ID: 1173343369

View in Genome Browser
Species Human (GRCh38)
Location 20:42175302-42175324
Sequence CAGTGTGGCTGCAGCCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173343369_1173343373 18 Left 1173343369 20:42175302-42175324 CCCTCTAGGCTGCAGCCACACTG 0: 1
1: 0
2: 3
3: 48
4: 280
Right 1173343373 20:42175343-42175365 GCCCACCTGAGAATCTGTACAGG 0: 1
1: 0
2: 0
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173343369 Original CRISPR CAGTGTGGCTGCAGCCTAGA GGG (reversed) Intronic
900164764 1:1240272-1240294 CAGTGTGGGTCCAGCCCAGGAGG + Intergenic
900411419 1:2514412-2514434 CTCTGTGGATGCAGCCGAGAGGG - Exonic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
902079673 1:13812526-13812548 CAGTGTGGCTGGAGCCTGGTAGG + Intronic
902097511 1:13958807-13958829 CAATGTGGCTGGAGCCAAGGCGG + Intergenic
903478159 1:23634664-23634686 CAGTGTGGCTGGAACCCAGCTGG + Intronic
903956144 1:27027421-27027443 CAGTGTGGCTGCCCCCGATAAGG - Intergenic
904901243 1:33858783-33858805 CAGTGTGGCTGCTGCTTTGATGG - Intronic
905182412 1:36175421-36175443 CATTCTGGCTCCACCCTAGAGGG + Intronic
905459185 1:38111253-38111275 CAGTATGGCTGCCTCTTAGAAGG + Intergenic
905728293 1:40274551-40274573 CAGTGTGGCTGCACCATAGCAGG + Intronic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
907281548 1:53350293-53350315 CAGTGTGGCTGGAGCATGGTGGG - Intergenic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
909289239 1:73861328-73861350 CACTGTGGCTTCAGCCTAATTGG + Intergenic
911463738 1:98224210-98224232 CAGTGTGGCTGAAGCATAAAAGG + Intergenic
912987320 1:114447001-114447023 CAGTGTAGCTGTAGCAGAGATGG + Intronic
914972996 1:152328467-152328489 CATTGTAGCTGAAGACTAGAAGG + Intergenic
914978515 1:152390448-152390470 CAGTGTCGCTGCAGTTTACACGG - Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
917112593 1:171565150-171565172 CAGTGAGGCTGAAGCATAGCAGG - Intronic
917294519 1:173504948-173504970 CCATGTGGCTGCAGCCTACCAGG + Intronic
917447797 1:175121368-175121390 CAGTTTTGCTGGAGCATAGAGGG + Intronic
917468610 1:175306896-175306918 CAGAGTGGCTGAAGCACAGATGG - Intergenic
918115238 1:181490468-181490490 GAGCGTGGCTGGAGCCTAGCTGG - Intronic
919088081 1:192945388-192945410 TAGGGAGGCTGCAGCCAAGAGGG - Intergenic
919981996 1:202647531-202647553 CAGTGTGGAGGCAGCCTTGCTGG + Intronic
920169617 1:204063348-204063370 CAGTGAGGCTGAGCCCTAGAAGG + Intergenic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
1063615013 10:7593500-7593522 CTGGGTGGCTGCAGTCTACAGGG - Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1070061694 10:72989945-72989967 CTGCCTGGCTGCAGCCTAGCAGG - Intergenic
1071105542 10:82089889-82089911 CACTGGGGCAGGAGCCTAGAAGG - Intronic
1073484139 10:103806010-103806032 AAGTGTGGCTGTATCCTAGCCGG - Intronic
1075469308 10:122676116-122676138 CCGTGAGGATGCAGGCTAGAGGG + Intergenic
1076798282 10:132809202-132809224 GAGTGTGGCTGCGGCCTTGCAGG + Intronic
1077197301 11:1287857-1287879 CAGGGAGGCTGCAGCAGAGAGGG - Intronic
1077474381 11:2779460-2779482 CTGCCTGGCTGCAGCCGAGATGG - Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077918472 11:6626005-6626027 CAGTCTGGCTGCATCCCAGCCGG - Exonic
1078437940 11:11340866-11340888 CAGGGTGGCTGAAGTCTGGATGG - Exonic
1078690010 11:13570240-13570262 CTGTGAGGCTGCAGCCTGGCGGG + Intergenic
1079293146 11:19206910-19206932 CAGTGTGGCTCCAGACTAAGGGG - Intronic
1079633303 11:22705201-22705223 CAGTGTGGCTGCAACAAAGTCGG - Intronic
1079653991 11:22965632-22965654 CTGTGAGGCTGCAGCCTGGCAGG - Intergenic
1080896394 11:36451970-36451992 CAGTGACACTGCAGTCTAGATGG + Intronic
1083302545 11:61746504-61746526 TGGTGTGGCTGCAGCCTTGGGGG - Exonic
1084946296 11:72640614-72640636 CAATGTGTTTGCAGCCTAGGTGG - Intronic
1085021522 11:73213187-73213209 CCATGTGACTGCAGCGTAGAAGG + Intergenic
1085794869 11:79529983-79530005 CAGTGTGGTAGCAGTCAAGATGG - Intergenic
1087466492 11:98513634-98513656 CAGTGTTGCTGTAGACTATATGG - Intergenic
1087814265 11:102641226-102641248 CAGTGTTCCTGAAGCCTAAAGGG + Intergenic
1088391993 11:109324601-109324623 CAGTGTGGTCTCAGTCTAGAGGG - Intergenic
1088992568 11:114966758-114966780 CAGTCTGGCTGCAGAGTGGAAGG + Intergenic
1089137264 11:116259647-116259669 CTGTGTGGCTGCTGCTTAGAAGG + Intergenic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1089811702 11:121137582-121137604 GAGTGTGGCTGCAACTTTGAGGG + Exonic
1092209554 12:6637521-6637543 GAGTGTGGCTGGAGCCCAGGAGG + Intergenic
1092650781 12:10632439-10632461 CAGTGTAGCTGGAGCCAAGTGGG + Intronic
1094286462 12:28799486-28799508 TAGGGTGTCTGCAGCCTGGAGGG + Intergenic
1094430750 12:30367076-30367098 CTGTGAGGCTGCAGCCTGGCGGG - Intergenic
1094436841 12:30430269-30430291 CAGTGTGGCTGGTGCCCAGTGGG - Intergenic
1097701012 12:62820174-62820196 CGGTGAGGCAGCAGCCTAGTAGG + Intronic
1098101989 12:67027758-67027780 CACTCTGGCTGCAACCCAGAAGG + Intergenic
1098267020 12:68732225-68732247 GAGGGTGGCTTGAGCCTAGAAGG - Intronic
1098590141 12:72201499-72201521 CAGAGGGTCTGGAGCCTAGAGGG - Intronic
1100348647 12:93756834-93756856 CAGTGTGGATGAAGGCTAGGAGG - Intronic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101457206 12:104846703-104846725 CTGTATGCCTGCAGCCTGGAAGG - Intronic
1102443236 12:112979400-112979422 AAGTGTGGCAGCAGCAGAGAAGG - Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102579777 12:113879030-113879052 CAGTGTGGCTGCAGCTGTGGTGG + Intronic
1103657324 12:122483319-122483341 CAATGTGGCTGAAGACTTGATGG + Exonic
1105047298 12:133015556-133015578 GAGTGTCGCTTCAGCCCAGAAGG + Exonic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106044877 13:26129639-26129661 CAGTGTGACTGCTGTGTAGAGGG - Intergenic
1106184984 13:27401439-27401461 CAGTCTGTCTACAGCCAAGATGG - Intergenic
1106412184 13:29518209-29518231 AAATGTGGCTGCAGGCTAGATGG + Intronic
1108490608 13:50977591-50977613 CAGTGGGGACACAGCCTAGAGGG + Intergenic
1108604237 13:52021492-52021514 CAGTTTGGCTGCACCCTGGAGGG + Intronic
1110443248 13:75548927-75548949 CACTGTGGCTGCAGAGTAAAGGG - Intronic
1112128925 13:96499739-96499761 CAGTGTGGCTGAAGCTGAGTGGG + Intronic
1113519991 13:110933763-110933785 GAGTGGGACTCCAGCCTAGACGG + Intergenic
1113557750 13:111252093-111252115 CACTGGGGCAGAAGCCTAGATGG + Intronic
1114261121 14:21037020-21037042 CAGGGAAGCTGCAGCCTTGAGGG - Intronic
1115843664 14:37502019-37502041 CTGTGAGGCTGCAGCCTGGCAGG + Intronic
1116364703 14:44045406-44045428 CAGTGTGGCTGCCATCGAGAAGG + Intergenic
1117783376 14:59257770-59257792 CAATGTGGCTGAAGCCTAATGGG - Intronic
1117892657 14:60443444-60443466 CTGTGAGGCTGCAGCCTGGCAGG + Intronic
1118707609 14:68494548-68494570 CAGTGAGGCGTCAGTCTAGATGG + Intronic
1119761997 14:77158218-77158240 CAGTGTGGCTGCCACCAGGAGGG + Intronic
1120946763 14:90005150-90005172 GAGTGTGGCTGCAGAGCAGATGG - Intronic
1121729038 14:96173689-96173711 CTGTGTAGCTGCAGCTCAGAGGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122117558 14:99535451-99535473 GAGTGTGGCTGGAGCTTGGAGGG - Intronic
1122122010 14:99559754-99559776 CAGGGTGGCTGCAGACTAAGAGG + Intronic
1122385391 14:101341828-101341850 CAGTGTGGCTGCAGCAAAGGAGG - Intergenic
1122881575 14:104692739-104692761 CAGTGTGGTCACAGCCCAGATGG + Intronic
1123120774 14:105915411-105915433 CAGTGTGCCTGCAGCCTGTCCGG + Intergenic
1125289237 15:38127403-38127425 CAAGGTGGCTGCAGCCTGGATGG - Intergenic
1126796612 15:52264948-52264970 AAGTGTTTCTGGAGCCTAGAAGG - Intronic
1127016650 15:54696165-54696187 CAGTTTGGCTGCAGCATAGTTGG - Intergenic
1127968112 15:63938975-63938997 CAGTGGGGCTACAGCCTGTAAGG - Intronic
1128506489 15:68276814-68276836 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1131463723 15:92637999-92638021 CAGTGGGACGGCAGCCTACAAGG + Intronic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133770259 16:8863626-8863648 CAGCTTGGCTTCAGCCCAGATGG - Intronic
1134205296 16:12232726-12232748 CAGGATGGCTGCAGCCTAGAGGG + Intronic
1134362744 16:13546940-13546962 CAGTGTGGCTGTAGCACAGCAGG - Intergenic
1134505566 16:14803249-14803271 CAGTGTGTCTGCAGTCTTCATGG + Intronic
1134575014 16:15325662-15325684 CAGTGTGTCTGCAGTCTTCATGG - Intergenic
1134727432 16:16430829-16430851 CAGTGTGTCTGCAGTCTTCATGG + Intergenic
1134940003 16:18281026-18281048 CAGTGTGTCTGCAGTCTTCATGG - Intergenic
1135780223 16:25293532-25293554 GAGTGTGGCTGAAGCAGAGATGG + Intergenic
1136414448 16:30095213-30095235 CAGTGGGGCTGGAACCTATAGGG - Intronic
1137498945 16:48995844-48995866 CATTGTGCTTACAGCCTAGAAGG + Intergenic
1137633529 16:49965808-49965830 CCGGGTGGCTGCAGTCTACATGG + Intergenic
1138414122 16:56861544-56861566 CAGTGGGGCTGAAGGCTTGAGGG - Intergenic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1141126552 16:81404639-81404661 CAGTCTGGCTGCAGAGTGGATGG - Intergenic
1141944166 16:87298188-87298210 CAATGTTGCTGCAGCCCACACGG - Intronic
1142145104 16:88489610-88489632 CAGAGCGGCTGCAGCCTATGGGG + Intronic
1142527570 17:555205-555227 CAGTGTAACTGAAGCCTAGCAGG - Intronic
1143890178 17:10096857-10096879 CAGTATGGCTTAAGCCAAGAAGG - Intronic
1143999071 17:11035750-11035772 CAGTGGGGCTGGAGCATGGAGGG - Intergenic
1144024803 17:11268417-11268439 TAGTGTGTCTGCAGCCTAGGAGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1146269674 17:31476757-31476779 CTCTGTGGCTGCAGCCCAGGAGG - Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1148885253 17:50767580-50767602 CAGTGAGGCTGCTGCCTCAAAGG + Intergenic
1149225518 17:54465622-54465644 CTGTGAGGCTGCAGCCTGGTGGG - Intergenic
1150289490 17:63973216-63973238 CTGTGTGGCTTCAGCCTAATGGG + Intergenic
1150862828 17:68818794-68818816 CATTGTGGGTGCAGGCTGGAAGG + Intergenic
1151434049 17:74083172-74083194 AAGTGTGGCAGCAGCCCAGATGG + Intergenic
1151540247 17:74761187-74761209 CAGTGTGGCTGTGGCCTGGAGGG - Intronic
1153770891 18:8415783-8415805 CAGTCTGGGTGCAGACTGGAGGG - Intergenic
1157561473 18:48649374-48649396 CTGTGAGGCAGCAGCCTGGAGGG + Intronic
1157596250 18:48865661-48865683 CAGTGTTGTTTCAGCCAAGATGG - Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1159925470 18:74265237-74265259 CAGTTTTTCTGCAGCATAGATGG - Intronic
1160289510 18:77578148-77578170 CTGTCAGGCTGCAGCCTAGCAGG - Intergenic
1160345249 18:78127251-78127273 CAGGGTGGCTGCAGCCAGGAAGG - Intergenic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1163822304 19:19502912-19502934 CAGTGTGACCGCAGCATGGATGG - Intronic
1164812247 19:31166491-31166513 CAGGAAGGCTGCAGCCAAGAAGG + Intergenic
1165088101 19:33365311-33365333 GAGGGTGGCTTGAGCCTAGAAGG - Intergenic
1165891235 19:39113502-39113524 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1166000308 19:39873609-39873631 CAGTGTGGCTGCCTCCATGATGG - Exonic
1166179674 19:41098930-41098952 CTGTGAGGCAGCAGCCTGGATGG + Intergenic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1166262202 19:41648210-41648232 CAAGGAGGCTGCAGCCTAGAAGG + Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166945253 19:46392182-46392204 CAGCATGGCTGCAGCCCTGACGG - Intronic
926624753 2:15081807-15081829 CACTTTGGCTGCTGCCTGGAAGG + Intergenic
929827394 2:45319807-45319829 CAGGGTGGCTGGAACCTACAGGG - Intergenic
930007491 2:46909733-46909755 CAGCTGGGCTGCAGCCTAGAGGG + Intronic
930226333 2:48797942-48797964 CAGTGTGGCTGGAACTTCGAAGG + Intergenic
930511411 2:52349913-52349935 CAGTGTGGCTGCAACAGAGTGGG - Intergenic
932263182 2:70344045-70344067 CAGAGTGGCTGCAGCTGAGATGG + Intergenic
934937129 2:98473513-98473535 CAGTGTAGGTGCAGTGTAGAGGG + Intronic
935936438 2:108189499-108189521 CACTGTGTCTGCTGCCCAGAAGG + Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937399727 2:121571762-121571784 CAGTGTGGCTACAGTATGGAGGG + Intronic
937427393 2:121811758-121811780 CACTGTGGGTGTAGGCTAGATGG + Intergenic
937556790 2:123167887-123167909 AAGTATGGGTGAAGCCTAGATGG - Intergenic
937890871 2:126937583-126937605 GAGTGTGGTTGCTGCGTAGAGGG - Intergenic
938249838 2:129806121-129806143 CAGTGTGGCAGCTGCCAATATGG + Intergenic
938366400 2:130737867-130737889 CAGTGAGGCTGCAGCCTGCCTGG - Intergenic
938902709 2:135811563-135811585 CAGTGTGGCTGGAGCAATGAGGG + Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
942065798 2:172270455-172270477 CTGTGAGGCTGCAGCCTGGTGGG - Intergenic
943281898 2:185945551-185945573 CAGTTTGGGAGCAGCTTAGATGG - Intergenic
944189212 2:196983367-196983389 CAGTGTGGCTGGAGACTCAAGGG - Intronic
944403411 2:199354442-199354464 TACTGTGGCTGAAGCCTTGAGGG + Intronic
944973987 2:205026297-205026319 CAGGGTGGCTGCAGTGTAGTGGG + Intronic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
946794070 2:223330906-223330928 CTGTGAGGCTGCAGCCTGGCGGG + Intergenic
947468572 2:230378359-230378381 CATTGTGGCTGGAGCTTAGCAGG - Intronic
948488545 2:238296822-238296844 CACGGTGGCTGCAGCCTTGGTGG - Intergenic
948508821 2:238449334-238449356 CAGTGAGGCTGCTGCCTGGCTGG + Exonic
948830067 2:240594347-240594369 CAGGGTGGCCGCTGCCCAGAAGG + Intronic
1168962796 20:1880463-1880485 CAGTGTGGCTGAAGCAGAGTGGG + Intergenic
1170199407 20:13726344-13726366 CAGTGTGGCTGGAGCATTGTCGG - Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170693742 20:18638583-18638605 CAGTGTGGCTGGAGCTTGGAGGG + Intronic
1171067490 20:22032512-22032534 CAGTGAGCCTGCTGCCTAGACGG + Intergenic
1171273639 20:23835852-23835874 CTGTGAGGCAGCAGCCTAGCTGG + Intergenic
1171366534 20:24628694-24628716 GAGTCTGGCTGCAGCCAAGCTGG + Intronic
1171443519 20:25186573-25186595 CTGTGAGGCAGCAGCCTAGCAGG - Intergenic
1173343369 20:42175302-42175324 CAGTGTGGCTGCAGCCTAGAGGG - Intronic
1173926536 20:46785238-46785260 CAGTGGGGTTGCAGCAAAGAGGG - Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174398886 20:50265105-50265127 CTGTGTGGCTGCAGCCCACAGGG - Intergenic
1175123591 20:56735583-56735605 CAGTGTGGCTCCAGCTCCGAGGG + Intergenic
1175699008 20:61123850-61123872 ATGGGTGGCTGGAGCCTAGAAGG - Intergenic
1177326905 21:19602354-19602376 AAGTGTTGCTGCAGTGTAGATGG + Intergenic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1178983506 21:37284214-37284236 CATGGTGTCTGCTGCCTAGATGG - Intergenic
1180034342 21:45236067-45236089 GAGTGTGGCAGCAGCCAGGAGGG + Intergenic
1180053477 21:45344672-45344694 CAATGTGGGCGCGGCCTAGAGGG - Intergenic
1181585055 22:23848662-23848684 CTGGGGGGCTGCAGCCTAGCTGG - Intergenic
1182103616 22:27673883-27673905 CAGCCTGGCTCCAGCTTAGAGGG + Intergenic
1182258968 22:29059062-29059084 CAGTGGGACAGCAGCCTGGAAGG - Exonic
1182336264 22:29585509-29585531 CAGTGTGGCCGCTGACTAGAAGG + Intergenic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
950267840 3:11588425-11588447 CAGTTGGGCTGCAGCCCAGGGGG + Intronic
950681533 3:14588534-14588556 CAGTGAGGCTGGACCCCAGAAGG - Intergenic
952273062 3:31851493-31851515 CAGAGTGGCTGCAGCCCATGAGG + Intronic
953000905 3:38932227-38932249 CAGTCAGGCTGGAGCCAAGATGG + Intronic
954729181 3:52643313-52643335 CAGTCTGGCTGCAGCCAAGTTGG + Exonic
954975822 3:54693343-54693365 CAGGATGGCTGCAGCCTAGGTGG - Intronic
955926644 3:64012643-64012665 CAGGGTGGCTCCAGCATAGTTGG - Intronic
956256673 3:67290599-67290621 CAGTGTGGCTGCAGAGGAAAGGG - Intergenic
956477395 3:69637067-69637089 CTGTGAGGCTGCAGCCTGGTGGG - Intergenic
956865367 3:73363840-73363862 CAGTGTTGTTGCAGAGTAGATGG - Intergenic
956918320 3:73898508-73898530 CAGTGTGACTGTATCATAGAAGG - Intergenic
957948893 3:87098373-87098395 CAGTGAGGGTGGAGCCAAGATGG - Intergenic
959824066 3:110771832-110771854 CAGTGTGGCTGCAGCAGAGCTGG - Intergenic
961930453 3:130527809-130527831 CATGGGGGATGCAGCCTAGAAGG - Intergenic
962436943 3:135375454-135375476 CAGTGTGGCTGAAATCCAGATGG - Intergenic
966086394 3:176072203-176072225 CAGTTTGGCTTCAGCCTGGCTGG + Intergenic
967756863 3:193179783-193179805 CTGTGTGGCAGCAGCCTGGCTGG + Intergenic
969010293 4:4056217-4056239 TTGTGTGGCTGAAGCCTAGAGGG - Intergenic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970228627 4:13885777-13885799 CAGCCTGGCAGAAGCCTAGAGGG - Intergenic
972995127 4:44870149-44870171 CAGTGTGCTTGAACCCTAGAAGG + Intergenic
973666600 4:53165571-53165593 CAGTGTGGCTGGAGCAAACAAGG - Intronic
974837998 4:67273918-67273940 CTGTGAGGCTGCAGCCTGGTTGG - Intergenic
976035877 4:80820514-80820536 CAGTGTTGCTGGAGCGTAGTGGG + Intronic
976877776 4:89876673-89876695 CAGTGTGGCTGGGACCTAGTAGG + Intergenic
978205306 4:106073836-106073858 CTGTGAGGCGGCAGCCTAGCTGG - Intronic
978928950 4:114287432-114287454 CTGTGAGGCTGCAGCCTGGCGGG + Intergenic
979745493 4:124207340-124207362 CAGTGAGGCTGAATCCCAGAGGG - Intergenic
979782158 4:124666170-124666192 CAGTGGAGCTGTAGCTTAGATGG - Exonic
980558727 4:134442869-134442891 CTGTGAGGCTGCAGCCTGGCAGG - Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
986206185 5:5627453-5627475 CAGTGTGGCTGCAGCCACGGAGG + Intergenic
986269205 5:6216753-6216775 GAGTGTGGATGCAGCCAGGATGG - Intergenic
988371383 5:30372333-30372355 CAGCGAGGCTGCAGTTTAGATGG + Intergenic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
993972856 5:94441439-94441461 CATTGTGGGTGCAGCCAAGGTGG - Intronic
994586525 5:101715998-101716020 CAGTGAGACTGCAGCCTGGCTGG - Intergenic
998172546 5:139881071-139881093 CAGTGGCCCTGCAGCTTAGATGG + Intronic
998224850 5:140319033-140319055 CAGCGTGGCTGGGGCCTAGAGGG - Intergenic
1001929672 5:175664022-175664044 AAGTGTGGCTGGAGCCAAGTTGG + Intronic
1001966515 5:175913672-175913694 CAGTGTGGCTGCAGCAAGTAGGG + Intergenic
1002250432 5:177925532-177925554 CAGTGTGGCTGCAGCGAGTAGGG - Intergenic
1002534593 5:179869320-179869342 CAGTGGTGCTGTAGCCTAGTGGG - Intronic
1002690275 5:181045600-181045622 TATTGTGTCTGCAGCCTAGCTGG + Intronic
1004847286 6:19658902-19658924 CAGTGAGGATGCAGCCTATTGGG + Intergenic
1006728169 6:36215028-36215050 CAGTTTGGCTGCAGCAGAGGGGG + Intronic
1006778775 6:36617468-36617490 CAATGTGTCTGCAGCCAACAGGG - Intergenic
1007273792 6:40658689-40658711 CAGTGGGGCTGCATCCTGGGGGG - Intergenic
1007899297 6:45395071-45395093 AAGTGTGGCTGAAGCCTAGTAGG - Intronic
1010842235 6:80659737-80659759 CAGTGTGGCTGGGGCCAGGAGGG + Intergenic
1014458209 6:121663605-121663627 GTGTGAGGCTGCAGCCTAGGTGG + Intergenic
1015563374 6:134540322-134540344 CAGTGAGTCTGGAGCCTAGAAGG + Intergenic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1019457317 7:1137168-1137190 CAGTGTGGCTGCAGCCAATTTGG - Intronic
1020147932 7:5659461-5659483 CAGTATGGCTGGAGCCCAGTGGG + Intronic
1022225115 7:28354778-28354800 CAGTGTGGCTGCAGGCTTCTGGG + Intronic
1023311628 7:38893198-38893220 CAATGTGGCTGTAGTGTAGAAGG - Intronic
1026760935 7:73125194-73125216 CAGTGAGGCAGCAGCGTGGATGG - Intergenic
1026844372 7:73689706-73689728 GAGTGTGGTTGCTTCCTAGAAGG + Intronic
1027037277 7:74933990-74934012 CAGTGAGGCAGCAGCGTGGATGG - Intergenic
1027086285 7:75267462-75267484 CAGTGAGGCAGCAGCGTGGATGG + Intergenic
1029210940 7:98907922-98907944 CAGTGTGGCTGCAGCACATCAGG - Intronic
1029392588 7:100285489-100285511 CAGTGAGGCAGCAGCGTGGATGG + Intergenic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029655280 7:101919914-101919936 CAGGATGGCTGGAGCCTTGAAGG + Intronic
1029959976 7:104680388-104680410 CACTTTTCCTGCAGCCTAGAGGG - Intronic
1030936754 7:115594212-115594234 CTGTGAGGCTGCAGCCTGGTGGG + Intergenic
1031895623 7:127345597-127345619 CAGTGTGGCTGCATTCGAGTGGG + Intergenic
1032250685 7:130254768-130254790 CAGCCTGGCTGCAGCCTTGTAGG + Intergenic
1032373447 7:131384097-131384119 CAGTGTGGTTGCAGCCTAATAGG - Intronic
1032512202 7:132481121-132481143 CAGTTTGGATGGATCCTAGATGG - Intronic
1032543727 7:132725060-132725082 CACTGTGGATACAGCCTGGAGGG + Intronic
1034560376 7:151876251-151876273 CTGGGCGGCTGCAGACTAGAGGG - Intronic
1035448255 7:158957619-158957641 CCGTGTGGCTGCAGCCCAGCTGG - Intergenic
1036448163 8:8841664-8841686 CAGTCTCTCTGCAGCCTGGAAGG - Intronic
1036721720 8:11181940-11181962 GAGTGTGGCTTGAGCCTGGAAGG - Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037680751 8:21095593-21095615 CTGTGGGGCTACAGCCTAGTAGG - Intergenic
1037897821 8:22669910-22669932 AGGTGTGGTGGCAGCCTAGAAGG + Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1040556704 8:48485959-48485981 CTGTGAGGCTGCAGCCTGGCGGG + Intergenic
1040617204 8:49048458-49048480 CAGTATGGGTGCAGCATTGATGG + Intergenic
1041618325 8:59934433-59934455 CAGTGTGGCAGGAGCATAGTTGG + Intergenic
1042318785 8:67452905-67452927 CAATGTGGCTGGAGCCAAGTGGG + Intronic
1044312841 8:90714147-90714169 CACTTTGGCTGCAGTCTGGAAGG + Intronic
1045031224 8:98138321-98138343 CAGGGTGGCTGAAGTGTAGAAGG - Intronic
1045384104 8:101654737-101654759 CAGTGTTCCTACAGCCTACAAGG + Intronic
1045678477 8:104633333-104633355 CAGTGTGGCGGCAGGCTGAAGGG + Intronic
1046970977 8:120223112-120223134 CAGTGTGGCTGGAACCCAAAAGG + Intronic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1047285020 8:123480304-123480326 GAGTGTGGCTGGAGCCTAACAGG + Intergenic
1048166825 8:132069125-132069147 CAATGTAGCTGCAGCAAAGATGG - Intronic
1048436889 8:134426382-134426404 CAGTTTGCCTGAACCCTAGAAGG - Intergenic
1055530063 9:77175345-77175367 CATTGTGGTAGCAGGCTAGATGG - Intergenic
1056377150 9:86025605-86025627 CAATGTGGCTGCAGCCTGAGGGG - Intergenic
1056668081 9:88597716-88597738 CTGTGAGGCTGCAGCCTGGCAGG + Intergenic
1056826674 9:89880662-89880684 CAGTGTGGCTGCGGTCAAGGAGG + Intergenic
1057172486 9:92971398-92971420 GTGTGTGGTTGCAGCCTAGGAGG - Intronic
1057190877 9:93086949-93086971 AAGTGTGGCTTCAGCCCACAAGG - Intergenic
1058710552 9:107675349-107675371 CAATGTGTCTGCATCCTAGAAGG - Intergenic
1061177623 9:129007179-129007201 GAGTGGGGCTGCAGCCTCGGGGG + Intronic
1061299924 9:129698368-129698390 CAGTCTGGCTGCAGAGAAGAGGG + Intronic
1061368851 9:130186788-130186810 CACGGTGACTGCAGCATAGAGGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062511422 9:136908254-136908276 CTGTGTGGCTGCAGCCATGCGGG + Intronic
1185666291 X:1767924-1767946 CAGAGTGACTGCAGCCCAGAGGG + Intergenic
1187124132 X:16437684-16437706 CAGTGTGGCTGTGGCCTCTAAGG - Intergenic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1190552572 X:51599843-51599865 TAGAGTGGCTGCAGTCTAGGAGG + Intergenic
1190622255 X:52299121-52299143 CTGTGAGGCTGCAGCCTGGCTGG + Intergenic
1190797815 X:53760528-53760550 CAGGCTGGCTCCAGCCAAGATGG - Intergenic
1190917346 X:54820682-54820704 CAGGCTGGCTCCAGCCAAGATGG + Intergenic
1192678841 X:73230242-73230264 CCGTGTGGCAGCAGCCTGGTAGG + Intergenic
1194429401 X:93782421-93782443 CAGTGTGACTGGAGCATAAAGGG + Intergenic
1194618410 X:96136700-96136722 CAATGTGCAAGCAGCCTAGAAGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199166064 X:144677255-144677277 CAATGTGGCTGCAGTATTGAGGG - Intergenic
1199968511 X:152841027-152841049 CTGTGAGGCTGCAGCCTGGAGGG - Intronic