ID: 1173351384

View in Genome Browser
Species Human (GRCh38)
Location 20:42248618-42248640
Sequence CTCAACACTGCTGTGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173351384_1173351390 6 Left 1173351384 20:42248618-42248640 CCTGGCCACACAGCAGTGTTGAG 0: 1
1: 0
2: 3
3: 26
4: 334
Right 1173351390 20:42248647-42248669 TCGGGTCAGCAGAGTCTTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173351384 Original CRISPR CTCAACACTGCTGTGTGGCC AGG (reversed) Intronic
900295966 1:1949869-1949891 CTCGGCAGTGCTGTGTGGCAGGG + Intronic
900965556 1:5955895-5955917 CTCATCATTTCTGTGTGGTCAGG - Intronic
901165282 1:7216552-7216574 CTCAACACTGCACTGCAGCCTGG - Intronic
902599273 1:17530126-17530148 AACAAGACTGCTGTGTGGCCAGG - Intergenic
902616990 1:17629321-17629343 CTTAAAACTACTGTGTGGGCCGG - Intronic
902987419 1:20163540-20163562 CTCAAGTCTGCTCTGTGTCCCGG + Intronic
903467529 1:23562411-23562433 ATCAACACAGCTGTGGGACCGGG - Intergenic
904661933 1:32091831-32091853 CACAAGACAGCTGTATGGCCCGG + Exonic
905647764 1:39636200-39636222 CTCTAATTTGCTGTGTGGCCTGG - Intronic
906184430 1:43850854-43850876 ATCAACTCTGCTGTGTTCCCTGG - Intronic
907150779 1:52285387-52285409 CTCACCTCTGCTGTGTGGCCTGG - Intronic
908161522 1:61413383-61413405 CTCAACACTCCTATGAGGTCAGG + Intronic
908884963 1:68778552-68778574 CTTAAAATTGCTGTGTGGGCAGG - Intergenic
909204615 1:72739545-72739567 CTCTACCTTGCTCTGTGGCCAGG + Intergenic
911922274 1:103780346-103780368 CTCAACAGTGCTGTGAGGGTAGG + Intergenic
912165318 1:107036591-107036613 CTCAATAATGCTCTGTGTCCTGG - Intergenic
912269195 1:108192374-108192396 CTGAACACTGCAGTGGGCCCAGG + Intronic
914009515 1:143764674-143764696 CTCAAAACTGGTTTGTAGCCCGG + Intergenic
914165684 1:145173254-145173276 GTCCACACTCCTGTGTGGCACGG - Intergenic
915210582 1:154305907-154305929 TGCAACACTGCTGAGTGACCTGG + Intergenic
915284747 1:154845609-154845631 CGCAGCATTGCTGTGTGGCATGG + Intronic
915364181 1:155304950-155304972 TTCCACTCTGCTGTGGGGCCAGG + Intergenic
916045707 1:160998656-160998678 CCTACCACTGCTGAGTGGCCTGG - Exonic
918005628 1:180539824-180539846 CTGAACATTGCTGCTTGGCCAGG - Intergenic
920540199 1:206772405-206772427 CTCAGCACTGCTCTGTTGCCTGG - Exonic
922995331 1:229953321-229953343 CTACACACTGCTGTTTGACCAGG - Intergenic
924354652 1:243159021-243159043 CGCACCACTGCACTGTGGCCTGG + Intronic
1063238417 10:4143280-4143302 CTCAACTCTGCAGGATGGCCAGG - Intergenic
1063530007 10:6821691-6821713 GGCAACACGGCTTTGTGGCCTGG - Intergenic
1065011315 10:21423391-21423413 CTCACCACTGCACTCTGGCCTGG + Intergenic
1065083561 10:22151494-22151516 ATCAACACAGCTGAGTGGCTGGG - Intergenic
1065284328 10:24173029-24173051 CTCACCCCTGCTGTGCAGCCTGG - Intronic
1065420510 10:25538668-25538690 CTCAACATTTATGTGTAGCCAGG - Intronic
1065536974 10:26724619-26724641 CACACCACTGCTTTGTAGCCTGG - Intronic
1065625149 10:27622707-27622729 CTGAAGACTGATTTGTGGCCTGG - Intergenic
1066433334 10:35373364-35373386 CCCAACACTGCTGGGTGGCAAGG - Intronic
1067060230 10:43074635-43074657 CTCAGCAGGGCAGTGTGGCCAGG + Intergenic
1067095167 10:43295022-43295044 CTCCACAGAGCTGTGGGGCCAGG - Intergenic
1067523760 10:47026534-47026556 CTGGAAACTGCTGTGAGGCCTGG - Intergenic
1067573431 10:47388284-47388306 GTCAAAACTGCTGTATGACCAGG - Intergenic
1070737091 10:78870573-78870595 CTCATCTTTCCTGTGTGGCCTGG + Intergenic
1071097756 10:81998454-81998476 CTCCACACTGCTGTGTAGTGTGG + Intronic
1072553582 10:96497417-96497439 CTCCACTCTGCTCTGTGTCCAGG + Intronic
1072906529 10:99458933-99458955 CTCAACCTTGCTGAGTGTCCTGG + Intergenic
1074124928 10:110521294-110521316 CTCACCACTGCACTGTAGCCTGG - Intergenic
1074944449 10:118267973-118267995 CAAAACACTGGAGTGTGGCCAGG + Intergenic
1075931825 10:126303684-126303706 CTCAAAGCTGCTCTGTGGCTAGG - Intronic
1076143057 10:128095063-128095085 CTCAACAATGCTATGTGCTCAGG + Intergenic
1077025101 11:436595-436617 CTCACCCCTGCTCTGTGGCCCGG - Intronic
1077116991 11:889683-889705 CTCAGGGCTGCTGTGGGGCCTGG - Intronic
1077117614 11:892327-892349 TGCAGCACTGCTGTGTGCCCTGG - Intronic
1077123863 11:923996-924018 CTAAACACTCTTGTGTGGACGGG + Intergenic
1080403100 11:31955271-31955293 ATCAACAGTGTTGTGTTGCCAGG + Intronic
1081085529 11:38795703-38795725 CTCAACAGTGCTTTGGGGACTGG - Intergenic
1083738267 11:64694119-64694141 CTCAGCCCAGCTGTGGGGCCTGG - Intronic
1084426351 11:69086439-69086461 AACACCACTGCTGCGTGGCCAGG - Intronic
1085260909 11:75204171-75204193 CTGGACTCTGCTCTGTGGCCTGG - Intronic
1087765808 11:102151983-102152005 TTGAACACAGCTGTGTGTCCAGG + Intronic
1087941130 11:104098546-104098568 TGCAGCACTGCTGTATGGCCTGG - Intronic
1089019522 11:115198353-115198375 CTCAGCACTGCTGAGAGGCAAGG - Intronic
1089588424 11:119524476-119524498 CTCACCACTGGTGTATGGCTTGG - Intergenic
1089787426 11:120918057-120918079 CTCATCTCTGCTGTGTGGCTGGG - Intronic
1091038825 11:132257532-132257554 CTCTGCCCTGCAGTGTGGCCTGG + Intronic
1094004907 12:25738895-25738917 GTCACCACAGCAGTGTGGCCTGG + Intergenic
1094672956 12:32588683-32588705 CCCAGCATTGCTGAGTGGCCTGG + Intronic
1096059780 12:48686860-48686882 CTCACCACTGCACTCTGGCCTGG + Intergenic
1097107386 12:56633779-56633801 CACAACACTGCATTCTGGCCTGG - Intronic
1097642292 12:62196963-62196985 CTCACCCCTGCTGTGAGGCTGGG - Intronic
1098659619 12:73075754-73075776 CTCAGCAGTTCTGTGTGGGCAGG - Intergenic
1102077872 12:110074238-110074260 CTCCACCCTGCTCTGTGCCCCGG + Intergenic
1102482096 12:113230949-113230971 CTCAGCACAGCTGAGTGTCCTGG + Intronic
1102620588 12:114191561-114191583 ATCCACACTGCTCTGTGCCCAGG + Intergenic
1104596106 12:130120763-130120785 CTCAACACCTCTGTGTGAACTGG + Intergenic
1104628015 12:130375762-130375784 CTCAAAACTCCTGTGTTGTCTGG + Intergenic
1104662444 12:130620891-130620913 CTCACCACTGCTGGGTGGGGTGG - Intronic
1105067715 12:133215350-133215372 GTTACCTCTGCTGTGTGGCCTGG - Intergenic
1107352983 13:39535361-39535383 CTCAACACAGCAGAGTGGCTGGG + Intronic
1110419066 13:75284553-75284575 CCCACCACTGCTGTGCAGCCTGG + Intergenic
1110645911 13:77883957-77883979 CCAAACAGTGCTGTGTGCCCTGG + Intergenic
1113522930 13:110953503-110953525 CCCAGCACTGCAGTCTGGCCTGG - Intergenic
1113542930 13:111122983-111123005 CTCCACTCTGCTTTGTGTCCTGG - Intronic
1114654116 14:24305725-24305747 CTCCACACTGCTGCAAGGCCTGG - Exonic
1116973237 14:51090638-51090660 CTCACCACTGCACTGTAGCCTGG - Intronic
1117931575 14:60847358-60847380 CGCACCACTGCAGTCTGGCCTGG + Intronic
1119292402 14:73505932-73505954 CTCACCACTGCTCTCTAGCCTGG - Intronic
1119709194 14:76809182-76809204 CTTCCCACTGCTCTGTGGCCAGG + Exonic
1120680666 14:87477359-87477381 CTCGATACTGGTTTGTGGCCTGG + Intergenic
1121206276 14:92171168-92171190 CTCATCACTGCACTGTAGCCTGG - Exonic
1121333257 14:93061191-93061213 CTCAACACAGATCTGGGGCCAGG + Intronic
1121547673 14:94773804-94773826 GTGAACTCTGCTCTGTGGCCGGG - Intergenic
1122036718 14:98954364-98954386 CCCCGCACTTCTGTGTGGCCGGG - Intergenic
1122212618 14:100182455-100182477 CAGAACTCTGCTGGGTGGCCAGG + Intergenic
1122871261 14:104640106-104640128 GTCCACACTGCTGCCTGGCCGGG + Intergenic
1122984041 14:105204015-105204037 CACACCAGTGCTGTGTGACCTGG - Intergenic
1124212365 15:27774387-27774409 CTCAATGATGCTGGGTGGCCAGG - Intronic
1124372292 15:29110672-29110694 CTCCACATGGCTGTGTGACCTGG - Intronic
1124969327 15:34469590-34469612 CTCACCACTGCAGTCTAGCCTGG + Intergenic
1125000801 15:34768305-34768327 CTCAGCCCTGCTCTGTGTCCTGG + Intergenic
1125178306 15:36851551-36851573 TTCTACCCTGCTGTGTGGCCTGG + Intergenic
1127303892 15:57683339-57683361 CTCCACCCTACTCTGTGGCCCGG - Intronic
1128557596 15:68642256-68642278 CCCAACCCTGCTGTGTGACTTGG - Intronic
1129413483 15:75362220-75362242 CTCATCCCCGCTGTGTGGCAGGG - Intronic
1129673868 15:77621982-77622004 CTCAGCCTGGCTGTGTGGCCAGG + Intronic
1129751147 15:78065394-78065416 CTCAGCCCAGCTGGGTGGCCTGG - Intronic
1131304584 15:91230612-91230634 CTCAACCCTGCTTAGTGTCCAGG + Intronic
1132615141 16:837243-837265 CTCACCACTGCACTCTGGCCTGG - Intergenic
1133863174 16:9616232-9616254 CTCCACTCTGCTCTGTGACCTGG + Intergenic
1134090047 16:11386734-11386756 CTCAGGCTTGCTGTGTGGCCAGG - Intronic
1134102000 16:11459238-11459260 CGCACCACTGCAGTCTGGCCTGG - Intronic
1134265370 16:12688071-12688093 CGCACCACTGCAGTGTAGCCTGG - Intronic
1135112308 16:19699704-19699726 CTCAACACAGCATTGTGGCCTGG + Intronic
1136132811 16:28234649-28234671 GTCAAGACTGCAGTGTGGCCGGG - Intergenic
1137403189 16:48170077-48170099 GCCACCACTGCCGTGTGGCCAGG - Intronic
1138448628 16:57079697-57079719 CTCCAGCCTGCTGTGTGGCCTGG + Intronic
1138544574 16:57708205-57708227 CTGAACACACCTGTGTAGCCAGG + Intronic
1138582745 16:57952254-57952276 CTCCACCTTCCTGTGTGGCCTGG - Intronic
1141815583 16:86407485-86407507 CTTATCACTGCTGAGGGGCCTGG + Intergenic
1142291955 16:89197259-89197281 CTGGACCCTGCTGTGTGGCCGGG + Intronic
1144523004 17:15966885-15966907 CTGAGCACTGCAGTGAGGCCAGG - Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1144946828 17:18973607-18973629 CTCCACTTTGCTCTGTGGCCAGG + Intronic
1145090493 17:19981921-19981943 CCCACCACTGCAGTCTGGCCTGG - Intergenic
1145788391 17:27609004-27609026 TTCTTCACTGCTGTGTGGCTTGG + Intronic
1146168484 17:30612493-30612515 CTCACTCCTGCTGTGCGGCCTGG + Intergenic
1146221452 17:31025993-31026015 CTCACTCCTGCTGTGCGGCCTGG + Intergenic
1147426776 17:40349562-40349584 CTCAACACTGCAGGATGGGCAGG - Intronic
1147641878 17:42007565-42007587 CTCACCACTGCACTCTGGCCTGG - Intronic
1147941898 17:44054682-44054704 CCCATCACTGCTGAGTGGCAGGG - Intronic
1148867446 17:50635837-50635859 CGCACCACTGCACTGTGGCCTGG + Intronic
1151308936 17:73281784-73281806 CTTAACAGAGCTCTGTGGCCTGG + Intergenic
1151496157 17:74459527-74459549 TTAAATACTGCTGAGTGGCCGGG - Intergenic
1151579135 17:74968363-74968385 CTCAGCCCTGCTCTGTGGCCAGG - Intronic
1151665726 17:75544188-75544210 CCCCACACTGCTTGGTGGCCCGG - Intronic
1152431754 17:80252160-80252182 CTGGCCACTGCTGTGTGGCCTGG - Intronic
1152509795 17:80778767-80778789 CCCCACTCTGCTGTGTGGGCTGG - Intronic
1152901508 17:82943695-82943717 CCCCACACTCCTGTGTGGCCAGG - Intronic
1152912918 17:83015655-83015677 CTCACTCCTGCTGTGTGGCCTGG - Intronic
1153618015 18:6951973-6951995 CTCAACATCTCTGTGTGGCCTGG - Intronic
1155160470 18:23191203-23191225 CTCAACACTGCACTCTAGCCTGG + Intronic
1156352818 18:36315629-36315651 CTCATTGCTGCTGTGAGGCCAGG - Intronic
1156401961 18:36747668-36747690 CACATCACTGCTGTGTCTCCAGG - Intronic
1157334054 18:46724360-46724382 CTCCCCACTGCTGTGGAGCCTGG - Intronic
1158430880 18:57386187-57386209 CTCAATAAGGCTGTGTGGACTGG + Intergenic
1158534214 18:58292640-58292662 CTCAAAGCTCCTGTGAGGCCAGG + Intronic
1158753976 18:60300190-60300212 CTCAATACGGATCTGTGGCCTGG + Intergenic
1160037950 18:75318853-75318875 CTCTCCAGTGCTGTGTGGGCTGG + Intergenic
1160216977 18:76940839-76940861 CTCACCCCTGCTGTGCGGCCTGG - Intronic
1160704656 19:524343-524365 CTCTATGCTGCTGTGAGGCCAGG - Intergenic
1161462764 19:4408515-4408537 CCCAACACTGCACTGTAGCCTGG - Intronic
1161923712 19:7285404-7285426 CACACCACTGCAGTCTGGCCTGG + Intronic
1163199853 19:15759538-15759560 CTCAGCTTTGCTGTGTGGCTTGG - Intergenic
1163215125 19:15871025-15871047 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163228294 19:15980174-15980196 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163460805 19:17436451-17436473 CTCCACACTGGTGTGAGCCCAGG - Exonic
1163602087 19:18255335-18255357 CTCTGCACAGGTGTGTGGCCAGG + Exonic
1163611071 19:18301884-18301906 GTCACCATTGCTGTGTGACCTGG + Intergenic
1163886552 19:19970753-19970775 CTGAAGACTTCTGTGTAGCCAGG + Intergenic
1164168984 19:22707398-22707420 AAAAACACTGCTTTGTGGCCGGG - Intergenic
1166144557 19:40825091-40825113 CTCCACGCTGCTGTGTGGGTGGG + Intronic
1166183185 19:41122970-41122992 CTCCACGCTGCTGTGTGGGTGGG - Intronic
1166567177 19:43772328-43772350 CTCCTCTCTGCTGTGTGACCTGG + Intronic
1167264425 19:48476578-48476600 CTCAAAACTGCTGTCAGGCCAGG + Intronic
1168557324 19:57354050-57354072 CACAACACTGCACTGTAGCCTGG - Intronic
926664865 2:15510190-15510212 TGCAAGACTGCAGTGTGGCCAGG + Intronic
927473640 2:23395699-23395721 CGCAACACTGCACTGTAGCCTGG + Intronic
928154745 2:28866588-28866610 CGCTAACCTGCTGTGTGGCCCGG + Intronic
928716856 2:34071255-34071277 CTCAATACTGGTCTATGGCCTGG + Intergenic
929681031 2:43994095-43994117 CTCAGCATTTCTGTGAGGCCAGG - Intronic
930204400 2:48573550-48573572 CACAACACTGATGTGGGGCTTGG - Intronic
930611782 2:53553063-53553085 TTCAAGACTGCTGTGTGGAGTGG - Intronic
930967249 2:57344746-57344768 CTCACCACTGCACTGTAGCCTGG - Intergenic
932165586 2:69503561-69503583 CACAACACTGCTTTCTAGCCTGG - Intronic
933300974 2:80540736-80540758 CACACCACTGCACTGTGGCCTGG - Intronic
936810066 2:116387908-116387930 CTCCACCCTGCTCTGTGTCCTGG + Intergenic
938841628 2:135170595-135170617 GTCAACTCTGCTGTGTGGATCGG + Intronic
938911893 2:135893143-135893165 TTCCACTCTGCTGTGTGTCCTGG - Intergenic
940312492 2:152293140-152293162 GTCAACACTGGTGTGAGACCTGG - Intergenic
940769534 2:157825462-157825484 CTTACCTCTGCTGTGCGGCCGGG - Intronic
942652943 2:178187921-178187943 CTGAGCACTGCTGTGTTGCTGGG + Intergenic
944893433 2:204140521-204140543 CGCAACCCAGCTGTGAGGCCAGG - Intergenic
946369769 2:219273823-219273845 CTCAACACCCCAGTGTTGCCCGG + Intronic
946641553 2:221788952-221788974 CTCCACTCTGCTCTGTGCCCTGG - Intergenic
947629164 2:231640757-231640779 TGCAGCACTGCTGTGTTGCCAGG + Intergenic
948074815 2:235157712-235157734 CTCAACTCTGCACTGTTGCCAGG + Intergenic
948964433 2:241366293-241366315 CTCAACACTTCTGTGGGGGATGG - Intronic
948982537 2:241501699-241501721 CTCGAGAGTGCTGTGGGGCCAGG + Exonic
1169186983 20:3626824-3626846 CACAACACTGCACTCTGGCCTGG - Intronic
1171717784 20:28510080-28510102 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171717891 20:28511958-28511980 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718111 20:28515712-28515734 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718196 20:28517252-28517274 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718302 20:28519130-28519152 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718416 20:28521007-28521029 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718526 20:28522885-28522907 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718634 20:28524762-28524784 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718744 20:28526640-28526662 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718852 20:28528519-28528541 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718957 20:28530397-28530419 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719068 20:28532275-28532297 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719172 20:28534153-28534175 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719256 20:28535690-28535712 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719367 20:28537568-28537590 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719475 20:28539446-28539468 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719584 20:28541324-28541346 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719686 20:28543201-28543223 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719797 20:28545078-28545100 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719998 20:28548816-28548838 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171720103 20:28550694-28550716 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171720235 20:28553085-28553107 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171720341 20:28554963-28554985 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171720450 20:28556840-28556862 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171728042 20:28645006-28645028 CTCAAAACTGCTGTGTGAAAAGG + Intergenic
1172489323 20:35322436-35322458 CTCAAAACTGTTAAGTGGCCAGG + Intronic
1172735153 20:37121274-37121296 CTCACCACTGCACTCTGGCCTGG - Intronic
1173351384 20:42248618-42248640 CTCAACACTGCTGTGTGGCCAGG - Intronic
1174450413 20:50616702-50616724 CTCTTCTCTGCTGTGTGACCGGG - Intronic
1175582811 20:60113511-60113533 CTCTGCACTGCGGTCTGGCCTGG - Intergenic
1177251850 21:18602912-18602934 CACACCACTGCTCTCTGGCCCGG - Intergenic
1179814219 21:43893685-43893707 TTCAACACTGCTGTGTAACAGGG + Intronic
1180874082 22:19166501-19166523 TGCAACACTGCAGTGTAGCCTGG + Intergenic
1181005269 22:20010442-20010464 CTCAAGACAGGTGAGTGGCCTGG - Exonic
1181776980 22:25166779-25166801 CTCTGCCCAGCTGTGTGGCCTGG - Intronic
1182079314 22:27518008-27518030 CTCCACTCTGCTGTGTGGCCTGG - Intergenic
1182302626 22:29346154-29346176 CTCCTCCCTGTTGTGTGGCCTGG - Intronic
1182547146 22:31082934-31082956 CGCCAGTCTGCTGTGTGGCCTGG - Intronic
1183650222 22:39149381-39149403 GTCCTCAGTGCTGTGTGGCCAGG - Intronic
1183850558 22:40583569-40583591 CTCAGTCCTGCTGTGTGGCCTGG - Intronic
1184039585 22:41935037-41935059 CTCAGCTCTGCTGTGAGGCAGGG + Intergenic
1184527749 22:45035546-45035568 CCCAATACTGCTGTGAGGCAGGG + Intergenic
1184669242 22:46004202-46004224 GTCAACTCTCCTGGGTGGCCTGG + Intergenic
1184819777 22:46901192-46901214 CTTAATCCTGCAGTGTGGCCTGG - Intronic
949331796 3:2931670-2931692 CTCACCACTGCTGTCCAGCCTGG - Intronic
950064942 3:10104536-10104558 CGCAACTCTGATGTGTGGCAGGG + Exonic
952763152 3:36933501-36933523 GTGCTCACTGCTGTGTGGCCTGG - Intronic
952934213 3:38382965-38382987 CTCCAGGCTGCTGTGTGGACTGG + Intronic
953128432 3:40113731-40113753 AGCACCACTGCTGTCTGGCCTGG - Intronic
953731043 3:45448353-45448375 CCCCACACTGCTGTTTGGTCAGG + Intronic
954021352 3:47744970-47744992 CTTAAAACTGCTATCTGGCCAGG + Intronic
955594937 3:60578391-60578413 CTCACCACTGCACTCTGGCCTGG + Intronic
956739099 3:72260981-72261003 CTCTACCCTGCTCTGTGTCCTGG + Intergenic
957331575 3:78771021-78771043 CACACCACTGCAGTCTGGCCTGG + Intronic
957518592 3:81289114-81289136 CTCCAGACTGCTGGGTGACCAGG + Intergenic
960123952 3:113977262-113977284 CTCAACATTACTCTGTTGCCCGG - Intronic
960925032 3:122786226-122786248 CTCTACACTGTTCTGTGGCTTGG + Intronic
962186322 3:133263770-133263792 CTCACCGCAGCTGTGTGGTCTGG - Intronic
964402828 3:156316870-156316892 CTTTACCCTGCTTTGTGGCCTGG - Intronic
965659412 3:171025593-171025615 CACTAAACTGCTGTGAGGCCTGG - Intronic
966219883 3:177540861-177540883 CTCAACACAGCTGTGAGGCAAGG - Intergenic
967228845 3:187318657-187318679 CTCAAATCTGCTCTGTGCCCCGG + Intergenic
967907170 3:194511019-194511041 CGCACCACTGCTTTGTAGCCTGG + Intergenic
968912926 4:3485039-3485061 CTCAAGACGGCTGTGGGGGCAGG + Intronic
969314151 4:6371451-6371473 CTGACCACTGCTGGGTGCCCAGG + Intronic
969671941 4:8594472-8594494 CTCAACTCTGCTGTGTGACCTGG + Intronic
969692165 4:8709755-8709777 CCACACACTGTTGTGTGGCCTGG - Intergenic
970648657 4:18152807-18152829 CACACCACTGCACTGTGGCCTGG + Intergenic
973546918 4:51991425-51991447 CTCCATCCTGCTCTGTGGCCTGG + Intergenic
973784706 4:54324038-54324060 CTTAACTCTGCTCTCTGGCCAGG + Intergenic
975549433 4:75595883-75595905 CTCACCACTGCACTGTAGCCTGG + Intronic
976091305 4:81460820-81460842 CTCAACACTGGTTTGTGGAGGGG - Intronic
976198410 4:82556300-82556322 CTCTCCACTGCCTTGTGGCCTGG + Intronic
978614528 4:110581229-110581251 CTTAAGAATGCTTTGTGGCCAGG - Intergenic
979247154 4:118520630-118520652 CGCACCACTGCACTGTGGCCTGG - Intergenic
980705585 4:136488803-136488825 CTCCACCCTGCTTTGTGACCTGG - Intergenic
983067261 4:163225831-163225853 CTCACCATTGCACTGTGGCCTGG - Intergenic
984395150 4:179188504-179188526 CACACCACTGCACTGTGGCCTGG - Intergenic
985158935 4:187024113-187024135 CTCCACTCTGCTGTGTGCTCTGG + Intergenic
985199174 4:187466573-187466595 CTCAATGCTGGGGTGTGGCCTGG - Intergenic
985514267 5:331665-331687 CTCACTCCTGCTGTTTGGCCTGG - Intronic
985564223 5:607251-607273 CTCTGTCCTGCTGTGTGGCCAGG - Intergenic
985693943 5:1329447-1329469 CTCACCACTGCTTGGTGGACAGG + Intronic
985720192 5:1484893-1484915 CCCAGCACTTCTGTGTGCCCAGG + Intronic
985816942 5:2134285-2134307 CTCAACGCTGCAGTGTGGCTGGG + Intergenic
989432813 5:41375269-41375291 CTCAACACTGCATGGTGCCCTGG - Intronic
990630418 5:57662570-57662592 CTCAACCCTGGTGTCTGCCCAGG - Intergenic
991936003 5:71800727-71800749 CACAACACTGCAGTCTAGCCTGG + Intergenic
993938868 5:94034765-94034787 ATCAGCACTGGTCTGTGGCCTGG - Intronic
994150726 5:96444960-96444982 CTCAACTCTTCTATCTGGCCAGG - Intergenic
996743597 5:126825839-126825861 CTATACACAGCTATGTGGCCAGG - Intronic
996942298 5:129022779-129022801 CTCATCACTGCACTGTAGCCTGG + Intronic
999457688 5:151731509-151731531 CTCAGCACTGCACTTTGGCCTGG + Intergenic
999608623 5:153344842-153344864 CTCCACTCTGCTATGTGGACAGG - Intergenic
1001304292 5:170560533-170560555 CACAACACTGCTGTGTGACAGGG - Intronic
1002517692 5:179771915-179771937 CTGACCACAGCTGTGTGTCCTGG + Intronic
1002798313 6:495167-495189 CGCACCACTGCAGTCTGGCCTGG - Intronic
1002958854 6:1895535-1895557 CTCAATACACATGTGTGGCCAGG + Intronic
1003344864 6:5257568-5257590 CGCTCAACTGCTGTGTGGCCCGG - Intronic
1003474553 6:6469495-6469517 CACAACACTGAGGTGTTGCCTGG + Intergenic
1005132131 6:22521448-22521470 CTCACCACTGCTCTCTGGGCAGG - Intergenic
1005759578 6:28955700-28955722 CACAACACTGCTAAGAGGCCGGG + Intergenic
1006775131 6:36586614-36586636 CTCAGCCCTGCTCTGTGCCCTGG + Intergenic
1006810522 6:36817652-36817674 CCCCACACTGCTCTGTGCCCAGG + Intronic
1006998988 6:38290783-38290805 CACAACCCTGCTGTGTGCCTGGG + Intronic
1010055384 6:71558362-71558384 CTCAACACCTCTGGTTGGCCAGG + Intergenic
1010225227 6:73482833-73482855 CGCACCACTGCAGTCTGGCCTGG - Intronic
1011069816 6:83368036-83368058 TTCAACACTGTTGTGTGTCTGGG + Intronic
1011661644 6:89599894-89599916 ATAAACACTGCTGTCAGGCCAGG - Intronic
1012472342 6:99586509-99586531 TTCAACACTGCTGTGTCTCAGGG + Intergenic
1012953136 6:105540424-105540446 ATCAACACAGCTGTATTGCCTGG + Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1013765701 6:113572030-113572052 CTCACTCCTGCTGTGCGGCCAGG + Intergenic
1015635973 6:135274380-135274402 GTCAACACTGCTGGCTGGGCTGG + Intergenic
1015841066 6:137477896-137477918 CCCAACACAGCTATGTGACCTGG - Intergenic
1015927315 6:138323314-138323336 TTCAAGACTCCTTTGTGGCCGGG + Intronic
1018252378 6:161883691-161883713 CTCACCACTGCGCTCTGGCCTGG - Intronic
1019154069 6:170027017-170027039 CACACCCCAGCTGTGTGGCCTGG - Intergenic
1019203656 6:170341280-170341302 CCCAACAGTGCTGGGAGGCCAGG - Intronic
1021030554 7:15728829-15728851 CTCAACACTTCTGTGTATCTGGG + Intergenic
1025201220 7:56963013-56963035 CTCCACCCTGCTGAGTGCCCTGG + Intergenic
1025212977 7:57031589-57031611 CTAGACACTGCTGGGGGGCCGGG - Intergenic
1025658976 7:63545235-63545257 CTAGACACTGCTGGGGGGCCGGG + Intergenic
1025670724 7:63613920-63613942 CTCCACCCTGCTGAGTGCCCTGG - Intergenic
1026655315 7:72251440-72251462 CACACCACTGCAGTCTGGCCTGG - Intronic
1026663968 7:72326016-72326038 CTCAAGCCTTCTGAGTGGCCAGG + Intronic
1026905543 7:74060802-74060824 TTCAGCAGTGCTCTGTGGCCAGG + Intronic
1028180741 7:87720643-87720665 CTCACCACTGCACTCTGGCCTGG - Intronic
1031259330 7:119497654-119497676 CTCACCACTGCACTCTGGCCTGG - Intergenic
1032076658 7:128839199-128839221 CTCACCTGTGCTGTGTGGCATGG + Intronic
1032757446 7:134904519-134904541 CTCACCACTGCACTCTGGCCTGG + Intronic
1033194764 7:139318544-139318566 CACAACACTGCATTCTGGCCTGG - Intergenic
1033540212 7:142349431-142349453 CATGACACTGCTGTGTGCCCAGG + Intergenic
1033846598 7:145440640-145440662 CACAACAATGCTGTGAGGTCAGG - Intergenic
1034539134 7:151744905-151744927 CTCAACCATGCTGTGTGGTAGGG + Intronic
1034820976 7:154216043-154216065 CTCAACACTGCTGTGGTTCCTGG - Intronic
1035439342 7:158883259-158883281 CACACCACTGCTCTCTGGCCTGG - Intronic
1035629236 8:1095564-1095586 GTCAACACTGTTGTGAGGCTTGG + Intergenic
1037666265 8:20972745-20972767 CTCAACCCTGCTGAGGGGCCAGG + Intergenic
1038713981 8:29975073-29975095 CTCAACATTGCACTCTGGCCTGG + Intergenic
1039965777 8:42282500-42282522 CTTAAAACTGCTTTGTGGCTGGG - Intronic
1043077142 8:75716160-75716182 CTCAATACTTTTGTGTGGCATGG + Intergenic
1044582610 8:93837168-93837190 CTCAACACTGAAGTCTGTCCAGG - Intergenic
1044866388 8:96575079-96575101 CTCACCTCTGCTGTGCAGCCTGG + Intronic
1047983123 8:130204081-130204103 CTCACTCCTGCTGTGTGGCCTGG - Intronic
1048308908 8:133303241-133303263 ATCAACCCTGCTGTGTTTCCAGG - Intergenic
1048472701 8:134717740-134717762 CTCACCACTGCACTCTGGCCTGG - Intergenic
1049159161 8:141086406-141086428 CTCGACACTACTGTGTGCCTGGG - Intergenic
1049351678 8:142167932-142167954 CTCAAAGCTTCTGTGAGGCCAGG + Intergenic
1049365410 8:142234607-142234629 CCCAGCCCTGCTGTGTGACCAGG + Intronic
1050998648 9:12252333-12252355 CTCACCACTGCACTCTGGCCTGG + Intergenic
1051796787 9:20880540-20880562 CTCAACCCTGCTCTGTGCTCTGG - Intronic
1052394777 9:27925738-27925760 GACAACACAGCTGTGTGTCCAGG + Intergenic
1054872073 9:70056716-70056738 CTCAATCCTGCTGTGTGGCTGGG - Intronic
1055913229 9:81374608-81374630 CTCAAAACTGCTGAGTGGGAAGG - Intergenic
1056256992 9:84809836-84809858 CTCACCACTGCACTCTGGCCTGG + Intronic
1056664882 9:88573437-88573459 TTCAAGACTACTGTATGGCCAGG - Intronic
1057920490 9:99092990-99093012 CTCAACTCAGCTGTGGTGCCAGG + Intergenic
1058562846 9:106248067-106248089 TTCAAATATGCTGTGTGGCCAGG - Intergenic
1058703690 9:107621559-107621581 GACAACACAGCTGTGTGACCTGG - Intergenic
1061664228 9:132151034-132151056 CTCACCACTGCACTCTGGCCTGG + Intergenic
1062489661 9:136799091-136799113 CCCGACACTGCTCTGTGGGCAGG - Exonic
1203742741 Un_GL000218v1:16865-16887 CTCCACAATGCTGTGAGCCCAGG + Intergenic
1187098330 X:16168976-16168998 CTCAGCTCTGCTGTGCGCCCTGG + Intronic
1189292004 X:39893320-39893342 CTGACCACTGCTGACTGGCCAGG + Intergenic
1190775827 X:53551578-53551600 CTCAACACTGCAGTGAGGCAAGG - Intronic
1190980176 X:55450520-55450542 CTCAAGAGTGCTCTGTGTCCTGG + Intergenic
1192156418 X:68750159-68750181 CTCAGCACTGCTGTTTGCCAGGG - Intergenic
1192218385 X:69179786-69179808 CTCACCTCTGCTGAGTGGCGTGG + Intergenic
1192220659 X:69195410-69195432 CTCATCTCTGCTGTCAGGCCCGG + Intergenic
1198557657 X:137812329-137812351 CTCCACTCTGCTTTGTGACCAGG - Intergenic
1200957266 Y:8963074-8963096 CGCACCACTGCAGTGTAGCCTGG - Intergenic
1201273879 Y:12281288-12281310 CCCACCACTGCAGTCTGGCCTGG + Intergenic
1202327202 Y:23704271-23704293 CTCACCACTGCAGTCTAGCCTGG - Intergenic
1202373405 Y:24213061-24213083 CTCAAAGCTGCTGTGGGGCTCGG + Intergenic
1202497376 Y:25457059-25457081 CTCAAAGCTGCTGTGGGGCTCGG - Intergenic
1202543568 Y:25965781-25965803 CTCACCACTGCAGTCTAGCCTGG + Intergenic