ID: 1173339611

View in Genome Browser
Species Human (GRCh38)
Location 20:42141564-42141586
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173339610_1173339611 -10 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG No data
Right 1173339611 20:42141564-42141586 CTTCCGCATGTCAGCCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type