Intronic
1143230576 17:5350766-5350788 ACATAACAGCTACATTTGAGGGG + Intronic
1148375029 17:47135486-47135508 ACATATCTGCTTTATTTGAGTGG + Intronic
1160055399 18:75474334-75474356 ACATGGCATCTCACTTTGAGGGG + Intergenic
1160229672 18:77037724-77037746 ACAGAGCAGCTTCATCAGAGAGG - Intronic
1162281672 19:9702979-9703001 ACATGCCCACTCCATTTGAGTGG + Intergenic
1162763033 19:12899796-12899818 AAATAGCAGCTTCTCTTGAGAGG + Exonic
1164726925 19:30471978-30472000 ACCGAGGAGCTCCATTAGAGGGG + Intronic
925645695 2:6034392-6034414 ACATTGAAGGTCCATATGAGAGG + Intergenic
926005393 2:9369598-9369620 ACAGAGCACCTGCATTTGAGTGG + Intronic
926366795 2:12140567-12140589 ACATAGCATCTGCATTTCACAGG - Intergenic
927819415 2:26249930-26249952 ATACAGCAGCTACATTTGGGTGG + Intronic
928859962 2:35845998-35846020 ACATAGCAGGTCCAAGTGAGTGG - Intergenic
935176709 2:100655266-100655288 ACCTAGAAGATTCATTTGAGAGG + Intergenic
936166209 2:110122025-110122047 ACTTACCACCTCCATTTGAAAGG + Intergenic
936720853 2:115251324-115251346 ACATAGCACCTCTCTTTGTGAGG + Intronic
941297936 2:163763681-163763703 TCATAGTAGCTACATTTTAGTGG - Intergenic
942788108 2:179724721-179724743 AAATAGAAGCTCCTTTTTAGAGG + Intronic
944670123 2:201987491-201987513 ACATAGCAGCTGGCTTTGAGTGG + Intergenic
944868658 2:203887418-203887440 ACCAAGAAGCTCCATTTAAGTGG + Intergenic
944931461 2:204524538-204524560 ACATAGCAGCTTCATTTATATGG - Intergenic
945363173 2:208916970-208916992 ACAAAGCAGCTCCCTTTTAGAGG + Intergenic
1169743726 20:8921756-8921778 ACAAAACAGGTCCATTTTAGAGG - Intronic
1170049743 20:12129212-12129234 ACAAAGCAGCTCCAACTGGGTGG - Intergenic
1170764054 20:19275159-19275181 GCATAGCAGCTCCTTTTGAGAGG - Intronic
1173337929 20:42128082-42128104 ACATAGCAGCTCCATTTGAGGGG - Intronic
1180123308 21:45768474-45768496 TCAAAGCAGATGCATTTGAGGGG + Intronic
949334828 3:2962947-2962969 ACAAGGCACCACCATTTGAGAGG - Intronic
949791224 3:7794094-7794116 ACATAGCAGGAATATTTGAGAGG + Intergenic
951591856 3:24274654-24274676 ACAAAGCAGCTCAATTTCACAGG + Intronic
955666089 3:61350441-61350463 GAATAGCAGCTCCATGAGAGTGG - Intergenic
957330213 3:78753695-78753717 ACACATCAGGTCCAGTTGAGGGG - Intronic
958665093 3:97127330-97127352 AGATAAGAGCTTCATTTGAGAGG - Intronic
959790923 3:110360016-110360038 ACATACCAGGGCCTTTTGAGGGG + Intergenic
964411978 3:156407322-156407344 ACAGAGGAGATGCATTTGAGCGG - Intronic
965823476 3:172708019-172708041 ACATAGCATCTGTGTTTGAGAGG + Intronic
967602282 3:191404436-191404458 ACAAAGCATCTCAATTTGAAAGG - Intergenic
969448682 4:7260280-7260302 ACACAGCAGACCCCTTTGAGTGG - Intronic
969457701 4:7309626-7309648 GCTTGGCAGCTCCATTTCAGAGG - Intronic
975404671 4:73976221-73976243 CCACAGCATATCCATTTGAGAGG + Intergenic
977043902 4:92045755-92045777 ACTTATCCACTCCATTTGAGTGG - Intergenic
982856380 4:160386654-160386676 ACCTATCAGCATCATTTGAGAGG + Intergenic
984132647 4:175897263-175897285 TCAGAGGAGCTGCATTTGAGAGG + Intronic
984523971 4:180834451-180834473 ACATAGACTCTCAATTTGAGTGG + Intergenic
987933220 5:24429217-24429239 ACATAGCAGATCTATTTGATCGG + Intergenic
991609523 5:68435959-68435981 AAGTGGCAACTCCATTTGAGTGG - Intergenic
993092850 5:83448467-83448489 ACATAGTAACTCCATTTGGGAGG - Intergenic
996850135 5:127942333-127942355 GCCTAGCTGCTCCCTTTGAGTGG - Intergenic
997392084 5:133525361-133525383 ACAAAGAAGCTGCCTTTGAGTGG - Intronic
1001007633 5:168067798-168067820 ACATTTCAGCTCCATGTGAAAGG - Intronic
1002675349 5:180908043-180908065 ACAAAGCAGCTCCAACTGGGTGG - Intronic
1004670990 6:17796709-17796731 AAATGGCAGCTCCATCTGGGAGG - Exonic
1009502199 6:64428908-64428930 ACATAGCAGCTGCATTTATGTGG - Intronic
1011508779 6:88077447-88077469 ACAAAGCAGCTTCCTTTGAAGGG + Intergenic
1012003101 6:93679296-93679318 ACATTACTGCTCCATTTGACAGG + Intergenic
1013313105 6:108915958-108915980 ACACAGCAGCCCCAGTTAAGAGG + Intronic
1020001317 7:4757704-4757726 ACATAGCAGGTACATTTGTTAGG + Intronic
1020044152 7:5027954-5027976 ACTTACCCACTCCATTTGAGTGG - Intronic
1023376064 7:39556764-39556786 ACATGTCAGCTCCATATGTGTGG + Intergenic
1023856174 7:44185655-44185677 ACATAGCTACTCCTTCTGAGGGG + Intronic
1027600268 7:80231572-80231594 AAGTAGCAGCTCCAGATGAGTGG - Intergenic
1028351562 7:89856595-89856617 ACATAGCAGCTTCATATTGGGGG + Intergenic
1028462208 7:91106964-91106986 ACCAAGCAGCTCCATGAGAGGGG + Intronic
1033572386 7:142643601-142643623 AAATAGAAGCTCCAAGTGAGAGG + Intergenic
1036759646 8:11498563-11498585 ACAAAGCAGCCACATCTGAGTGG + Intronic
1037741362 8:21611730-21611752 ACATAGCAGCACCGTGTCAGGGG + Intergenic
1041870657 8:62631050-62631072 AGAGAGCAGCTCCATTGGAATGG - Intronic
1043377306 8:79665192-79665214 ACCTAGCAAATTCATTTGAGTGG - Intronic
1043792943 8:84496526-84496548 ATATAGCAGCTTCATTTGCTTGG - Intronic
1044623883 8:94217553-94217575 AGAGAGCAGCTGCATTTGAGGGG - Intergenic
1046877908 8:119276840-119276862 ACATAGCAGCTCCTGTTGTTGGG + Intergenic
1049871726 8:144984332-144984354 ACATAGCAGCAGCATTTGGAGGG - Intergenic
1056139993 9:83666979-83667001 ACCTAGCAGCTCCATTTCTCTGG - Intronic
1059726057 9:117009076-117009098 TCATAGCTGCTCCATTTTAATGG - Intronic
1061517975 9:131100610-131100632 ACATAGCAGCACTACTGGAGTGG + Intronic
1186558856 X:10589430-10589452 ACTTGCCCGCTCCATTTGAGTGG - Intronic
1189030639 X:37446176-37446198 ATATAGCACCTCCATGTAAGAGG + Intronic
1190275455 X:48896535-48896557 ACAGAGGAGCTCCAGTTGGGTGG + Intronic
1190315556 X:49148343-49148365 ACTTACCCACTCCATTTGAGTGG - Intergenic
1190626082 X:52340081-52340103 AGATAGAAGCTGCATTTAAGTGG + Intergenic
1195667636 X:107445221-107445243 GCTCAGCAGCTGCATTTGAGGGG + Intergenic
1197933673 X:131719005-131719027 ACATTGTAGCTGCATGTGAGTGG - Intergenic
1197940691 X:131785728-131785750 ACATTGTAGCTGCATGTGAGTGG - Intergenic
1197951072 X:131897663-131897685 CCATAGCAGCTCCTTGGGAGAGG + Intergenic
1199716128 X:150508446-150508468 ACACGGCAGCTCCAGTGGAGGGG + Intronic