ID: 1173339614

View in Genome Browser
Species Human (GRCh38)
Location 20:42141569-42141591
Sequence GCATGTCAGCCCTTTTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173339610_1173339614 -5 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG No data
Right 1173339614 20:42141569-42141591 GCATGTCAGCCCTTTTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173339614 Original CRISPR GCATGTCAGCCCTTTTGGCT GGG Intronic