ID: 1173339623 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:42141609-42141631 |
Sequence | GGAATTGAGCAGGCAATGCT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1173339616_1173339623 | 7 | Left | 1173339616 | 20:42141579-42141601 | CCTTTTGGCTGGGCTTCTTCCCC | No data | ||
Right | 1173339623 | 20:42141609-42141631 | GGAATTGAGCAGGCAATGCTCGG | No data | ||||
1173339612_1173339623 | 19 | Left | 1173339612 | 20:42141567-42141589 | CCGCATGTCAGCCCTTTTGGCTG | No data | ||
Right | 1173339623 | 20:42141609-42141631 | GGAATTGAGCAGGCAATGCTCGG | No data | ||||
1173339615_1173339623 | 8 | Left | 1173339615 | 20:42141578-42141600 | CCCTTTTGGCTGGGCTTCTTCCC | No data | ||
Right | 1173339623 | 20:42141609-42141631 | GGAATTGAGCAGGCAATGCTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1173339623 | Original CRISPR | GGAATTGAGCAGGCAATGCT CGG | Intronic | ||