ID: 1173339610

View in Genome Browser
Species Human (GRCh38)
Location 20:42141551-42141573
Sequence CATGCGGAAGACCCCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173339610_1173339613 -6 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG 0: 1
1: 0
2: 0
3: 23
4: 171
Right 1173339613 20:42141568-42141590 CGCATGTCAGCCCTTTTGGCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1173339610_1173339614 -5 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG 0: 1
1: 0
2: 0
3: 23
4: 171
Right 1173339614 20:42141569-42141591 GCATGTCAGCCCTTTTGGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 115
1173339610_1173339617 14 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG 0: 1
1: 0
2: 0
3: 23
4: 171
Right 1173339617 20:42141588-42141610 TGGGCTTCTTCCCCGACCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 147
1173339610_1173339620 25 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG 0: 1
1: 0
2: 0
3: 23
4: 171
Right 1173339620 20:42141599-42141621 CCCGACCTGAGGAATTGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1173339610_1173339611 -10 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG 0: 1
1: 0
2: 0
3: 23
4: 171
Right 1173339611 20:42141564-42141586 CTTCCGCATGTCAGCCCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173339610 Original CRISPR CATGCGGAAGACCCCACAGC TGG (reversed) Intronic
900031810 1:378102-378124 CATGTGGAAGACCTCACAGGGGG + Intergenic
900052358 1:606293-606315 CATGTGGAAGACCTCACAGGGGG + Intergenic
900666160 1:3816905-3816927 CATGCAGACGGTCCCACAGCTGG - Intronic
901826965 1:11868402-11868424 CAGGCGTAAGCCCCCACACCCGG + Intergenic
902269778 1:15295176-15295198 CTTGCTGAAGGTCCCACAGCTGG - Intronic
902449025 1:16485030-16485052 CATCTGGTAGACCCCACAGCAGG + Intergenic
902468413 1:16631737-16631759 CACCTGGTAGACCCCACAGCAGG + Intergenic
902505727 1:16938254-16938276 CACCTGGTAGACCCCACAGCAGG - Intronic
903154713 1:21435921-21435943 CACCTGGTAGACCCCACAGCAGG - Intergenic
903488596 1:23710079-23710101 CATGCGCAGGATCACACAGCTGG + Intergenic
904624813 1:31796502-31796524 CATGCCCAAGACCACACTGCTGG + Intronic
904773793 1:32894858-32894880 GATGCGGGAGAACCCAGAGCTGG - Exonic
905241608 1:36585072-36585094 CTTGCCCAAGACCACACAGCTGG - Intergenic
905328121 1:37172518-37172540 CATGCCCAAGATCACACAGCTGG + Intergenic
905649647 1:39647659-39647681 CAGGCACAACACCCCACAGCTGG + Intergenic
905653256 1:39670647-39670669 GATGTGGAAGAGCCCACAGAGGG - Intronic
905891467 1:41521086-41521108 CTTGCCCAAGAGCCCACAGCTGG - Intronic
907472192 1:54681069-54681091 CTTGCAGCAGCCCCCACAGCAGG + Intronic
910455288 1:87391251-87391273 CATGTGGAAAACCCTACACCCGG + Intergenic
912014265 1:105013248-105013270 CATGAGTAAGCCACCACAGCTGG - Intergenic
912105273 1:106265227-106265249 GATGAGGAAGACTGCACAGCTGG + Intergenic
915545900 1:156597629-156597651 TTTGCTGAAGAGCCCACAGCTGG - Intronic
915745048 1:158149514-158149536 CTTGCTTAAGACCCCACAGCTGG + Intergenic
916428112 1:164700875-164700897 CATGCTCAAGGCCACACAGCAGG - Intronic
918085471 1:181241125-181241147 CATCTCCAAGACCCCACAGCAGG - Intergenic
919845310 1:201638706-201638728 CTTGCCCAAGACCACACAGCAGG - Intronic
1063657764 10:8009132-8009154 CAGGCCGAAGACCCCACCGCCGG + Exonic
1063692440 10:8299371-8299393 GCTGCGGGAGACACCACAGCAGG + Intergenic
1063895413 10:10676301-10676323 CATGGGGAAGTCCACACAGCTGG + Intergenic
1065718964 10:28606191-28606213 CAGGCGCAAGCCACCACAGCTGG + Intronic
1065778460 10:29144269-29144291 CTTGCCCAAGAGCCCACAGCCGG + Intergenic
1066414550 10:35208604-35208626 CATGCTGAAGATGACACAGCCGG - Intronic
1066482534 10:35810988-35811010 CCTGGGGAAGACCCCACCCCAGG - Intergenic
1067061769 10:43081452-43081474 CATGCGGAAGTCCCTACACAGGG - Intronic
1069379033 10:67823313-67823335 CATCCTGAAAACCCCAAAGCTGG - Exonic
1069572827 10:69504715-69504737 CATGTGGAACAGCCCACAGTAGG - Intronic
1069635587 10:69922910-69922932 CATGGGGAAAACCACACATCTGG - Intronic
1069660892 10:70122765-70122787 CTTGCTTAAGATCCCACAGCTGG - Intronic
1070160325 10:73862975-73862997 CTTGCCCAAGATCCCACAGCAGG + Intronic
1073479226 10:103775717-103775739 CTTGAGGATGACCACACAGCTGG + Intronic
1073878339 10:107950821-107950843 GCTGCGCAGGACCCCACAGCTGG - Intergenic
1076608163 10:131702731-131702753 CACTCAGAAGTCCCCACAGCTGG - Intergenic
1076978839 11:194695-194717 CGTGCGAAAGTCCCCACAGAGGG + Intronic
1081598269 11:44474245-44474267 CAAGTGGAAGCCACCACAGCAGG + Intergenic
1081786842 11:45753791-45753813 CACGAGGAGGACCCCACAGGAGG + Intergenic
1083404822 11:62449351-62449373 CAGGGGGCAGACCCCACAGGTGG - Intronic
1089561647 11:119346191-119346213 CATGAGGAATACCCAACAGAAGG - Intronic
1090999023 11:131892832-131892854 ATTGCAGAAGGCCCCACAGCAGG + Intronic
1092906161 12:13101794-13101816 CATTGGGAAGACCCCAGGGCGGG + Intronic
1095520036 12:43052625-43052647 AAGGCGTAAGGCCCCACAGCTGG + Intergenic
1101949183 12:109161264-109161286 CAGGCGTGAGACCCCACAACTGG - Intronic
1102058287 12:109913098-109913120 CCTGCCCAAGACCCAACAGCCGG - Intronic
1102540657 12:113616795-113616817 CAGGACAAAGACCCCACAGCGGG - Intergenic
1102885592 12:116519319-116519341 CATGCGTGAGCCCCCACACCTGG + Intergenic
1103424056 12:120816005-120816027 CATGCGTAAGCCACCACACCTGG + Intronic
1103946017 12:124526841-124526863 CATGAGTGAGACCACACAGCTGG - Intronic
1104991193 12:132624705-132624727 GCTGCAGAAGAACCCACAGCTGG - Exonic
1105492818 13:20904019-20904041 CAGGCGCAAGACACCACACCGGG - Intergenic
1105685537 13:22777474-22777496 CATGCTGAATATCTCACAGCAGG + Intergenic
1106409080 13:29498655-29498677 CAAGCAGAAAATCCCACAGCTGG + Intronic
1107218328 13:37948714-37948736 CAGGCGTAAGACACCACACCTGG + Intergenic
1109510391 13:63364732-63364754 CATGCGTGAGCCACCACAGCTGG - Intergenic
1112567736 13:100565753-100565775 CACACAGAAGTCCCCACAGCTGG - Intronic
1113880459 13:113622644-113622666 CAAGCGGGAGACCCCTCTGCAGG - Intronic
1118333159 14:64829921-64829943 CATGCACAAGACCCCTGAGCTGG - Intronic
1118981510 14:70720660-70720682 CATGCCCAAGACCGCACAACTGG - Intergenic
1119901194 14:78261217-78261239 CATGCTAGAGACCCCCCAGCTGG - Intronic
1121308954 14:92924421-92924443 GCTGGGGAAGTCCCCACAGCAGG - Intronic
1122125581 14:99576844-99576866 CATGCCCAAGACAGCACAGCGGG + Intronic
1125151634 15:36538954-36538976 CAGGCGCACGACCCCACACCCGG + Intergenic
1127733706 15:61822556-61822578 CGTGCCCAAGATCCCACAGCTGG - Intergenic
1129694002 15:77730367-77730389 CATGTCTAAGACCACACAGCTGG + Intronic
1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG + Intronic
1132664938 16:1077245-1077267 CATGCTGAGGTCACCACAGCCGG + Intergenic
1135831878 16:25781655-25781677 CTTACCCAAGACCCCACAGCTGG + Intronic
1136249120 16:28992078-28992100 CAGGCGGAAGCCACCACACCCGG - Intergenic
1138255949 16:55560711-55560733 CATGCCCAAGGCCACACAGCTGG + Intronic
1138635546 16:58335124-58335146 CATGCCCAAGGCCACACAGCTGG + Intronic
1140104630 16:71948358-71948380 CAGGCGTGAGCCCCCACAGCTGG + Intronic
1141662319 16:85448094-85448116 CAGGCGGAGGAGCCCAGAGCTGG - Intergenic
1142407728 16:89900447-89900469 CATGCGGAAAGCCCCCCAGGTGG + Intronic
1142466305 17:139400-139422 CATGCGAAAGTCCCCACAGAGGG + Intergenic
1142466325 17:139506-139528 CGTGCGAAAGTCCCCACAGAGGG + Intergenic
1144717670 17:17445696-17445718 CATGCGGAGGAAGCCAGAGCCGG - Intergenic
1146567242 17:33923997-33924019 CCTGCTGAAGATCACACAGCTGG - Intronic
1147645847 17:42033382-42033404 CTTGCCTAAGACCACACAGCTGG - Intronic
1151037032 17:70812349-70812371 CATGCGTAAGCCACCACACCCGG + Intergenic
1152947847 17:83207612-83207634 CATGTGGAAGACCTCACAGGGGG - Intergenic
1153537530 18:6118092-6118114 CATGGGGAAGAGGCCACAGATGG - Intronic
1153997566 18:10454952-10454974 CGTGCGGGAGGCCCCAGAGCAGG + Exonic
1155221079 18:23686460-23686482 CAGGCGTAAGCCCCCACACCTGG + Intergenic
1156479900 18:37429837-37429859 CCTACGGAAGACCCCACACTTGG + Intronic
1157064504 18:44331825-44331847 CAGACGGAAGACCACACAGTTGG + Intergenic
1158054822 18:53266051-53266073 AGTGAGGAAGACCCCAGAGCAGG - Intronic
1160514129 18:79469323-79469345 CATGCGGCAGTCCCCACCGTGGG + Intronic
1160710602 19:549373-549395 CCTGCGCAAGACCACACAGCCGG + Intronic
1161015234 19:1979938-1979960 AATGCGGACGACCCCACGGCCGG + Exonic
1161271376 19:3391371-3391393 CAGGCGTAAGCCACCACAGCCGG - Intronic
1161982878 19:7638963-7638985 CAGGCGGAAGAGGCCACAGCTGG - Intronic
1162340540 19:10089239-10089261 CTTGCCCAAGTCCCCACAGCTGG + Intronic
1165892547 19:39122735-39122757 CAGGCGGAAGCCACCACACCCGG + Intergenic
1166452302 19:42912650-42912672 CATGGGGAGGACCCCAAAACAGG + Intronic
1166454764 19:42931517-42931539 AATGCGGAGGACCCCAAAACAGG + Intronic
1167553128 19:50174804-50174826 CAGGCGTAAGCCACCACAGCCGG - Intergenic
925160057 2:1677469-1677491 CAGGTGGCAGACACCACAGCTGG + Intronic
925687369 2:6486509-6486531 CATGTGTGAGACCCCACACCCGG + Intergenic
928287674 2:30007753-30007775 CAGGTGGAAGACCCCACTGCAGG + Intergenic
930145167 2:47994651-47994673 CAGGCGTAAGCCACCACAGCTGG + Intergenic
944482829 2:200175023-200175045 CGTGCGCAGGAGCCCACAGCGGG - Intergenic
947980291 2:234403069-234403091 GATGCAGAGGCCCCCACAGCTGG - Intergenic
948823975 2:240565605-240565627 GATGCGGCAGAGCCCAAAGCTGG + Intronic
1170057418 20:12221950-12221972 CATGCGTAAGATCATACAGCTGG - Intergenic
1172036096 20:32011742-32011764 CATGTGCAAAACCCCACAGTGGG + Intronic
1172085679 20:32380472-32380494 CAGGCGTAAGACACCACACCTGG - Intronic
1173339610 20:42141551-42141573 CATGCGGAAGACCCCACAGCTGG - Intronic
1174202892 20:48819533-48819555 CTTGCTGAAGTCCACACAGCTGG - Intronic
1180981045 22:19878157-19878179 CCTGAGGGAGCCCCCACAGCTGG - Exonic
1181764760 22:25083582-25083604 CTTGCAGAAGATCACACAGCTGG + Intronic
1182362611 22:29755819-29755841 CATGGTGAAGACTCCACAGGAGG - Intronic
1182560474 22:31155125-31155147 CATGCCCAAGACTACACAGCTGG - Intergenic
1182659866 22:31917549-31917571 CATGGGTCAGACCCCAGAGCTGG - Intergenic
1183030389 22:35099603-35099625 TAAGGGGAAGACCCCACTGCAGG + Intergenic
1183072469 22:35406110-35406132 CAGACAGAAGACCACACAGCAGG + Intronic
1184572056 22:45331534-45331556 CATCAGGAAGACCTCACAGCCGG - Intronic
953463635 3:43101411-43101433 CATGTGGACTACTCCACAGCGGG + Intronic
955215390 3:56981204-56981226 CATGCCGATGTCCACACAGCTGG + Intronic
955688963 3:61571897-61571919 CTTGCCCAAGATCCCACAGCTGG - Intronic
960538449 3:118839184-118839206 CATGTGGAAGCCACCAAAGCTGG + Intergenic
960618915 3:119620878-119620900 CATGCCCAAGTCTCCACAGCTGG + Intronic
960640478 3:119817884-119817906 AATGCTGTATACCCCACAGCAGG - Exonic
961197738 3:125017330-125017352 CAGGCGTAAGCCACCACAGCCGG + Intronic
964484621 3:157174879-157174901 CATGTGCAAGACCCGGCAGCAGG + Intergenic
967236270 3:187386495-187386517 CTTGCCTAAGACCCCAAAGCTGG + Intergenic
969244988 4:5926036-5926058 CATGCGGACGACACGATAGCTGG + Intronic
969276749 4:6140961-6140983 CTTGCCTAAGACCCCAGAGCTGG + Intronic
969427955 4:7136940-7136962 CATGCAGCAGACCCCACGGCAGG + Intergenic
969689555 4:8696648-8696670 CTTGCTGAAAGCCCCACAGCTGG - Intergenic
970199374 4:13587480-13587502 CCTGCAGAAGACCCAACCGCTGG - Intronic
979530904 4:121768188-121768210 CTTGCTGAAGACCACACCGCTGG + Intergenic
979556732 4:122056245-122056267 CATGCACAATACCTCACAGCAGG + Intergenic
981335660 4:143566243-143566265 CAGGCGTGAGACACCACAGCTGG + Intergenic
983096756 4:163571497-163571519 CATACAGAAGACCACACAACAGG - Intronic
985813717 5:2111051-2111073 CCTGCGGTGGAGCCCACAGCTGG + Intergenic
987692205 5:21281788-21281810 CATTCAGAAGACCCCACAGAAGG + Intergenic
996482270 5:123988597-123988619 CATTCAGCAGGCCCCACAGCAGG - Intergenic
997585310 5:135040025-135040047 CATGCGGACGAAGCCAGAGCGGG + Intronic
999642893 5:153689624-153689646 CATGCTGAAGGCCACACAGCTGG - Intronic
1000004273 5:157168657-157168679 CATGCGTAAGCCACCACACCAGG + Intronic
1001228457 5:169965454-169965476 CTTGCTGAAGATCACACAGCTGG + Intronic
1002742010 5:181440766-181440788 CATGTGGAAGACCTCACAGGGGG - Intergenic
1002858161 6:1056314-1056336 GAAGCAGAAGACTCCACAGCCGG + Intergenic
1006354860 6:33549384-33549406 AATGGGGAAGAGCCCACAGCTGG - Intergenic
1007075194 6:39061781-39061803 CATGCTCAACATCCCACAGCTGG + Intronic
1007184676 6:39959110-39959132 CATGCTCAAGAACACACAGCTGG - Intergenic
1013607766 6:111766218-111766240 CTTGCCCAAGACCCCACAGCTGG + Intronic
1013791086 6:113837339-113837361 CTTGTGGGAGACTCCACAGCTGG + Intergenic
1019205756 6:170360205-170360227 CCTGCTCAAGACCCCATAGCTGG - Intronic
1019247147 6:170716504-170716526 CATGTGGAAGACCTCACAGGGGG - Intergenic
1019492263 7:1321098-1321120 GATGCAGCAGACCCGACAGCTGG + Intergenic
1019575487 7:1735624-1735646 CATGAGGGAGCCCCCAGAGCTGG + Intronic
1019585557 7:1800469-1800491 CAGGCGTAAGACACCACACCCGG - Intergenic
1022411156 7:30139663-30139685 CATGCAGAACAGCCCACAGGTGG + Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026863452 7:73808789-73808811 CAGGCGTGAGCCCCCACAGCTGG - Intronic
1028479110 7:91285138-91285160 CATGAAGAAGGTCCCACAGCAGG + Intergenic
1029846783 7:103419813-103419835 CAGGCGTAAGCCACCACAGCCGG + Intronic
1032341467 7:131077783-131077805 CTTGTGCAAGACCACACAGCTGG - Intergenic
1033238986 7:139661414-139661436 CATGTTGAAGACACCACAGATGG - Intronic
1034253348 7:149710148-149710170 CAGGCGGGAGACACCACACCTGG + Intergenic
1034532618 7:151706154-151706176 CATGCCCAAGGCCACACAGCTGG + Intronic
1035322816 7:158044664-158044686 CGTGCTGAAGAGACCACAGCTGG + Intronic
1035457377 7:159017386-159017408 CAGGCGCAAGACCGCACACCAGG - Intergenic
1035500990 8:91430-91452 CATGTGGAAGACCTCACAGGGGG + Intergenic
1036696261 8:10977066-10977088 CATGCCCAAGATCACACAGCTGG + Intronic
1038458397 8:27694132-27694154 CATGTCCAAGACCACACAGCTGG - Intergenic
1039883939 8:41645091-41645113 CTCGGGGAAGGCCCCACAGCTGG + Intergenic
1041712684 8:60908615-60908637 CGCTCGGAAGACCCCACAGCTGG - Intergenic
1045171073 8:99668870-99668892 CCTGCGGAACAGTCCACAGCAGG + Intronic
1046600298 8:116308691-116308713 AATGCAGAAGACCACACAGGTGG + Intergenic
1048113323 8:131491598-131491620 CATGGAGTAGAGCCCACAGCTGG - Intergenic
1048216989 8:132505424-132505446 CTTGCCCAAGACCACACAGCTGG + Intergenic
1048384047 8:133894568-133894590 CTTGCCCAAGATCCCACAGCTGG - Intergenic
1049665185 8:143839853-143839875 CATGGGGACGAACCCGCAGCTGG - Intronic
1056564797 9:87761754-87761776 CCTACCCAAGACCCCACAGCTGG + Intergenic
1056567748 9:87789717-87789739 CCTGCCCAAGACCCCAAAGCTGG - Intergenic
1203607922 Un_KI270748v1:71982-72004 CATGTGGAAGACCTCACAGGGGG - Intergenic
1185667168 X:1775005-1775027 TATGGGGAAGATCCAACAGCTGG - Intergenic
1185773755 X:2785887-2785909 CATTGGGAAGACCCCAGAGATGG + Intronic
1190046539 X:47115660-47115682 CAGGCGCATGACCCCACATCTGG - Intergenic
1194831799 X:98632264-98632286 CATGCTGTAGCCGCCACAGCTGG - Intergenic
1196647531 X:118133802-118133824 CTTGCTGAAGAACACACAGCTGG - Intergenic
1199991859 X:152991921-152991943 TTTGAGGAAGAACCCACAGCAGG - Exonic
1200241129 X:154494583-154494605 CATGTGGATGACCCCAACGCTGG + Intergenic
1201241125 Y:11957252-11957274 CTCGCGGATGACCCCAAAGCAGG - Intergenic
1201296130 Y:12464695-12464717 CATTGGGAAGACCCCAGAGATGG - Intergenic