ID: 1173338948

View in Genome Browser
Species Human (GRCh38)
Location 20:42136923-42136945
Sequence ACCTAAGCAGAGAGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 11, 3: 42, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173338940_1173338948 30 Left 1173338940 20:42136870-42136892 CCATTGTAGCAAGTTGAGGCTTA 0: 1
1: 0
2: 0
3: 10
4: 74
Right 1173338948 20:42136923-42136945 ACCTAAGCAGAGAGGGAGCTGGG 0: 1
1: 0
2: 11
3: 42
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173338948 Original CRISPR ACCTAAGCAGAGAGGGAGCT GGG Intronic
900457300 1:2783517-2783539 CCCCAAGGAGAGAGGGAGCCGGG - Intronic
901835157 1:11919337-11919359 ATCTTAGCAGGGAAGGAGCTAGG + Intergenic
902180570 1:14685279-14685301 ACCTTAGGGGTGAGGGAGCTGGG + Intronic
902704733 1:18196749-18196771 CCCTAGGCAGTGACGGAGCTGGG + Intronic
903018236 1:20375675-20375697 ACCTTAGGAGAGAGGCAGCCAGG + Intergenic
904747420 1:32719814-32719836 ACCCAGGCAGTGAGGGAGCAAGG - Intergenic
904813044 1:33176346-33176368 ACCCAAGGAGGGAGGGGGCTGGG - Intronic
905262750 1:36730965-36730987 ACCTAGGCAGAGAGGTTTCTGGG + Intergenic
905302686 1:36996563-36996585 TCCTAAGCTGAGAAGGAGGTGGG + Intronic
905303531 1:37001929-37001951 AACTAGGGAGAGAGGAAGCTGGG + Intronic
905394961 1:37661077-37661099 ACATCAGTAGAGAGGGGGCTGGG + Intergenic
906518460 1:46453325-46453347 ACAGAAGCAGAGAGGGAGAGAGG + Intergenic
907528491 1:55069637-55069659 ACCTAAGCTGAGTGAGAGTTGGG + Intronic
908897067 1:68912339-68912361 ACCTAAACACTGAGGCAGCTGGG - Intergenic
909113930 1:71510590-71510612 ACTTAAGCAGAGAAGGGGATGGG + Intronic
909821296 1:80065103-80065125 ACCTAAGCAGAGAGAGAGTCAGG + Intergenic
911030072 1:93478299-93478321 GCCTAAGCAGAGAGAGAGAGAGG + Intronic
911123900 1:94322672-94322694 ACCGAAGCTTAGAGGGAGGTAGG + Intergenic
914044982 1:144083869-144083891 ACCTGAGAGGTGAGGGAGCTGGG + Intergenic
914133128 1:144876817-144876839 ACCTGAGAGGTGAGGGAGCTGGG - Intergenic
917495147 1:175533844-175533866 AACTAGGCATAGAGGAAGCTTGG + Intronic
917690810 1:177466516-177466538 ACCTAAGAAAAGAGGTACCTGGG + Intergenic
918630428 1:186710661-186710683 ACCTGAGAAGAGAGGGAGTAGGG + Intergenic
920557244 1:206913162-206913184 AAAGAAGCAGAGAAGGAGCTGGG + Intronic
922176804 1:223203337-223203359 ACATCTGCAGAGAGGGAGTTAGG + Intergenic
922184422 1:223261404-223261426 AGCTAGGAAGAGGGGGAGCTGGG - Intronic
1066202944 10:33159534-33159556 ACCTTAGCAGAGGAGTAGCTTGG + Intergenic
1066957109 10:42183551-42183573 ACCTGAGAGGTGAGGGAGCTGGG + Intergenic
1067286865 10:44913231-44913253 ACCAAAGCCTAGAGGGAGCAGGG - Intronic
1067808902 10:49411943-49411965 ACCTAAGCTGGGAAGGAGGTGGG + Intergenic
1068084330 10:52355977-52355999 ACCTAATTAGAGATGGAGTTGGG + Intergenic
1069779612 10:70946407-70946429 ACCCAAGGAGTGAGGGAGCAGGG + Intergenic
1069902989 10:71716526-71716548 AGCTGAGCAGTGATGGAGCTGGG + Intronic
1070678789 10:78434405-78434427 ACCGAAGCAGAGAAGGAGTGGGG - Intergenic
1070691467 10:78530324-78530346 AGCTAATAAGAGAAGGAGCTGGG + Intergenic
1071495562 10:86165400-86165422 ACCAAGGCAGAGAGGGAAATGGG + Intronic
1071531259 10:86391789-86391811 ACCTTAGCAGACAGGATGCTGGG + Intergenic
1071552879 10:86580770-86580792 ACCTGAAGAGAGAGGAAGCTGGG + Intergenic
1071560993 10:86646769-86646791 TCCAGAGCAGAGATGGAGCTAGG + Intergenic
1071719686 10:88130945-88130967 AACTAAGCAGCTAGGAAGCTGGG + Intergenic
1071920836 10:90348288-90348310 ACCTAACCAGAAAGGGAGAGTGG - Intergenic
1072565386 10:96612743-96612765 ACCTAAGCAACGAGACAGCTGGG - Intronic
1073225977 10:101919389-101919411 AGCCAAGCAGAGAGGGAGCTGGG - Intronic
1074424973 10:113342725-113342747 ACCTGGGCAGATAGGGAGCCAGG + Intergenic
1074889891 10:117726731-117726753 TCCTAAGCTGAGAGGCTGCTGGG - Intergenic
1074963574 10:118469413-118469435 ACCTGAGCAGAGGGTGAGGTGGG + Intergenic
1075096865 10:119477730-119477752 GCCTCCCCAGAGAGGGAGCTGGG + Intergenic
1075649349 10:124117445-124117467 ACCAAGGCAGAGAGGGAGGGTGG - Intergenic
1075683721 10:124349835-124349857 ACATAAGAGGAGAAGGAGCTGGG - Intergenic
1078126086 11:8564884-8564906 TCCTAAGCAGAAAGAGATCTAGG + Intronic
1078546749 11:12252539-12252561 TCCTAATCAGAAAGGGAGCAAGG + Intronic
1079098189 11:17524461-17524483 ACCTCAGCAGACAGGGAGCCAGG + Exonic
1080653814 11:34242956-34242978 ACCAAAGCTGGGAGGAAGCTGGG + Intronic
1081371646 11:42311582-42311604 AACTGAGCAGTGAGGGAGCTGGG + Intergenic
1081428095 11:42947308-42947330 AGCTAAGCAGAGATGGAGCTGGG - Intergenic
1083989464 11:66237987-66238009 GCCTAGGCAAAGAGGCAGCTGGG - Intronic
1084299323 11:68236112-68236134 ACCTATTCAGAGAGGAATCTGGG - Intergenic
1084426858 11:69088841-69088863 ACCTCAGCAGAAAGGGGGCGTGG - Intronic
1085534049 11:77207569-77207591 GCCTCAGAAGAGAGAGAGCTGGG - Intronic
1087757991 11:102074433-102074455 ACACAAGCACAGAAGGAGCTGGG - Intronic
1088281959 11:108144139-108144161 GCCAAAGCAGAGAGATAGCTTGG + Intronic
1090018117 11:123103801-123103823 ACCTAAGCAGAGAGGGGCCTGGG + Intronic
1093829145 12:23734334-23734356 ACCAAAGCAGAAAGGTACCTGGG - Intronic
1094345206 12:29460620-29460642 ATCTGAGGAGCGAGGGAGCTGGG - Intronic
1095255547 12:40031598-40031620 ACCAAGGCAGAGAGGATGCTCGG + Intronic
1096169852 12:49459130-49459152 ATTTAAGCAGAGAAGGAGATGGG + Intronic
1097220948 12:57450715-57450737 ACCTAGACAGAGAGGGAACAGGG - Exonic
1099464046 12:82960619-82960641 ACTAAAGCAGAGAGGGAGGGAGG + Intronic
1100390553 12:94142927-94142949 AGATCAGCAGAGAGGGAGCTGGG + Intergenic
1101033250 12:100680169-100680191 ACCCAAGTAGCAAGGGAGCTGGG - Intergenic
1101271034 12:103144789-103144811 ACTTAAGCAGAAAGGGATTTTGG + Intergenic
1101320048 12:103665592-103665614 ACCAAAGCAGAGAGGGAGCAGGG + Intronic
1101805025 12:108056155-108056177 ACTTGAGCAGCAAGGGAGCTGGG - Intergenic
1102196474 12:111028980-111029002 AGCAAAGTAGGGAGGGAGCTGGG + Intergenic
1102414688 12:112750464-112750486 ATCTAAGGAGTGAGGGAGCTGGG + Intronic
1102814497 12:115853419-115853441 ACCCAGGCAGCGAGGCAGCTGGG + Intergenic
1103207104 12:119138538-119138560 AACCAAGGAGTGAGGGAGCTGGG - Intronic
1103226252 12:119290586-119290608 AACTCAGCAGTGAGGGATCTCGG + Intergenic
1103982636 12:124746385-124746407 AGCTAAAAAGAGAGGGAGCCAGG - Intergenic
1105749650 13:23410822-23410844 ACCTGAGGAGAGAGGGAGAGGGG - Intronic
1107991860 13:45825835-45825857 GCCTAGGAAGCGAGGGAGCTGGG - Intronic
1108680068 13:52772397-52772419 ACCTAAGGGGTGGGGGAGCTGGG - Intergenic
1109265879 13:60199705-60199727 GCCCAAGGAGAGAGGGAGATGGG + Intergenic
1112467575 13:99657614-99657636 ACCTAATTAGAGGGGGAGATGGG + Intronic
1112754886 13:102621469-102621491 AACTAAGCAGAGAGGTAGAAAGG + Intronic
1112951145 13:104998395-104998417 GAGTAAGCAGAGAGGCAGCTTGG + Intergenic
1117574113 14:57081085-57081107 ACATAAGCAGAGAGTGAGGTGGG + Intergenic
1118164951 14:63326943-63326965 AGCTAAGCAGCGATGGAGCTGGG + Intergenic
1118527312 14:66661084-66661106 ACTTAGGCAGGGCGGGAGCTTGG + Intronic
1118718348 14:68576132-68576154 ACCAGAGCAAAGAGGGAGCAGGG + Intronic
1121690262 14:95873222-95873244 AGGCAAGTAGAGAGGGAGCTAGG - Intergenic
1122783916 14:104155282-104155304 TCCTAAGAAGAGAGTTAGCTTGG + Intronic
1122931850 14:104936718-104936740 ACCTAGGCCAGGAGGGAGCTGGG + Exonic
1202936002 14_KI270725v1_random:88225-88247 ACCTGAGAGGTGAGGGAGCTGGG - Intergenic
1125843774 15:42831721-42831743 ACCTAAGCAGCAAGGAACCTTGG - Intronic
1126506554 15:49411041-49411063 AGCAAATGAGAGAGGGAGCTAGG + Intronic
1127912399 15:63428191-63428213 CCCTAAGGAGCAAGGGAGCTGGG + Intergenic
1128987212 15:72230461-72230483 ACCAGAGCAGAGAGGGAGGGAGG + Intronic
1130678918 15:85979448-85979470 ACCCAGGCAGGGAGTGAGCTGGG - Intergenic
1131496055 15:92912216-92912238 ATCCAATCAGACAGGGAGCTTGG - Intronic
1132107613 15:99074611-99074633 ATCTAAGCAGTGAGGGAGCTGGG + Intergenic
1133539121 16:6731638-6731660 ACCCATGGAGTGAGGGAGCTGGG - Intronic
1134328553 16:13229385-13229407 ACCTCAGGGGAGAGGCAGCTGGG + Intronic
1134505941 16:14806994-14807016 ACCTAAGGGGTGAGGGAGATGGG - Intronic
1134574608 16:15321788-15321810 ACCTAAGGGGTGAGGGAGATGGG + Intergenic
1134727805 16:16434522-16434544 ACCTAAGGGGTGAGGGAGATGGG - Intergenic
1134939631 16:18277305-18277327 ACCTAAGGGGTGAGGGAGATGGG + Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1137797802 16:51237025-51237047 ACCCAAACAGAGATGCAGCTAGG - Intergenic
1137821763 16:51452806-51452828 ACCTTCGCAGTGAGTGAGCTGGG - Intergenic
1139678913 16:68544721-68544743 ACCTCTGGACAGAGGGAGCTCGG - Intronic
1140276919 16:73517657-73517679 ACCTATGAGGTGAGGGAGCTGGG + Intergenic
1140901776 16:79374404-79374426 ACAAAAGCAGAGATGAAGCTTGG - Intergenic
1141771082 16:86089994-86090016 AGCTAGGAAGAGATGGAGCTGGG + Intergenic
1142813505 17:2407752-2407774 AACTCATCAGAGAGGGCGCTGGG - Intronic
1143506233 17:7367145-7367167 AGATAAGCAGAGAGGGTACTCGG - Intergenic
1144823819 17:18094049-18094071 AGCTAAGCAGAAAGGCAGCGAGG - Intronic
1145397237 17:22505826-22505848 ACCTAGCCAGGGAGGGAGCAGGG + Intergenic
1148258343 17:46156445-46156467 ACCTGAGAAGAGATGGATCTAGG - Intronic
1149572862 17:57685941-57685963 GCCTAAGGAGAGAGGGAGCAGGG + Intergenic
1151545186 17:74788518-74788540 ACCAAAGGAGAGAGGGAGCTGGG - Intronic
1153484767 18:5585840-5585862 ACCCAAGCAGGGAGGAAGCCTGG - Intronic
1153604703 18:6820362-6820384 ACTGAAGCAGAGAGAGAGTTGGG + Intronic
1153635883 18:7113186-7113208 ACTTCAGCAGAGAGAGAGCTGGG + Intronic
1154957728 18:21275721-21275743 ACCTCAGAAGAAAGGGATCTAGG + Intronic
1155137749 18:23013284-23013306 AGTTTGGCAGAGAGGGAGCTGGG + Intronic
1155139183 18:23028504-23028526 GCCTAAGCAGAAAGAGAGGTAGG + Intergenic
1155182368 18:23358890-23358912 TCCTAAGCAGAGAGGGTGCACGG + Intronic
1155920947 18:31602237-31602259 ATCATAGCAGAGAGGGAGATGGG - Intergenic
1157955185 18:52089121-52089143 AGGTAAGGACAGAGGGAGCTAGG - Intergenic
1158950252 18:62487961-62487983 AGCTAAGCAGAGAAGCAGCTTGG + Intergenic
1160061320 18:75531713-75531735 CCCTAACCAGGCAGGGAGCTGGG - Intergenic
1161610865 19:5241791-5241813 ACCTGAGCAGGGAGGGAGACTGG + Intronic
1162541682 19:11300343-11300365 ACTCAAGTGGAGAGGGAGCTGGG + Intronic
1162601656 19:11674409-11674431 AGCTGACCAGAGAGGGCGCTGGG - Intergenic
1162842880 19:13369197-13369219 TACTAAGAAGAGAGGCAGCTGGG - Intronic
1162885924 19:13697040-13697062 ACTTGAGGGGAGAGGGAGCTGGG + Intergenic
1162991735 19:14307274-14307296 ACCCAAGTGGAGAGGGAGCTGGG - Intergenic
1163170033 19:15524967-15524989 ACCCAAGGGGTGAGGGAGCTGGG + Intronic
1163348002 19:16756852-16756874 ACCTGACAAGAGGGGGAGCTCGG - Intronic
1163631721 19:18420977-18420999 ACCCAAGCAGAGAGGAGGCTGGG + Intronic
1166387764 19:42391580-42391602 TCCTGAGCAGGGAAGGAGCTGGG + Intergenic
1166657559 19:44623341-44623363 CACATAGCAGAGAGGGAGCTGGG + Intronic
1167248887 19:48390600-48390622 ACAGAAGGAGAGAGGAAGCTGGG + Intronic
1202684540 1_KI270712v1_random:37273-37295 ACCTGAGAGGTGAGGGAGCTGGG + Intergenic
925653641 2:6120912-6120934 ATCAAAACAGAGAGGTAGCTGGG + Intergenic
927642863 2:24856514-24856536 ACCTAAGCAGAGGGGGCTGTGGG + Intronic
929000740 2:37344927-37344949 ACCTAGGCAGAGCGGGAGGCGGG + Intronic
929215924 2:39413320-39413342 ACCTAATTAACGAGGGAGCTAGG + Intronic
929978718 2:46658949-46658971 GCCCCAGCAGAGAGGGAGCAGGG - Intergenic
929988270 2:46759579-46759601 ATGTTAGCAGACAGGGAGCTTGG + Exonic
930024050 2:47019692-47019714 ACCCATGCAGAGAGGGTGCCAGG - Intronic
931774074 2:65524866-65524888 ACCCAAGAGGTGAGGGAGCTGGG + Intergenic
934168825 2:89321911-89321933 ACCTAAGAAGGGAGGGAGATGGG - Intergenic
934198466 2:89860673-89860695 ACCTAAGAAGGGAGGGAGATGGG + Intergenic
934247179 2:90317573-90317595 ACCTGAGAGGTGAGGGAGCTGGG - Intergenic
934262147 2:91485030-91485052 ACCTGAGAGGTGAGGGAGCTGGG + Intergenic
934790773 2:97058290-97058312 AGCTGAAAAGAGAGGGAGCTGGG + Intergenic
934815681 2:97324240-97324262 AGCTGAGAAGAGAGGGAGCTGGG - Intergenic
934822014 2:97384243-97384265 AGCTGAGAAGAGAGGGAGCTGGG + Intergenic
934991719 2:98926357-98926379 ACCTCAACTGAGAGGGGGCTGGG + Intronic
935828997 2:106979634-106979656 AACTCAGCAGTGAGGGAGCTGGG + Intergenic
936181948 2:110274761-110274783 AACTAAGCAGAGCTGGGGCTAGG + Intergenic
936230620 2:110696912-110696934 AACTAAGCAGAGCTGGGGCTAGG - Intergenic
937492292 2:122382694-122382716 AGCTCAGCAGGGAGGGAGCCAGG - Intergenic
938592629 2:132753952-132753974 ACCTGAGGAATGAGGGAGCTGGG - Intronic
940053247 2:149486312-149486334 ACCTGAGCAGTGAGGGGGCATGG - Intergenic
940080943 2:149800634-149800656 AACTGATCAGAGAGGAAGCTGGG + Intergenic
945911668 2:215656871-215656893 CCCTAAGCAGAGAGAATGCTTGG - Intergenic
946601134 2:221361539-221361561 ACCTCAGCAGAGAGGGAGCAGGG - Intergenic
947595806 2:231410909-231410931 ACCTAAACTGAGAAGGAGCAGGG + Intergenic
948968205 2:241401356-241401378 AACTAAGCAGAGGTGGAGGTGGG - Intronic
1169076440 20:2762714-2762736 ACCTGAGGAGTGAGGCAGCTGGG + Intergenic
1169252018 20:4068234-4068256 GCCTGAGGAGTGAGGGAGCTGGG + Intergenic
1169297202 20:4410478-4410500 ACTTAAGCAGCGAGGAAGCTGGG - Intergenic
1169978524 20:11357605-11357627 AACTGAACAGAGAGGGAGCAGGG + Intergenic
1170121416 20:12916656-12916678 ATCTAAGGAGGGATGGAGCTAGG + Intergenic
1170580864 20:17698534-17698556 ACCTGAGCAGGGAGGGAGCTGGG + Intronic
1170732251 20:18985404-18985426 ACCTGAGGAGTGAGGGAGCTGGG + Intergenic
1170860869 20:20102357-20102379 ACCTGAGGAGTGAGGGAGCTGGG - Intronic
1171499159 20:25579707-25579729 ATCCATGGAGAGAGGGAGCTTGG - Intronic
1173239001 20:41276532-41276554 AGCTAAGCATTGAGAGAGCTCGG - Intronic
1173338948 20:42136923-42136945 ACCTAAGCAGAGAGGGAGCTGGG + Intronic
1173964175 20:47099146-47099168 ACCCAAGGAGTGAGGGAGCTGGG + Intronic
1174657162 20:52181235-52181257 AAATAAACAGAGAGGGGGCTGGG - Intronic
1174710993 20:52705414-52705436 ACCTTAGCTGAGAGGGTGGTGGG - Intergenic
1175569129 20:60005931-60005953 CCCTAAGCAGGGAGGGAACTTGG - Intronic
1176234154 20:64046477-64046499 ACCTATGCAGAGGGGGTGCTGGG + Intronic
1177725458 21:24961061-24961083 ATACAAGCAGAGAGGGAGCTAGG - Intergenic
1177741620 21:25161242-25161264 ACCTAGACAGAGAGGGAATTGGG - Intergenic
1180280348 22:10687905-10687927 ACCTGAGAGGTGAGGGAGCTGGG - Intergenic
1180587570 22:16906442-16906464 ACCTGAGAGGTGAGGGAGCTGGG - Intergenic
1180996893 22:19970327-19970349 AGCTAGGCAGGGAGGGGGCTGGG - Exonic
1181428255 22:22857846-22857868 ACCTGTGCAGAGAGTGAGCAGGG - Intronic
1181929485 22:26388624-26388646 CTCTGAGCAGTGAGGGAGCTGGG + Intergenic
1182050391 22:27308709-27308731 ACCTGAGGAGTGAGGGAGCTGGG - Intergenic
1182078173 22:27509325-27509347 ACCTGAGTGGGGAGGGAGCTGGG + Intergenic
1183267608 22:36838895-36838917 ACCCAAGCAGAGAGCCTGCTGGG + Intergenic
1183302467 22:37065069-37065091 GCCTTGGCAGACAGGGAGCTGGG + Intergenic
1183786178 22:40030395-40030417 CCCAAGGCAGGGAGGGAGCTTGG + Exonic
1183833816 22:40435510-40435532 TCATGAGCAGAGAAGGAGCTTGG - Exonic
1184030433 22:41891198-41891220 AGCTGAGCAGGGAGGGAGATTGG - Intronic
1184276258 22:43411359-43411381 ACCTATTCAGACTGGGAGCTGGG + Exonic
1184972840 22:48039316-48039338 ACCTCAGAAGAGAAGGAGTTTGG + Intergenic
1185382519 22:50516647-50516669 ACCTGAGGAGAGAGGGAGGTAGG - Intronic
949656480 3:6226727-6226749 AGCTAAGCAGAGAGGGCCCTGGG + Intergenic
949872093 3:8597416-8597438 ACCAAAGCTGAGAGGAAGCCTGG - Intergenic
950191716 3:10981219-10981241 ACTCAAGGAGAGAGGGAGCTGGG - Intergenic
950292316 3:11795301-11795323 CCCTGAGCAGAGGGGGAGGTTGG - Intronic
950668857 3:14513397-14513419 ACCCATGCTGAGAAGGAGCTTGG + Intronic
950937045 3:16849854-16849876 ACCTAGGCATAGAGAGTGCTTGG + Intronic
951540223 3:23775445-23775467 AGCCAAGTGGAGAGGGAGCTGGG - Intergenic
952516053 3:34105679-34105701 GCCAACGCAAAGAGGGAGCTGGG - Intergenic
952861633 3:37817561-37817583 ACCCAAGGAGAGAGGGAGCTGGG + Intronic
953135229 3:40176181-40176203 ACCTCAGCTGAAAGGGACCTTGG - Intronic
953241302 3:41151710-41151732 AGGTAGGCAGAGTGGGAGCTTGG - Intergenic
954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG + Intronic
954204314 3:49046798-49046820 ACCTAAGCAGAGTGGCTTCTGGG - Intronic
954455257 3:50594704-50594726 ACCCAAGGGGTGAGGGAGCTGGG - Intergenic
955325756 3:58008463-58008485 ACCGAAGCGGAGCGGGAGCGGGG - Exonic
956163947 3:66382350-66382372 CCCTGAGAAGAGAGGTAGCTTGG + Exonic
956644979 3:71446449-71446471 CCCTAAGGAGGGAGGGAGCCAGG + Intronic
956727726 3:72170245-72170267 ACCTAAGTTGTGAGGAAGCTGGG - Intergenic
956860044 3:73314039-73314061 ACCTAAGCAGCAAGAGAGGTTGG + Intergenic
956989648 3:74748555-74748577 ACCTGAGGAAGGAGGGAGCTGGG + Intergenic
957139981 3:76341696-76341718 ACCTAACCAAAAAGGAAGCTGGG + Intronic
958797724 3:98723906-98723928 ACCTAAGGAGAGAAAGAGTTTGG + Intergenic
958915936 3:100050305-100050327 ACTTACACAGAGAGGGAGTTTGG + Intronic
960015819 3:112886166-112886188 GGCTAAGAAGAGAGGAAGCTGGG - Intergenic
961033857 3:123628864-123628886 ACCTCAACAGAGGAGGAGCTGGG + Intronic
961648544 3:128405811-128405833 ACCAGAGCAGGGAGGAAGCTGGG - Intronic
962711612 3:138091254-138091276 AGCTAAGAAGAGATGGAGCTGGG - Intronic
966149241 3:176848572-176848594 ACCTAATCAGAGAGAGGGGTGGG + Intergenic
968145161 3:196292378-196292400 ACCCAAGGAGCCAGGGAGCTGGG - Intronic
968654657 4:1773298-1773320 ATCTGAGCAGGAAGGGAGCTGGG - Intergenic
969058531 4:4416755-4416777 ACCAGAGCAGAGAGGGGCCTTGG - Intronic
969447505 4:7253585-7253607 ACCTCATCTGGGAGGGAGCTGGG - Intronic
969715389 4:8865857-8865879 CCCAAAGCAGCGAGGGAGCCCGG + Intronic
972564021 4:40253844-40253866 TCCTAAGAAGAGAGGAACCTGGG + Intergenic
978343677 4:107742931-107742953 ACCTAAGAGGAGAGGGAGTTGGG + Intergenic
979345406 4:119580766-119580788 ACTTAAGCAGAGAGGCAGAGTGG - Intronic
979693197 4:123582464-123582486 CCCTAAGCAATGAGGGAACTTGG + Intergenic
980220729 4:129910481-129910503 ACCTAAGCAGGGAGGTAGTTGGG - Intergenic
980427442 4:132644752-132644774 ACAGTAGCAGAGAGGGAGCTAGG - Intergenic
980603970 4:135065064-135065086 ACCTGAAAAGAGAGGGAGCCAGG - Intergenic
980724219 4:136737454-136737476 AACTAAGCAGATAGGGACCATGG - Intergenic
981148083 4:141349305-141349327 ACCTCAGGAGAGAGCTAGCTGGG - Intergenic
981806183 4:148718053-148718075 CCCTAAAGAGAGAAGGAGCTTGG - Intergenic
982439660 4:155421141-155421163 ACCAAAGAAGACAGGAAGCTTGG - Intergenic
982466078 4:155734105-155734127 ACCTAACCTGAGACAGAGCTGGG - Intergenic
984088200 4:175338293-175338315 AGTTAAGCAGAGAGGCATCTTGG - Intergenic
987043224 5:14082706-14082728 ACTCAAGGGGAGAGGGAGCTGGG + Intergenic
987294144 5:16535456-16535478 GCCTTTGCAGAGTGGGAGCTGGG + Intronic
987412154 5:17625550-17625572 AACTCGGCAGAGAGGGTGCTGGG - Intergenic
989424782 5:41283612-41283634 GCATAAGGAGAGAGGGAGTTGGG + Intergenic
989576695 5:42994518-42994540 ACCGAAGCGGAGACCGAGCTTGG - Intergenic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
990731757 5:58816362-58816384 ACCTGAGGAGAAAGGGAGCTGGG + Intronic
991293043 5:65051168-65051190 ACCTAAGAAGAAAGGGATTTGGG + Intergenic
991937371 5:71815437-71815459 ACCTAGGAAGTGAGGGAACTGGG + Intergenic
992061270 5:73050266-73050288 AGCTAAACAGAGAGGGAGGGAGG - Intronic
996233215 5:121092069-121092091 ACCTCAGCAGTGAGGGAGCTGGG + Intergenic
997009204 5:129857134-129857156 ATCTAAGGGGAGAAGGAGCTGGG - Intergenic
997507258 5:134427226-134427248 ACCTAAGTAGAGAGTGCTCTTGG + Intergenic
997665963 5:135629699-135629721 AACCAAGGAGCGAGGGAGCTGGG + Intergenic
1001325442 5:170720418-170720440 TGCTTACCAGAGAGGGAGCTGGG - Intronic
1002554585 5:180025752-180025774 ACCTCAGAAAAGATGGAGCTTGG - Intronic
1002876020 6:1209951-1209973 ACATGAGCAGAGAGGTAGCAGGG + Intergenic
1005443491 6:25897241-25897263 ACCTAAGCAGAGTGAGAGAGAGG - Intergenic
1006132565 6:31878124-31878146 TTCTGAGGAGAGAGGGAGCTGGG - Intronic
1006942507 6:37762399-37762421 ACCCCAGCAGAGGGGCAGCTGGG - Intergenic
1007083233 6:39123767-39123789 CCATAAGGAGTGAGGGAGCTAGG - Intergenic
1007273376 6:40655629-40655651 GCTGAAGCAGGGAGGGAGCTGGG + Intergenic
1007496295 6:42262101-42262123 CCCTGGGCAAAGAGGGAGCTTGG + Intronic
1008154610 6:47998294-47998316 AGCTAAGCAGGGAGGGACATGGG - Intronic
1008235974 6:49050566-49050588 GTCTAAGCAGAAAGTGAGCTGGG - Intergenic
1009887938 6:69646810-69646832 ACCTAATAAGAGTGGGAGCAGGG + Intergenic
1011411058 6:87066887-87066909 ACTTAAGCTGAGAGTGAGATTGG + Intergenic
1011501729 6:87997902-87997924 ACTTAAGCAGGGAGGGGGGTGGG - Intergenic
1011631653 6:89332054-89332076 TCCTATTCAGAGAGTGAGCTGGG - Intronic
1014479869 6:121922465-121922487 ACTCAAGCACAGAGGGAGCTAGG + Intergenic
1014745110 6:125191695-125191717 ATCTGAGGAGAGAGAGAGCTGGG + Intronic
1015819245 6:137243218-137243240 ACATAATCAAGGAGGGAGCTGGG - Intergenic
1016823256 6:148365652-148365674 ACTGAAGGAGAGATGGAGCTAGG + Intronic
1017212528 6:151872695-151872717 ACCAAAGCAAAGAGGGAGTATGG - Intronic
1018264388 6:162006618-162006640 TCGTAAGCAGAGAAAGAGCTTGG - Intronic
1021950370 7:25768527-25768549 AGCTCAGCTGAGAGGGAGGTGGG + Intergenic
1022337928 7:29439959-29439981 ACCTAGTAAGAGAAGGAGCTGGG + Intronic
1022595221 7:31707047-31707069 ACCAACCCAGAGAAGGAGCTGGG - Intronic
1022805934 7:33822768-33822790 ACCTAATAAGAGAGGGAGCCAGG + Intergenic
1022889572 7:34682508-34682530 ACCTAAGCAGCCAGGTGGCTTGG - Intronic
1023125056 7:36947116-36947138 CCCAAAGCAGAGAGGGAGCAGGG - Intronic
1025249195 7:57340696-57340718 AGCTAAGAAGGGATGGAGCTAGG - Intergenic
1026049517 7:66933153-66933175 ACCAAAACAAAGCGGGAGCTAGG - Intronic
1028132147 7:87188018-87188040 ATCTAAGCAGCAAGGGAGGTGGG - Intronic
1029597085 7:101543642-101543664 CCCTAAGCAGAGAGACAGCAGGG + Intronic
1031810808 7:126366470-126366492 AAATGAGCAGAGAGAGAGCTGGG + Intergenic
1032489441 7:132313107-132313129 AGGTAGGCAGAGAGGGAGGTTGG - Intronic
1034440098 7:151081899-151081921 TCCTGAGGAGAGAGGGACCTGGG + Exonic
1034971897 7:155424423-155424445 AGCTCAGGAGAGAGGGAGCCAGG - Intergenic
1035367060 7:158355903-158355925 AGATAAGCAGAGAGGCAGCAGGG - Intronic
1037674231 8:21040423-21040445 ACAGAAGCAGAGAGGGAGGGAGG - Intergenic
1037806069 8:22058508-22058530 ACCAAACCAGAGAGAGACCTAGG + Intronic
1037906283 8:22717741-22717763 ACCTAAGAGGAGAGGCAGCGAGG - Intronic
1041252296 8:55946167-55946189 ACCAAAGAAGAGGAGGAGCTAGG + Intronic
1044495946 8:92882814-92882836 AGGTAAGTAGAGAGGGAACTGGG - Intergenic
1044722078 8:95160357-95160379 ACCTATGCAGAGAAGCAGCCTGG - Intergenic
1046908713 8:119602869-119602891 ACATGAGCAGTGAGAGAGCTGGG + Intronic
1047037875 8:120959666-120959688 ACTTATGCAGAGAGGGAGTTTGG + Intergenic
1047207935 8:122818484-122818506 AACTAGGCAGAGAGGGAGGAGGG - Intronic
1047340169 8:123973413-123973435 ACCTGAGGAGAGAGAGAGCAGGG - Exonic
1049189423 8:141278713-141278735 AGCTGACCAGAGAGGAAGCTGGG + Intronic
1049449755 8:142654359-142654381 ACATCAGCAGGGAGGGAGCCAGG - Intergenic
1049684576 8:143934199-143934221 TCCTAAGGCGAGTGGGAGCTTGG + Intronic
1050775639 9:9256813-9256835 TTATAAGCAGAGAGGCAGCTGGG - Intronic
1051457606 9:17278083-17278105 GGCTCAGCAGAGAGTGAGCTGGG + Intronic
1053417107 9:37953679-37953701 ACCCTAGCACAGAGGGAGGTAGG - Intronic
1053569961 9:39294334-39294356 ATCTAAGCAGAGAGGTATCCAGG + Intergenic
1053835922 9:42135364-42135386 ATCTAAGCAGAGAGGTATCCAGG + Intergenic
1054091590 9:60853336-60853358 ATCTAAGCAGAGAGGTATCCAGG + Intergenic
1054113005 9:61128910-61128932 ATCTAAGCAGAGAGGTATCCAGG + Intergenic
1054127188 9:61324676-61324698 ATCTAAGCAGAGAGGTATCCAGG - Intergenic
1054594710 9:67053280-67053302 ATCTAAGCAGAGAGGTATCCAGG - Intergenic
1055574141 9:77646143-77646165 CCCCTAGGAGAGAGGGAGCTTGG - Intronic
1055837028 9:80455739-80455761 ACATAAGCAGAGATGGGGATAGG + Intergenic
1056269475 9:84932829-84932851 AACTAAGCAGAGAGGAAGCCTGG + Intronic
1057530307 9:95839218-95839240 GCCTGAGGATAGAGGGAGCTGGG - Intergenic
1058020864 9:100086688-100086710 AGCTAAAAAGAGAGGGAGCTAGG + Intronic
1058604295 9:106704322-106704344 ACCAAAGCATAGAGAAAGCTGGG - Intergenic
1059362270 9:113754084-113754106 TCCTAAGCTGAGAGGGTGGTGGG - Intergenic
1059991266 9:119868663-119868685 CCCTAAGTGGAGTGGGAGCTTGG + Intergenic
1060945985 9:127569405-127569427 ACCTAAGCAGAGAAAGAGACGGG + Intronic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1186068821 X:5795477-5795499 AACTATGCAGAGAGGGAAATAGG - Intergenic
1186071283 X:5824030-5824052 GACTCAGCAGAGAGTGAGCTCGG + Intergenic
1186435162 X:9536773-9536795 ACCTCAGCAGAAGGGGAGCTGGG + Intronic
1186536198 X:10351223-10351245 CCCCAAGCAGAGAGGGAGTATGG - Intergenic
1186756799 X:12679714-12679736 GTCTGAGGAGAGAGGGAGCTGGG - Intronic
1187100514 X:16186571-16186593 ACCCAAGGAGAGAGGGAGCTGGG + Intergenic
1187127672 X:16469301-16469323 ACCCAAGCAGAGGGGGAGGAGGG + Intergenic
1187243616 X:17534984-17535006 ACCTGAGAAGTGAGGAAGCTAGG - Intronic
1187823339 X:23311331-23311353 ACCTAAGAGGTGAGGAAGCTGGG - Intergenic
1188231032 X:27663626-27663648 GCCCAAGGAGAGAGGGAGATAGG - Intronic
1189330661 X:40142902-40142924 ACGTAGGCTGAGAGGAAGCTGGG - Intronic
1190692622 X:52924228-52924250 ACCTAAGCAGAGCGATTGCTTGG - Intergenic
1192422242 X:71044096-71044118 ATGTTAGCAGACAGGGAGCTTGG - Intergenic
1194652866 X:96536239-96536261 ACCTGAGCATAGAGGGAGTAGGG - Intergenic
1195692271 X:107636695-107636717 ACCCAAGATGAAAGGGAGCTGGG - Intronic
1196615786 X:117765833-117765855 AACTAAGCAGAGGGGGAATTGGG + Intergenic
1197959036 X:131983722-131983744 ACCTGAGGAGCAAGGGAGCTGGG - Intergenic
1201194237 Y:11475975-11475997 ACCTGAGAGGTGAGGGAGCTGGG - Intergenic