ID: 1173339620

View in Genome Browser
Species Human (GRCh38)
Location 20:42141599-42141621
Sequence CCCGACCTGAGGAATTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173339616_1173339620 -3 Left 1173339616 20:42141579-42141601 CCTTTTGGCTGGGCTTCTTCCCC No data
Right 1173339620 20:42141599-42141621 CCCGACCTGAGGAATTGAGCAGG No data
1173339612_1173339620 9 Left 1173339612 20:42141567-42141589 CCGCATGTCAGCCCTTTTGGCTG No data
Right 1173339620 20:42141599-42141621 CCCGACCTGAGGAATTGAGCAGG No data
1173339610_1173339620 25 Left 1173339610 20:42141551-42141573 CCAGCTGTGGGGTCTTCCGCATG No data
Right 1173339620 20:42141599-42141621 CCCGACCTGAGGAATTGAGCAGG No data
1173339615_1173339620 -2 Left 1173339615 20:42141578-42141600 CCCTTTTGGCTGGGCTTCTTCCC No data
Right 1173339620 20:42141599-42141621 CCCGACCTGAGGAATTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173339620 Original CRISPR CCCGACCTGAGGAATTGAGC AGG Intronic