ID: 1173340440

View in Genome Browser
Species Human (GRCh38)
Location 20:42148348-42148370
Sequence CCTTCCAAATCTGACTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 10, 3: 50, 4: 417}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173340440_1173340442 25 Left 1173340440 20:42148348-42148370 CCTCAAAAGTCAGATTTGGAAGG 0: 1
1: 0
2: 10
3: 50
4: 417
Right 1173340442 20:42148396-42148418 TTTTATAGATCAGCAAAGTGAGG 0: 1
1: 4
2: 105
3: 1164
4: 6252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173340440 Original CRISPR CCTTCCAAATCTGACTTTTG AGG (reversed) Intronic
900698038 1:4024448-4024470 GCTCCCAAATATGAATTTTGGGG - Intergenic
901260925 1:7870124-7870146 CCTTCAACATATGAGTTTTGGGG - Intergenic
901720675 1:11194652-11194674 CCCCCCAAATCTCACCTTTGCGG - Exonic
901946837 1:12711115-12711137 CCTTCCACTCATGACTTTTGAGG - Intergenic
903817806 1:26077779-26077801 GCTTCCACATGTGAATTTTGGGG - Intergenic
903820857 1:26101453-26101475 CCTTCCACTTCTGCCTTGTGAGG + Intergenic
905625786 1:39490224-39490246 ACTTCCAAATGTGATTTTTGGGG + Intergenic
905671089 1:39790115-39790137 ACTTCTAAATGTGATTTTTGGGG - Intergenic
906526548 1:46496579-46496601 CCTTCCAACTCTGAGCTTTTGGG - Intergenic
906743710 1:48207179-48207201 CCTTCCACATCTGACCCTGGGGG + Intergenic
907684084 1:56592878-56592900 CCCTCTAAATCTTTCTTTTGGGG + Intronic
909131536 1:71742887-71742909 GCTTCAACATCTGAATTTTGGGG - Intronic
909294050 1:73923218-73923240 CCTTCAACATATGAATTTTGTGG - Intergenic
909828654 1:80157854-80157876 CTTTGCAAAGCTGCCTTTTGTGG + Intergenic
909870058 1:80728092-80728114 GCTTCAAAATATGAATTTTGGGG + Intergenic
910088141 1:83428734-83428756 CCATCCAAATGTGACTTCTTGGG + Intergenic
911107702 1:94149484-94149506 CCCTGCAAAGCTGTCTTTTGTGG - Intronic
911278601 1:95895320-95895342 CCTTGCAAAGCTGTCCTTTGTGG - Intergenic
911485841 1:98504176-98504198 CCTTGAAAAGCTGCCTTTTGTGG + Intergenic
912856094 1:113169896-113169918 CCTTCCAAATCTGTCTTCTCCGG + Intergenic
912856977 1:113178071-113178093 CCTTCCCAGACTGATTTTTGTGG - Intergenic
914408519 1:147402143-147402165 TCCTGCAAATCTGTCTTTTGTGG - Intergenic
915514097 1:156402610-156402632 CCCTCCAAATCCCAGTTTTGGGG + Intergenic
915620052 1:157076188-157076210 ACTGCCAAACCTCACTTTTGTGG - Intergenic
915999278 1:160599075-160599097 CCCTGCAAAGCTGCCTTTTGTGG - Intergenic
916445942 1:164871770-164871792 CCTTCCAACTCCGAGGTTTGGGG - Intronic
917027419 1:170659493-170659515 CTTTCCCCATGTGACTTTTGGGG - Intergenic
917176436 1:172240711-172240733 TCTTTCAACTCTGACTTATGTGG - Intronic
917250562 1:173055489-173055511 CCCCCCAAATCTGAATTTTGGGG + Intergenic
917899656 1:179529781-179529803 CCTTGCAAAGCTGTCTTTTGTGG - Intronic
917932246 1:179830754-179830776 CCTCCCATATCTGGGTTTTGGGG + Intergenic
919993492 1:202726433-202726455 CCTTCCAGATTAGACTTTGGGGG - Exonic
920963615 1:210684528-210684550 CCTTTCAAATATCACTTTTCTGG + Intronic
921441908 1:215197615-215197637 GCTTCAACATATGACTTTTGGGG + Intronic
923724779 1:236496516-236496538 CCCTGCAAATATGACTTCTGTGG - Intergenic
924813270 1:247421749-247421771 GCTTCCATATCTGGATTTTGAGG + Intronic
1064771782 10:18730729-18730751 GCTTCCACATATGAATTTTGGGG + Intergenic
1065601755 10:27375875-27375897 ACTTCTGAACCTGACTTTTGGGG - Intergenic
1066290694 10:34012011-34012033 CCTTGCAAAGCTGTCTCTTGTGG + Intergenic
1066676664 10:37894766-37894788 CCTTGTAAATGTGACTTATGTGG + Intergenic
1068518252 10:58050552-58050574 CCCTACAAAGCTGTCTTTTGTGG + Intergenic
1070894879 10:79975204-79975226 CCTTCCAGATCTTTCTTTTCCGG - Intronic
1071437785 10:85662858-85662880 CCCTCCAGATCTGACTCTTTAGG + Intronic
1071674175 10:87639229-87639251 CCCTGCAAAGCTGTCTTTTGTGG - Intergenic
1072762534 10:98068798-98068820 TCTTCCAACTCTGCCTTTTATGG + Intergenic
1072900028 10:99399108-99399130 CCCTGCAAAGCTGTCTTTTGTGG + Intronic
1074547413 10:114412100-114412122 ACTTCCAAAACTGACTTTCTTGG - Intergenic
1075226101 10:120630660-120630682 CCTTGCAAAGATGACTCTTGTGG + Intergenic
1075260692 10:120961815-120961837 CCTTCCAAATCTGAGGAATGAGG - Intergenic
1076323864 10:129605359-129605381 CATTCCAGATGTGACTGTTGAGG + Intronic
1076657561 10:132035172-132035194 CCTTCAAAATATGAATTTTGGGG - Intergenic
1076709771 10:132326178-132326200 CCCTGCAAAGCTGTCTTTTGTGG - Intronic
1078189204 11:9077622-9077644 CCTTTCAAATCTGAATGTTGGGG + Intronic
1078208106 11:9247846-9247868 CCCTGCAAAGCTGTCTTTTGTGG - Intronic
1078578447 11:12520350-12520372 ACTTCCAAATCTCACTTTCCAGG - Intronic
1079250104 11:18780849-18780871 CCTTCCAAATCTGAGTGTAAAGG - Intronic
1079301152 11:19280016-19280038 ATTTCCAAATCTGATTTTTCTGG - Intergenic
1079907403 11:26266269-26266291 CCTTTAAAATCTGAGTCTTGGGG - Intergenic
1080184268 11:29461299-29461321 GCTTGCAAATTTGACTGTTGAGG + Intergenic
1080991958 11:37546917-37546939 CCTTCAACATATGAATTTTGGGG + Intergenic
1082079231 11:47999327-47999349 CCTTCCAAAAGAGATTTTTGTGG - Intronic
1082954331 11:58852817-58852839 CCTTCAACATGTGAATTTTGAGG + Intronic
1083083089 11:60113803-60113825 CCCTGCAAATCTGTCTCTTGTGG - Intergenic
1083360368 11:62103147-62103169 CCCTACAAAGCTGTCTTTTGGGG + Intergenic
1083375582 11:62217606-62217628 CCTTCCACTCATGACTTTTGAGG + Intergenic
1083444015 11:62695198-62695220 CCTTCCTACTCTGAGTCTTGGGG - Intronic
1084355141 11:68633490-68633512 CCTTCAACATTTGAATTTTGGGG + Intergenic
1084365477 11:68694808-68694830 CCCTGCAAAGCTGACTCTTGTGG + Intergenic
1084779830 11:71400780-71400802 ACTTCAAAATATGAATTTTGGGG - Intergenic
1085150745 11:74251285-74251307 TCTTCCATCTCTGGCTTTTGGGG - Intronic
1085251615 11:75147753-75147775 CCTTCCACCTCCGACTTCTGAGG + Intronic
1087032843 11:93723268-93723290 CCTTGCAAATCTGTTTTTTCAGG - Exonic
1087779869 11:102290692-102290714 CCTTCAACATATGAATTTTGGGG + Intergenic
1089075370 11:115734273-115734295 CCTTCAACATATGAATTTTGCGG + Intergenic
1089270388 11:117297876-117297898 CCCTGCAAATCTGGCTTTTGAGG - Intronic
1089839854 11:121406629-121406651 CCCTGCAAAGCTGTCTTTTGTGG - Intergenic
1089940488 11:122411332-122411354 CCTTGAAAAGCTGCCTTTTGTGG + Intergenic
1089941148 11:122418849-122418871 CCCTGAAAAGCTGACTTTTGTGG + Intergenic
1090108024 11:123872850-123872872 CCTTGCAAAGCTGTCCTTTGTGG + Intergenic
1090324011 11:125869457-125869479 CCTTCCACTCGTGACTTTTGAGG - Intergenic
1091826195 12:3514636-3514658 CCTTGCAAAGCTGACCTTTCCGG + Intronic
1092586780 12:9908637-9908659 CCTTCCACTCATGACTTTTGAGG - Intronic
1093188425 12:16048529-16048551 CCTTGCAAAGCTGTCTTTTGTGG + Intergenic
1093841294 12:23904912-23904934 CCCTCCATCTCTGACTTTGGTGG - Intronic
1094277887 12:28699488-28699510 ACTTCCACATGTGAATTTTGGGG - Intergenic
1095344489 12:41133587-41133609 GCTTCCAAGTATGAATTTTGTGG - Intergenic
1095708878 12:45267445-45267467 GCTTCCACATCTGATTTTTGGGG + Intronic
1096018451 12:48300688-48300710 CTTTCCACATATGACTTTTAGGG - Intergenic
1097442611 12:59629242-59629264 CCTTAAAAATATGAATTTTGGGG + Intronic
1097584841 12:61503226-61503248 CCTTCCAAAGCTGTCTCTTGTGG + Intergenic
1098231124 12:68372906-68372928 TCTACCAAATCTGAGTTTGGAGG - Intergenic
1098703124 12:73653680-73653702 CCAAACAAATCTGTCTTTTGTGG + Intergenic
1100134732 12:91541637-91541659 CCTTCCAAATCTGATTCTAGAGG - Intergenic
1100147082 12:91691149-91691171 CCTTGCAGATCTGGTTTTTGCGG + Intergenic
1101983622 12:109428744-109428766 CATCCCAAATCTGACTTCTGCGG + Intronic
1102598406 12:114010930-114010952 ACTTCAAAATATGAATTTTGAGG + Intergenic
1102873833 12:116434557-116434579 CCTTGCTCATCTGAATTTTGGGG + Intergenic
1104101457 12:125616584-125616606 CTTTGCAAAGCTGTCTTTTGTGG - Intronic
1104537977 12:129636250-129636272 CCCTGCAAATCTGTCTCTTGTGG - Intronic
1104591681 12:130088959-130088981 ACTTCAACATCTGAATTTTGAGG + Intergenic
1104871221 12:131998006-131998028 CTTTCCAAATATGCATTTTGGGG - Intronic
1105212160 13:18263363-18263385 CCTTCCAGTTCTGACTTTTGAGG + Intergenic
1106390265 13:29328760-29328782 CCCTGCAAAGCTGTCTTTTGTGG - Intronic
1108100352 13:46947721-46947743 CCTTGCAAACCTGTCTTTTGTGG - Intergenic
1108248202 13:48538811-48538833 TCTTGCAAAGCTGACTTGTGGGG + Intergenic
1108883281 13:55147803-55147825 CCCTTCAAAGCTGTCTTTTGTGG + Intergenic
1109041837 13:57348372-57348394 CCCTGCAAAGCTGTCTTTTGTGG + Intergenic
1109141558 13:58718602-58718624 CCTTGAAAAGCTGCCTTTTGTGG + Intergenic
1109778786 13:67079631-67079653 CCCTGCAAAGCTGTCTTTTGTGG + Intronic
1111229606 13:85326433-85326455 CCCTCAAAATATGAATTTTGTGG + Intergenic
1111702922 13:91713352-91713374 CCTGCCAAGTCTGACTATTTAGG - Intronic
1112358096 13:98691506-98691528 CCTGCCAAATGTGACATGTGAGG - Intronic
1112574682 13:100625061-100625083 CCCTCCAAAGCTGCCTTTTTTGG + Intronic
1112697187 13:101963419-101963441 CCCTCTAATTCTGACATTTGTGG + Intronic
1113971418 13:114194016-114194038 CCTTCCAAAGGTGACTAGTGAGG - Intergenic
1114052718 14:18935106-18935128 CCTTCCCAGGGTGACTTTTGTGG + Intergenic
1114109840 14:19466820-19466842 CCTTCCCAGGGTGACTTTTGTGG - Intergenic
1114415158 14:22537959-22537981 CCCTCCAGCTCTCACTTTTGTGG - Intergenic
1115145652 14:30223113-30223135 CCTTCCAATTCTTATTTTTCAGG + Intergenic
1115317858 14:32045232-32045254 CCTTTCTATTCTGAATTTTGGGG - Intergenic
1115499555 14:34037143-34037165 CCTTACAAATTTGAATGTTGTGG + Intronic
1116688414 14:48073244-48073266 CCTTGCAAATCTGTCTTTGTGGG + Intergenic
1118378779 14:65200858-65200880 CCTTCAACATATGAATTTTGGGG - Intergenic
1118488990 14:66241008-66241030 CCTTCTAACCCTGATTTTTGAGG + Intergenic
1119933551 14:78570104-78570126 GCTTCCACATGTGAATTTTGGGG - Intronic
1120387714 14:83866735-83866757 ACTTCCAAATATAAATTTTGGGG + Intergenic
1120886227 14:89453874-89453896 GCTTCAACATCTGAATTTTGGGG - Intronic
1121354173 14:93199874-93199896 CCTGACAAATCTGCCTTCTGTGG - Intronic
1121466524 14:94118980-94119002 CCTTCCATTTCTGCCTTGTGGGG + Intergenic
1121515519 14:94547397-94547419 ACTTCCAAATCTCACTTTCCAGG + Intergenic
1122402149 14:101473868-101473890 CCTTCCAATTCTGTTCTTTGTGG + Intergenic
1122680520 14:103458014-103458036 GATTGCAAATCTGAGTTTTGGGG - Intronic
1122943874 14:104996204-104996226 GGTTCCAAACCTGACTTCTGTGG + Intronic
1124230659 15:27943442-27943464 CCTTGCAAAGTTGTCTTTTGTGG + Intronic
1124613227 15:31223473-31223495 CCTTCCAATCCTGACTCTTTAGG + Intergenic
1125093957 15:35829415-35829437 CCTTTGAAATCAGACTTTTTTGG + Intergenic
1126316866 15:47379253-47379275 CCTTTCAAATCCCAGTTTTGAGG - Intronic
1126607499 15:50493416-50493438 CTTTCCTAATTTGACTTTTCTGG - Intronic
1127972782 15:63974749-63974771 CCCTGCAAAGCTGACTCTTGTGG - Intronic
1128401102 15:67281696-67281718 TCTTGCAAAGCTGTCTTTTGTGG - Intronic
1130031215 15:80316135-80316157 CCTTCCAGCTCTGACATTTAGGG - Intergenic
1130311195 15:82756605-82756627 CTTTCCAATTCTGACTTGTAAGG + Exonic
1132335032 15:101042779-101042801 CCTTCAAATTCTCACTTTTGAGG + Intronic
1133714251 16:8431710-8431732 ACTTCAACATATGACTTTTGGGG + Intergenic
1135112374 16:19700182-19700204 ACGTCCAAATCTGATTTTTAGGG + Intronic
1135523817 16:23198180-23198202 CCCTCCAAATTTGACCTTTGTGG + Intronic
1135959845 16:26986405-26986427 CCCTGCAAAGCTGTCTTTTGTGG - Intergenic
1137305654 16:47197126-47197148 CCATGCAAAGCTGTCTTTTGTGG + Intronic
1137364246 16:47847069-47847091 GCTTGCAAAGCTGTCTTTTGTGG + Intergenic
1138131306 16:54482389-54482411 CCTTCCAATTCTGTCTCTTGAGG - Intergenic
1139660636 16:68418548-68418570 CCTTCCCCATTTGCCTTTTGGGG - Intronic
1140178613 16:72690900-72690922 GCTTCAACATCTGAATTTTGAGG + Intergenic
1140628454 16:76822851-76822873 CCTTCTGGATCTGACTTTTCTGG - Intergenic
1141402896 16:83766202-83766224 CCTTCCTAATCTAACCCTTGGGG - Intronic
1141687877 16:85580643-85580665 GCTTCCACATCTGAATTTGGGGG - Intergenic
1142032697 16:87846451-87846473 GCTTCCACGTCTGAGTTTTGGGG - Intronic
1144844469 17:18209236-18209258 CCTTCCAAGTCTAGCATTTGGGG + Exonic
1145001647 17:19309427-19309449 CATTCAAGAGCTGACTTTTGAGG - Intronic
1145058074 17:19716149-19716171 TCTTCCAACTCAGGCTTTTGTGG + Intronic
1145283537 17:21486659-21486681 CCCTGCAAAGCTGTCTTTTGAGG + Intergenic
1145393917 17:22478841-22478863 CCCTGCAAAGCTGCCTTTTGAGG - Intergenic
1145405417 17:22586240-22586262 CCTTACAAAGCTATCTTTTGTGG - Intergenic
1145827238 17:27886181-27886203 CTTTCCAAATGTTAATTTTGAGG - Intronic
1147345280 17:39788344-39788366 CCCTACAAATGTGAGTTTTGTGG - Exonic
1148499645 17:48080032-48080054 TCATCCAAATTTGACTTTTTTGG + Intronic
1148982490 17:51590580-51590602 CCTTTCAAGACTGAGTTTTGGGG - Intergenic
1149154433 17:53609583-53609605 CCTTGCAAAGCTGTCTTTTGTGG + Intergenic
1152381639 17:79945288-79945310 CCTCCCAGATCTGACTGTTCCGG + Intronic
1152813409 17:82392887-82392909 CCTTCCAGATCTGACACTTTAGG + Intronic
1153432984 18:5039062-5039084 CCTTGCAAAGCTGTCTCTTGTGG - Intergenic
1153831943 18:8931458-8931480 CCCTGCAAAGCTGTCTTTTGTGG - Intergenic
1153852028 18:9103904-9103926 CATTCCACATCTCATTTTTGAGG + Intronic
1155187979 18:23404261-23404283 ACTTCAACATATGACTTTTGAGG - Intronic
1156393808 18:36679023-36679045 CATTAAAAATCTGACTTTCGTGG + Intronic
1157158693 18:45292173-45292195 CCTGCAAAATATGTCTTTTGCGG + Intronic
1157326817 18:46675021-46675043 CCTTCCAAAAATACCTTTTGTGG - Intronic
1157375697 18:47162219-47162241 CCTCCCAATACTGACATTTGGGG + Intronic
1159186325 18:64979817-64979839 CCTTGCAATTCTTACTTTTCTGG - Intergenic
1160543768 18:79639509-79639531 CCCTCCAAAGCTGTCTCTTGTGG + Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1161417321 19:4154728-4154750 CTTTCCAAATCTGGACTTTGAGG - Intronic
1161552881 19:4923825-4923847 CTTGCCAAAGCTGACATTTGGGG - Intronic
1161870175 19:6863835-6863857 ACATCCAAACCTGACTTCTGAGG - Intergenic
1162646436 19:12053414-12053436 CCTTGCAAAACTGTCTTTTGAGG + Intergenic
1162657922 19:12145826-12145848 CCCTACAAATGTAACTTTTGTGG - Exonic
1163087251 19:14990905-14990927 CCTTCCAAAGTTCACTTTTATGG - Intronic
1163554914 19:17986421-17986443 CCTTCCTTAGCTGACTTTCGGGG + Intronic
1164454252 19:28394049-28394071 CCCTGCAAAGCTGTCTTTTGTGG + Intergenic
1165446646 19:35860431-35860453 CCTTCCCAAGCTCACTCTTGGGG - Intronic
1165692034 19:37871091-37871113 CCCTGCAAAGCTGACTCTTGTGG - Intergenic
1167201406 19:48067945-48067967 GCTTCCACATATGACTTTGGTGG - Intronic
1167917582 19:52754708-52754730 CCTTCCAGATCTTTCTTTTCTGG - Intergenic
925811295 2:7703341-7703363 CCCTGCAAAGCTGCCTTTTGTGG - Intergenic
926389211 2:12370286-12370308 GCTTGCAAAGCTGTCTTTTGTGG + Intergenic
926736961 2:16081041-16081063 ACTTGCAAATCTGAAATTTGCGG - Intergenic
927312852 2:21650011-21650033 ATTTCCAGAGCTGACTTTTGAGG + Intergenic
927451172 2:23210747-23210769 CCTTCAACATATGAATTTTGGGG - Intergenic
927892739 2:26762633-26762655 CCCTGCAAATCTGTCTTTTGTGG + Intergenic
928064917 2:28153713-28153735 CCTACCAAATCAGAATTTTAGGG + Intronic
929111066 2:38405560-38405582 CCTTGCAAAGCTGTCCTTTGTGG - Intergenic
930168875 2:48231121-48231143 CCTTCCGAATCAGACTTTCTCGG + Intergenic
930508277 2:52312100-52312122 CCCTCCAAAGCTGTCTTTTGTGG - Intergenic
930923222 2:56783188-56783210 CCTTCCAAATCCAACTTTAATGG + Intergenic
931177069 2:59864854-59864876 CCTTCCACATCTGAAGCTTGGGG + Intergenic
931880375 2:66563094-66563116 CATTCCATATCTGAGTTTTAAGG + Intronic
932288525 2:70555522-70555544 CCCTCCACCTCTGACTTTGGGGG - Intergenic
933369178 2:81393601-81393623 CCTTGCAAAGCTGTCTTTTGTGG - Intergenic
933397955 2:81755310-81755332 CATTCAAAATGTGACTTGTGTGG - Intergenic
934155687 2:89197909-89197931 CCTTGCAAAGCTGTCCTTTGTGG + Intergenic
934211637 2:89984850-89984872 CCTTGCAAAGCTGTCCTTTGTGG - Intergenic
934301465 2:91779040-91779062 CCTTCCAGTTCTGACTTTTGAGG - Intergenic
934973760 2:98786039-98786061 ACTTCCACATATGAATTTTGAGG + Intergenic
935048080 2:99499494-99499516 CCTTCCACTCATGACTTTTGAGG + Intergenic
935578439 2:104734902-104734924 ACTTCAATATCTGAATTTTGGGG - Intergenic
935816338 2:106849537-106849559 CCATGCAAAGCTGTCTTTTGTGG + Intronic
936647826 2:114392168-114392190 CCCTGCAAAGCTGTCTTTTGTGG + Intergenic
936768180 2:115879026-115879048 GCTTTAACATCTGACTTTTGGGG - Intergenic
937138577 2:119577313-119577335 GCTTCCACATATGAATTTTGAGG + Intronic
937235624 2:120430420-120430442 ACTTCCAAATCTGACATTGGAGG + Intergenic
937520630 2:122709212-122709234 CCCTGCAAAGCTGTCTTTTGTGG - Intergenic
937525142 2:122759296-122759318 GCTTCCCTATGTGACTTTTGGGG + Intergenic
937667932 2:124507741-124507763 CCCTGCAAAGCTGTCTTTTGTGG - Intronic
938057037 2:128223574-128223596 CCTTGCAAAGCTGTCTTTTGGGG - Intergenic
938106336 2:128533138-128533160 CCCTGCAAAGCTGTCTTTTGGGG + Intergenic
938781921 2:134592361-134592383 CCTTGCAAAGCTATCTTTTGTGG - Intronic
940174121 2:150860129-150860151 CCTTGCAAAGCAGTCTTTTGTGG - Intergenic
940477849 2:154189301-154189323 GCTTCCACATATGAATTTTGGGG - Intronic
941525333 2:166599399-166599421 CCTTCTAAACCTAATTTTTGAGG - Intergenic
942048123 2:172112582-172112604 TCTCTCAAATCTGATTTTTGGGG + Intergenic
942097844 2:172550165-172550187 CCCTGCAAATCTGTCTTTTGTGG - Intergenic
943783332 2:191848649-191848671 CCTTTTACATTTGACTTTTGTGG + Intergenic
944027403 2:195187732-195187754 CCTTCAAAATGTGACTAATGCGG + Intergenic
944041172 2:195356925-195356947 CCTTCAACATATGAATTTTGGGG - Intergenic
944069478 2:195653115-195653137 CCTTGCAAAACTGTCTCTTGTGG - Intronic
944127351 2:196309410-196309432 CCTGCCAAATCTGAATTCTTTGG + Intronic
948259252 2:236590718-236590740 GCTTCAAAATATGAATTTTGGGG + Intergenic
948437492 2:237963702-237963724 CCTTGCAAAGCTGTCTCTTGTGG + Intergenic
948480156 2:238244522-238244544 CCTTCATGATCTGACTTTAGAGG + Exonic
1170320463 20:15091264-15091286 TGTTCCAAATCTTACTTTGGGGG + Intronic
1172486649 20:35302382-35302404 CCTTCCAAATCTGAGCTTCCAGG + Intergenic
1172911881 20:38415621-38415643 GCTTCAATATGTGACTTTTGGGG - Intergenic
1173340440 20:42148348-42148370 CCTTCCAAATCTGACTTTTGAGG - Intronic
1173438526 20:43054608-43054630 CCTCCCAAATCTGAGCTTTTAGG + Intronic
1173480356 20:43393737-43393759 GCTTCAAAATATGAATTTTGCGG - Intergenic
1174119386 20:48251010-48251032 CCTTGCAAGGCTGTCTTTTGTGG + Intergenic
1175057302 20:56210029-56210051 CTTTGCAAAGCTGTCTTTTGTGG - Intergenic
1175765851 20:61592473-61592495 CTTTCCAAGTCTGAATTTTAAGG - Intronic
1176159132 20:63639873-63639895 CTGTCCACATCTGGCTTTTGTGG - Exonic
1176902686 21:14462343-14462365 CCTTCCGTATCCGACTTTTCAGG - Intergenic
1177328479 21:19625691-19625713 CCTTCAATATATGACATTTGGGG + Intergenic
1177649488 21:23941971-23941993 CCCTGCAAAGCTGACTCTTGTGG + Intergenic
1179586379 21:42376296-42376318 CCCTCCAATTCTGACTTTGTGGG - Intronic
1180471192 22:15657480-15657502 CCTTCCCAGGGTGACTTTTGTGG + Intergenic
1180814971 22:18783683-18783705 CCTTCCAGTTCTGACTTTTGAGG + Intergenic
1181201159 22:21218019-21218041 CCTTCCAGTTCTGACTTTTGAGG + Intronic
1181700583 22:24618948-24618970 CCTTCCAGTTCTGACTTTTGAGG - Intronic
1182245519 22:28954483-28954505 GCTTCAAAATATGACTTTTGGGG + Intronic
1182816118 22:33165574-33165596 CCTTCTAAATCAGAATTTTGGGG - Intronic
1182835891 22:33341063-33341085 CTTTCCACATGTGAATTTTGTGG - Intronic
1183756276 22:39769265-39769287 GCATCCAAGTCTGCCTTTTGGGG - Intronic
1183756444 22:39770749-39770771 GCATCCAAGTCTGCCTTTTGGGG - Intronic
1203225754 22_KI270731v1_random:77412-77434 CCTTCCAGTTCTGACTTTTGGGG - Intergenic
1203265074 22_KI270734v1_random:9372-9394 CCTTCCAGTTCTGACTTTTGGGG + Intergenic
949659380 3:6260321-6260343 CCTTGCAAAGCTGTCTTTTGTGG - Intergenic
951083573 3:18482476-18482498 CCAGGGAAATCTGACTTTTGAGG - Intergenic
951382917 3:22007371-22007393 CCATTCAAATCAGACTTTTATGG + Intronic
951857104 3:27209863-27209885 TCTTGAAAATCTGTCTTTTGTGG + Intronic
952854972 3:37762643-37762665 CCTTGCAAAACTGTCTCTTGTGG - Intronic
953960552 3:47262875-47262897 CTTTCCTAATCTGTCTTTTGTGG + Intronic
955171337 3:56568178-56568200 CCTTGCAAAGCTGTCTTTTGTGG - Intronic
957805732 3:85146677-85146699 GTTTCCAAATATCACTTTTGTGG + Intronic
958717581 3:97804144-97804166 CCCTACAAAGCTGTCTTTTGTGG + Intergenic
959295413 3:104529351-104529373 CCTTGCAAAGTTGTCTTTTGTGG + Intergenic
959513985 3:107245037-107245059 CCTTCAACATATGAATTTTGGGG + Intergenic
959536162 3:107487445-107487467 CCTTACACATCTAGCTTTTGTGG + Intergenic
961500769 3:127333130-127333152 ACTTCCAAATCTGTTTTATGAGG + Intergenic
961527045 3:127510899-127510921 CCCTACAAAGCTGTCTTTTGTGG - Intergenic
963226685 3:142869440-142869462 CCTTGCAAAGCTGTCTGTTGGGG + Intronic
963263793 3:143219035-143219057 TCTTGCAAAACTGCCTTTTGTGG - Intergenic
963433177 3:145235467-145235489 CCCTCCAAAGCTGTCCTTTGTGG + Intergenic
963563322 3:146895336-146895358 CCTAACAAATCTGACTCTTAAGG + Intergenic
964902301 3:161674145-161674167 CCCTGCAAAGCTGCCTTTTGTGG - Intergenic
965279119 3:166725528-166725550 CCTAGCAAAGCTGTCTTTTGTGG + Intergenic
967746925 3:193066837-193066859 CCTTCTAAATCAGAATTTTGGGG + Intergenic
967750895 3:193115162-193115184 CCTTGCAAAGCTGTCTTTTGTGG - Intergenic
969962784 4:10962555-10962577 CATTCCATAGCTGACTTTTGAGG - Intergenic
971730246 4:30370152-30370174 CCTCCCAAATGTTACTTTTTTGG + Intergenic
972035331 4:34512887-34512909 CCCTGCAAAGCTGCCTTTTGTGG - Intergenic
972349676 4:38225119-38225141 GTTTCCACATATGACTTTTGGGG + Intergenic
972803387 4:42501808-42501830 CTTTACAAATCTGACTGTTTAGG - Intronic
973038968 4:45446552-45446574 CCATGCAAAGCTGTCTTTTGTGG - Intergenic
974203268 4:58668275-58668297 CCCTGCAAAGCTGTCTTTTGTGG + Intergenic
974289348 4:59910820-59910842 CCTTGCAAAACGGACTTGTGAGG + Intergenic
974351737 4:60756366-60756388 ACTTCCAAATCTGTTTTATGAGG - Intergenic
974674633 4:65073970-65073992 CCCTGCAAAACTGTCTTTTGTGG - Intergenic
975836518 4:78428050-78428072 CCCTCCAAAACTGGCTTTTGGGG + Intronic
976491807 4:85679353-85679375 CCCTGCAAATCTGTCTTTTGTGG - Intronic
976741677 4:88363290-88363312 CCCTGCAAAGCTGTCTTTTGTGG - Intergenic
976755795 4:88496866-88496888 GCTTCAAAATATGAATTTTGTGG - Intronic
976783082 4:88783649-88783671 ACTTCAAAATGTGAATTTTGAGG - Intronic
976970804 4:91099972-91099994 CCCTGCAAAGCTGTCTTTTGTGG - Intronic
977382127 4:96288805-96288827 CTTTGCAAATCTGACTTTCATGG - Intergenic
977499408 4:97820906-97820928 CCCTCCAAATCTTATTTTGGAGG - Intronic
977544327 4:98359140-98359162 CCCTCCAAATTGGACTTTTATGG + Intronic
978284574 4:107061066-107061088 CCTTCCAAACCTGACTCTACCGG - Intronic
981813802 4:148805996-148806018 CCCTCCAAAGTTGACTTTTCTGG - Intergenic
982009472 4:151092892-151092914 CCTTGCAAAACTGTCTCTTGTGG - Intergenic
983702918 4:170621228-170621250 CCTTCCATATTTGATTTTTGGGG + Intergenic
983822804 4:172217237-172217259 CCTTGCAAAGCTGTCCTTTGTGG - Intronic
983904999 4:173172636-173172658 GCTGCCTACTCTGACTTTTGAGG + Intronic
984123538 4:175776482-175776504 CCTTGCACACCTGACTTTTTTGG - Intronic
984441844 4:179780764-179780786 CCTTCAACATCTCAATTTTGGGG + Intergenic
984514972 4:180726831-180726853 CTTCCAAAATCTTACTTTTGAGG - Intergenic
985349385 4:189041094-189041116 ACTTCAATATCTGAATTTTGAGG + Intergenic
985785871 5:1894228-1894250 CATTTCACATCTGATTTTTGTGG + Intergenic
986509462 5:8488733-8488755 CCTTGCAAAGCTGTCTTTGGTGG - Intergenic
986519684 5:8601098-8601120 CCTGCCAAGTCTGACTTCTAGGG + Intergenic
987574068 5:19703546-19703568 CCCTCCAGATCTTTCTTTTGTGG + Intronic
987733352 5:21806247-21806269 CCTTGCAAAGCTATCTTTTGTGG + Intronic
987882535 5:23767565-23767587 CTTTCCAGATATGACTTTAGTGG - Intergenic
988108487 5:26781933-26781955 GCTTCAACATATGACTTTTGAGG + Intergenic
988271525 5:29023550-29023572 CCCTGCAAAACTGTCTTTTGTGG + Intergenic
988660981 5:33268383-33268405 CCATCCAAATCAGAACTTTGTGG + Intergenic
988775786 5:34477162-34477184 GCTTCCAAGTCTGAATTTAGGGG - Intergenic
988866216 5:35337990-35338012 CCTTGCAAAGCTGTCTTTTGTGG - Intergenic
989638853 5:43564047-43564069 CCCTGCAAAGCTGCCTTTTGTGG - Intergenic
990212972 5:53500361-53500383 CCTTCCAAATCAAAATTTTATGG + Intergenic
990300850 5:54447921-54447943 CTTTCCAAATCTGTATTTTTAGG - Intergenic
990467702 5:56085456-56085478 TCTTACACATCTGACTTTTGTGG + Intergenic
992882291 5:81122323-81122345 CCTTCCATTACTGAATTTTGGGG + Intronic
993045001 5:82856793-82856815 CCATCCAATGCAGACTTTTGGGG + Intergenic
993616619 5:90120174-90120196 TCTTCCAAATGTGAGTTTTTTGG - Intergenic
993829565 5:92738431-92738453 GCTTCAACATATGACTTTTGAGG + Intergenic
994094350 5:95835445-95835467 CCTTCCCCATCTGACTGATGGGG - Intergenic
995398903 5:111718628-111718650 CTTTCCACATCACACTTTTGTGG + Intronic
996212218 5:120825372-120825394 ACTTCCACATATGAATTTTGAGG - Intergenic
996331967 5:122339865-122339887 CCTTCCAAGTCTGTCTTCAGGGG + Intronic
996410306 5:123151631-123151653 CCTTCCAAATCTGATTTTCCTGG + Intronic
997353557 5:133247985-133248007 CCTTCCAACTCTGAGACTTGTGG - Intronic
998501562 5:142637282-142637304 ACTTCCAAATCTGCCTCTGGAGG - Intronic
999325881 5:150643026-150643048 CCTTCATATTCTGACATTTGAGG + Intronic
999372291 5:151063436-151063458 CCTTCCAAATCTGACCTTCTGGG + Intronic
1000332914 5:160219867-160219889 CCTACCAAACCAGAATTTTGGGG + Intronic
1000552164 5:162680403-162680425 CCCTACAAAGCTGATTTTTGTGG - Intergenic
1000913116 5:167046158-167046180 CCTTCCAAATCACAGTTATGTGG + Intergenic
1000923356 5:167164186-167164208 TCTTCCAAATCTCATTTTGGTGG - Intergenic
1000969626 5:167699211-167699233 CCTTCCAAATTTTAATTTTAAGG - Intronic
1001258484 5:170204348-170204370 ACTTCCATATATGAATTTTGAGG - Intergenic
1001385034 5:171331529-171331551 GCTCCCAAAGCTGAGTTTTGTGG - Intergenic
1001581669 5:172802697-172802719 GCTTCCACATATGAATTTTGAGG - Intergenic
1001658994 5:173376445-173376467 CCTGCCACATCTGACTTAGGAGG - Intergenic
1001779490 5:174355635-174355657 CCTTCCAAATCTGACATTTATGG + Intergenic
1002063290 5:176639364-176639386 CCTTCCAAGTCTGTCTATGGGGG - Intronic
1003772351 6:9319447-9319469 CCTTCCTAAGATGACATTTGAGG + Intergenic
1004466977 6:15894984-15895006 CCTTGCAAAGCTGTCTTTTATGG + Intergenic
1004574830 6:16885782-16885804 CCTTGCAAAGCTGTCTCTTGTGG + Intergenic
1005027074 6:21473558-21473580 GCTTCCACATATGAATTTTGGGG - Intergenic
1005565376 6:27087707-27087729 CCTTTAAAATCTGCCTCTTGTGG + Intergenic
1005650854 6:27883755-27883777 TCTTATAAATCTGCCTTTTGTGG - Intergenic
1005651485 6:27889281-27889303 CCCTGCAAATCAGTCTTTTGTGG + Intergenic
1008678487 6:53846176-53846198 CCTTCAAACACTGACTTTTGTGG + Intronic
1008841019 6:55904419-55904441 GCTTCCATATATGAATTTTGAGG + Intergenic
1010434060 6:75810292-75810314 CCCTGCAAAGCTGTCTTTTGTGG - Intronic
1010473506 6:76259244-76259266 TCTTCCAAATCTAAATTTTATGG - Intergenic
1011121340 6:83956685-83956707 CCCTGCAAATCTGTCCTTTGTGG - Intronic
1011875025 6:91948885-91948907 CCTTACAAATTTGACATTAGGGG - Intergenic
1012837905 6:104293760-104293782 ACTTCAACATATGACTTTTGGGG - Intergenic
1013359805 6:109383127-109383149 CTTTCCCAACCTGACTTTTCCGG + Intergenic
1013634740 6:112018491-112018513 CCTTGCAATTTTCACTTTTGAGG - Intergenic
1013930412 6:115524206-115524228 GCTTCCACATATGAATTTTGGGG - Intergenic
1015078776 6:129197194-129197216 CCTTGCAAAGCTGTCTCTTGGGG + Intronic
1016475412 6:144421731-144421753 CTATCCAAATTTGTCTTTTGGGG - Intronic
1016595622 6:145796155-145796177 CCTTTCAAATTTGAATTTTATGG - Exonic
1016785248 6:148004172-148004194 CCACCCAAATCAGAATTTTGGGG - Intergenic
1016810401 6:148255473-148255495 CCTTCAAAATATGAATTTGGGGG + Intergenic
1017264143 6:152422963-152422985 CCCTGCAAAGCTGTCTTTTGGGG + Intronic
1017483082 6:154877114-154877136 CTTTCAAAATCTGGCATTTGGGG + Intronic
1017486873 6:154911198-154911220 CCTTCCATTTCTGACTGCTGTGG - Intronic
1017851064 6:158306447-158306469 CCTTCCACCTCAGACTCTTGAGG - Intronic
1017870942 6:158486150-158486172 ACTTCCCAATATGAATTTTGGGG - Intronic
1019068206 6:169320504-169320526 CCCTGCAAAGCTGTCTTTTGTGG + Intergenic
1019085215 6:169469076-169469098 CCTTCCACATATAAATTTTGAGG + Intronic
1019372692 7:671202-671224 CCTTCAGAATCTGAATTCTGCGG - Intronic
1020394809 7:7702311-7702333 GCTTCCTAAACTGACTTTTAAGG + Intronic
1020402485 7:7794749-7794771 CCCTGCAAAGCTGTCTTTTGTGG + Intronic
1020563269 7:9759249-9759271 CCCTGCAAAGCTGTCTTTTGTGG - Intergenic
1021202958 7:17746070-17746092 TCTTGCAAAGCTGCCTTTTGTGG + Intergenic
1021784576 7:24139251-24139273 TCTTTCAAATCTGACTTTTCTGG + Intergenic
1022229094 7:28395834-28395856 CCTTGCCAATCTGATTTCTGAGG - Intronic
1023742119 7:43290185-43290207 CCCTGCAAAGCTGTCTTTTGAGG - Intronic
1024011016 7:45266770-45266792 ACTTCCACATCTAAATTTTGAGG + Intergenic
1024140489 7:46458207-46458229 CCTTGCAAAGCTGTCTTTTGTGG - Intergenic
1024422551 7:49185883-49185905 CCCTGCAAAGCTGTCTTTTGTGG - Intergenic
1024737440 7:52320844-52320866 CCCTGCAAAGCTGTCTTTTGAGG + Intergenic
1026198049 7:68189961-68189983 CCTTCAACATCTGAATCTTGGGG - Intergenic
1026289217 7:68990895-68990917 CCTTCCATTTTTGCCTTTTGTGG - Intergenic
1026308876 7:69166599-69166621 CCCTGCAAAGCTGTCTTTTGTGG - Intergenic
1026563014 7:71466074-71466096 CCTTGCAAAGCTATCTTTTGTGG - Intronic
1027305014 7:76885171-76885193 CCATCCAAATGTGACTTCTTGGG + Intergenic
1027517815 7:79164381-79164403 CCCTGCAAAGCTGTCTTTTGTGG + Intronic
1027870570 7:83701718-83701740 CTTTCCAAGCCTGGCTTTTGAGG + Intergenic
1027951491 7:84822591-84822613 CCTTGCAAAGCAGTCTTTTGTGG + Intergenic
1028018506 7:85743497-85743519 CCTTCCACTCATGACTTTTGGGG - Intergenic
1028708283 7:93876216-93876238 TTTTCTGAATCTGACTTTTGTGG - Intronic
1029329049 7:99836162-99836184 TCTTCCAAGCCTGACTTTTCGGG - Intronic
1030188144 7:106784149-106784171 CCTTCAAAATATAAATTTTGGGG - Intergenic
1031658892 7:124395930-124395952 GCTTCAACATCTGAGTTTTGGGG + Intergenic
1032896095 7:136252502-136252524 ATTTCAAAATCTGAATTTTGGGG - Intergenic
1033894350 7:146053313-146053335 CCTGCCAAATCTTACCTTGGGGG - Intergenic
1034985551 7:155511415-155511437 CCTTCCACAACTTACTTCTGTGG + Intronic
1036484573 8:9167580-9167602 ACTTCCACATATGAATTTTGGGG + Intronic
1036559191 8:9887218-9887240 GCTGCCAAACCTGACTTTGGAGG - Intergenic
1036718445 8:11149083-11149105 CTTTCAACATCTGAATTTTGGGG - Intronic
1037406688 8:18549879-18549901 CCTTCCAACTCTGTATTTTTAGG - Intronic
1038496751 8:28008673-28008695 ACTTCAACATATGACTTTTGGGG - Intergenic
1038861184 8:31390556-31390578 CCATCCAAAGCTGACTTGTGGGG + Intergenic
1040633557 8:49244764-49244786 CCTTGCAAATTTGTCTTTAGTGG - Intergenic
1042172767 8:66008534-66008556 ACTTCCACATATGAATTTTGGGG - Intergenic
1042703959 8:71647114-71647136 GCTTCAAAATATGAATTTTGGGG + Intergenic
1042828467 8:73001919-73001941 CCTTGCAAAGCTGTCTTTTGTGG + Intergenic
1042979044 8:74505343-74505365 CCCTGCAAATCTGTCTCTTGTGG + Intergenic
1043476919 8:80614239-80614261 CTTTCCAATTCTCATTTTTGTGG - Intergenic
1043848056 8:85183798-85183820 CCTTCAACATATGAATTTTGGGG - Intronic
1044490380 8:92806553-92806575 CCTTCCTTGTCAGACTTTTGGGG + Intergenic
1045646718 8:104306557-104306579 CCTTGCAAAGCTGTATTTTGTGG + Intergenic
1046712098 8:117521203-117521225 CTCTACAAATCCGACTTTTGGGG - Intronic
1050193889 9:3059664-3059686 TCTTCCAAATCTTTCTTTTCTGG - Intergenic
1051618487 9:19029192-19029214 CCTTTCAACTTTAACTTTTGAGG - Intronic
1051687287 9:19670934-19670956 CCATTCTAATCTGACTTTTTAGG - Intronic
1052516385 9:29485998-29486020 GCTTCCATATATGAATTTTGGGG + Intergenic
1052644377 9:31214125-31214147 GCTTCAAAATATGAATTTTGAGG + Intergenic
1052772499 9:32702747-32702769 CTTTCCAAATCTGAGTTTTGAGG - Intergenic
1053619948 9:39804699-39804721 CATTCCAAACATGAATTTTGTGG + Intergenic
1053878126 9:42564001-42564023 CATTCCAAACATGAATTTTGTGG + Intergenic
1053894534 9:42730365-42730387 CATTCCAAACATGAATTTTGTGG - Intergenic
1054233568 9:62537693-62537715 CATTCCAAACATGAATTTTGTGG - Intergenic
1054264209 9:62902745-62902767 CATTCCAAACATGAATTTTGTGG - Intergenic
1054833498 9:69651884-69651906 GCTTCAACATGTGACTTTTGTGG - Intronic
1056602303 9:88055630-88055652 ACTTCCATGTCTGAATTTTGGGG + Intergenic
1056919215 9:90771385-90771407 CCTTGCAAAGCTGTCCTTTGCGG - Intergenic
1057150645 9:92793285-92793307 TCTTTCAACTCTGACTTTTCAGG + Intergenic
1057248654 9:93481224-93481246 TTTTCAAAATGTGACTTTTGGGG + Intronic
1057679855 9:97169467-97169489 CCGTACAAAGCTGTCTTTTGTGG + Intergenic
1058650347 9:107170090-107170112 CCTTCCAAGTGTTAGTTTTGGGG + Intergenic
1058954489 9:109932670-109932692 CCTTCCAGTTCTGATTTCTGAGG - Intronic
1059590858 9:115659964-115659986 CCTTTCAACTCTGACATTTGGGG + Intergenic
1059628886 9:116098055-116098077 CCTTTGAAATATGACTTTTATGG - Intergenic
1186330529 X:8527332-8527354 CCCTACAAAGCTGTCTTTTGTGG + Intergenic
1186741768 X:12525568-12525590 CCATGCAAAGCTGTCTTTTGTGG + Intronic
1186830299 X:13383515-13383537 CCCTGCAAAGCTGTCTTTTGTGG - Intergenic
1187101690 X:16199345-16199367 CCCTGCAAATCTGTCTTTTGTGG + Intergenic
1187581922 X:20616344-20616366 GCTTCAACATCTGAATTTTGAGG + Intergenic
1187806731 X:23128907-23128929 CCCTGCAAAGCTGTCTTTTGTGG + Intergenic
1189684039 X:43545259-43545281 CCCTGCAAAGCTGTCTTTTGTGG - Intergenic
1190495483 X:51024548-51024570 CCCTGCAAACCTGACTTTTGTGG - Intergenic
1190496679 X:51033584-51033606 CCCACAAAATCTGACTTCTGTGG - Intergenic
1190509294 X:51160353-51160375 CCCACAAAATCTGACTTCTGTGG + Intergenic
1190510485 X:51169334-51169356 CCCTGCAAAGCTGTCTTTTGTGG + Intergenic
1190792190 X:53710833-53710855 GCTTCCACATATGAATTTTGAGG - Intergenic
1192063660 X:67857817-67857839 CCTTGCAAAGCTGACTTTTGTGG - Intergenic
1192161428 X:68791088-68791110 CCCTGCAAAGCTGTCTTTTGTGG + Intergenic
1192231498 X:69268213-69268235 CCCTGCAAAGCTGTCTTTTGTGG - Intergenic
1192273280 X:69604712-69604734 TCTTCCAAAAGTGTCTTTTGGGG - Intergenic
1192576307 X:72245871-72245893 CCTTCTAAACCTGCCTTTCGGGG + Intronic
1194356516 X:92891474-92891496 CCATCCTAAGCTGATTTTTGCGG + Intergenic
1194378290 X:93163222-93163244 CCTTGCAATTCTGAGTTTTGGGG - Intergenic
1194483051 X:94450857-94450879 CCTTACAAAGCTGTCTCTTGTGG - Intergenic
1194799111 X:98249498-98249520 CCTTCCTCACCTGAGTTTTGGGG + Intergenic
1195617727 X:106926370-106926392 CCTCCCAAATCTGAATTTCCAGG - Intronic
1195980489 X:110572108-110572130 CCATCCAAAGCTTACTTTTGAGG + Intergenic
1196006058 X:110838491-110838513 CCCTGCAAAGCTGTCTTTTGTGG + Intergenic
1196295981 X:113998023-113998045 TCTTGCAAAGCTGTCTTTTGTGG - Intergenic
1196978760 X:121188447-121188469 CATTCCAACACTGGCTTTTGTGG - Intergenic
1198066323 X:133100063-133100085 CCTTCTGAATCAGAATTTTGTGG + Intergenic
1198772828 X:140149084-140149106 CCTTCAACATATGACTTTTGAGG - Intergenic
1200074842 X:153545830-153545852 CCTTCCAAGGCTGGCTTTAGGGG + Intronic
1200138198 X:153885120-153885142 CATTCCAGGTCAGACTTTTGGGG - Intronic
1201962624 Y:19698835-19698857 CCTTCAACATATGAATTTTGGGG + Intergenic