ID: 1173339617

View in Genome Browser
Species Human (GRCh38)
Location 20:42141588-42141610
Sequence TGGGCTTCTTCCCCGACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173339612_1173339617 -2 Left 1173339612 20:42141567-42141589 CCGCATGTCAGCCCTTTTGGCTG No data
Right 1173339617 20:42141588-42141610 TGGGCTTCTTCCCCGACCTGAGG No data
1173339610_1173339617 14 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG No data
Right 1173339617 20:42141588-42141610 TGGGCTTCTTCCCCGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173339617 Original CRISPR TGGGCTTCTTCCCCGACCTG AGG Intronic