ID: 1173339610

View in Genome Browser
Species Human (GRCh38)
Location 20:42141551-42141573
Sequence CATGCGGAAGACCCCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173339610_1173339620 25 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG No data
Right 1173339620 20:42141599-42141621 CCCGACCTGAGGAATTGAGCAGG No data
1173339610_1173339613 -6 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG No data
Right 1173339613 20:42141568-42141590 CGCATGTCAGCCCTTTTGGCTGG No data
1173339610_1173339617 14 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG No data
Right 1173339617 20:42141588-42141610 TGGGCTTCTTCCCCGACCTGAGG No data
1173339610_1173339611 -10 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG No data
Right 1173339611 20:42141564-42141586 CTTCCGCATGTCAGCCCTTTTGG No data
1173339610_1173339614 -5 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG No data
Right 1173339614 20:42141569-42141591 GCATGTCAGCCCTTTTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173339610 Original CRISPR CATGCGGAAGACCCCACAGC TGG (reversed) Intronic