ID: 1173352416

View in Genome Browser
Species Human (GRCh38)
Location 20:42257199-42257221
Sequence CTAAAATCAAGCTGCAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173352416_1173352422 20 Left 1173352416 20:42257199-42257221 CCAGAACTGCAGCTTGATTTTAG 0: 1
1: 0
2: 2
3: 19
4: 165
Right 1173352422 20:42257242-42257264 AGAAACTGTGGCTGACTTTCAGG 0: 1
1: 0
2: 4
3: 27
4: 244
1173352416_1173352420 8 Left 1173352416 20:42257199-42257221 CCAGAACTGCAGCTTGATTTTAG 0: 1
1: 0
2: 2
3: 19
4: 165
Right 1173352420 20:42257230-42257252 AGGCCAACATGGAGAAACTGTGG 0: 1
1: 0
2: 7
3: 81
4: 810
1173352416_1173352418 -3 Left 1173352416 20:42257199-42257221 CCAGAACTGCAGCTTGATTTTAG 0: 1
1: 0
2: 2
3: 19
4: 165
Right 1173352418 20:42257219-42257241 TAGCCAAGTCAAGGCCAACATGG 0: 1
1: 0
2: 0
3: 13
4: 146
1173352416_1173352424 29 Left 1173352416 20:42257199-42257221 CCAGAACTGCAGCTTGATTTTAG 0: 1
1: 0
2: 2
3: 19
4: 165
Right 1173352424 20:42257251-42257273 GGCTGACTTTCAGGACAGCCGGG 0: 1
1: 0
2: 1
3: 19
4: 200
1173352416_1173352423 28 Left 1173352416 20:42257199-42257221 CCAGAACTGCAGCTTGATTTTAG 0: 1
1: 0
2: 2
3: 19
4: 165
Right 1173352423 20:42257250-42257272 TGGCTGACTTTCAGGACAGCCGG 0: 1
1: 0
2: 0
3: 19
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173352416 Original CRISPR CTAAAATCAAGCTGCAGTTC TGG (reversed) Intronic
901827615 1:11872635-11872657 CCAAAATCAAGATGCTGTCCAGG + Intergenic
902173717 1:14633522-14633544 CTAAAATCAAGATGCAGACAGGG - Intronic
908363074 1:63389411-63389433 TTAAAATCAAGCAGAAATTCTGG - Intronic
908396739 1:63731925-63731947 ATAAAATCAAGCTTTAGTTGTGG + Intergenic
909157351 1:72094723-72094745 CTAAAAACAATCTTCAGTTTGGG - Intronic
910733281 1:90422070-90422092 TTAAAATCAAGCAGAAATTCTGG + Intergenic
912775760 1:112505528-112505550 ATAAAATGAAGATGCAGGTCAGG + Intronic
915806598 1:158859878-158859900 ATAAAATCAAGATGAAATTCTGG + Intergenic
917353289 1:174100981-174101003 ATAAAATCAAGCATCAGTACAGG - Intergenic
924182574 1:241453936-241453958 CTAAAAGCAAACTGCTTTTCTGG + Intergenic
1064159297 10:12930019-12930041 TTAAAATAAAATTGCAGTTCAGG + Intronic
1070683106 10:78462832-78462854 CTAAAATGATGCTGTGGTTCAGG - Intergenic
1071460776 10:85893057-85893079 GTAAAACCAACCTGCAGTCCTGG - Intronic
1071765228 10:88656511-88656533 CTAAAATCATGGTGCACTTCAGG + Intergenic
1072267584 10:93745415-93745437 CTGAAATCCAGCTCCACTTCAGG + Intergenic
1073738655 10:106381447-106381469 CTCAAATGAAGCTGCAGCCCTGG - Intergenic
1075328574 10:121555076-121555098 CTAAAATGAATCTGCAGGCCAGG + Intronic
1076398545 10:130160647-130160669 CTAAAATTGAGATGCAGTGCAGG + Intronic
1081134312 11:39419833-39419855 CTCAAAAGAAGCAGCAGTTCAGG - Intergenic
1081375722 11:42355865-42355887 CTGAAAGCAAGCTTCAGTTCAGG + Intergenic
1085765438 11:79277859-79277881 CTCATTTCAAGCTGCATTTCTGG - Intronic
1085977329 11:81674575-81674597 CTAAAATCAAGCTGTTGTCAAGG + Intergenic
1086213870 11:84353537-84353559 CTTAAATCAAGTTACAGTTATGG + Intronic
1086598805 11:88607487-88607509 CTAAAAACAGGCTGGAGTGCAGG - Intronic
1087010390 11:93508625-93508647 CCAGAATCAAGATGCATTTCAGG + Intronic
1093293577 12:17360041-17360063 CTAAAAGCAATCTGCAGATTGGG + Intergenic
1094195525 12:27745346-27745368 ATACACTGAAGCTGCAGTTCAGG - Intronic
1094338895 12:29389266-29389288 CAAAAATCTAACTTCAGTTCCGG + Intergenic
1095911966 12:47436848-47436870 CTATAGTCAAGCTGCTTTTCTGG - Intergenic
1098845840 12:75534676-75534698 CTAAAATTAAGCTTCACTGCTGG - Intergenic
1103261440 12:119592873-119592895 CTGGATTCAAGCTTCAGTTCTGG + Intergenic
1103274879 12:119703162-119703184 AAAAAATCAAACTTCAGTTCTGG + Intronic
1105643553 13:22291554-22291576 CTTAAATGTAGCTGAAGTTCTGG + Intergenic
1105820170 13:24073660-24073682 CCAAAATCATGCTGCAGTAAAGG - Intronic
1107577867 13:41746969-41746991 ATAAACTCAAGCAGCAGTTTTGG + Intronic
1108987173 13:56606682-56606704 CTAAAATTAAACAGCAGTTATGG + Intergenic
1112590390 13:100758627-100758649 CAAAAACCAAGCTGGAGTGCAGG - Intergenic
1112829150 13:103427401-103427423 CAAATCTCAAGATGCAGTTCAGG + Intergenic
1113721317 13:112559831-112559853 CTAAAGTCAAGATGCAGGTCTGG + Intronic
1114994223 14:28327741-28327763 AAAAAATCAAGCAGAAGTTCTGG - Intergenic
1117395203 14:55302130-55302152 CAAAAATAAAGCAGCAGTCCTGG + Intronic
1117606780 14:57438693-57438715 TAAAAATCAAGCAGAAGTTCTGG - Intergenic
1118967303 14:70600002-70600024 CCAAGATCAAGCAGCAGTTAAGG + Intronic
1119500760 14:75125789-75125811 CGGAAATCCATCTGCAGTTCTGG - Intronic
1122380262 14:101298696-101298718 CAAAAATCAAGCTGAAGCTCAGG + Intergenic
1124258224 15:28163252-28163274 CCAAAATAAAGCAGCAGGTCCGG - Exonic
1126271317 15:46820542-46820564 TTAAAATCAAACTGAAGTTCAGG - Intergenic
1127102504 15:55581863-55581885 CTAAAATAAAGCAGCAGCTATGG + Intronic
1127321205 15:57848230-57848252 CCAAGATCAAGGTGCAGATCTGG + Intergenic
1129420185 15:75418613-75418635 CTAAAATCAAGGTGCTGGCCGGG - Intronic
1131547458 15:93327865-93327887 CTAAAACCAAGCTGCATCCCAGG + Intergenic
1132978533 16:2722342-2722364 CAAAAGTCAAGATGCAGATCAGG + Intergenic
1134673939 16:16076145-16076167 AGAAACTCAACCTGCAGTTCTGG - Intronic
1135013787 16:18906850-18906872 CTAAATCCAAGATACAGTTCAGG + Intronic
1135320733 16:21494422-21494444 CTAAATCCAAGATACAGTTCAGG + Intergenic
1135373568 16:21925912-21925934 CTAAATCCAAGATACAGTTCAGG + Intergenic
1135438221 16:22444790-22444812 CTAAATCCAAGATACAGTTCAGG - Intergenic
1136330947 16:29576125-29576147 CTAAATCCAAGATACAGTTCAGG + Intergenic
1136445586 16:30315850-30315872 CTAAATCCAAGATACAGTTCAGG + Intergenic
1144803407 17:17947568-17947590 CCAAGATCAAGCTGCAGGTTTGG - Intronic
1146786073 17:35722404-35722426 CTAATACCAAGCAGCAGTTTTGG + Intronic
1149488557 17:57064951-57064973 CTAAAATCAAGATGGTGGTCAGG + Intergenic
1150969163 17:70007597-70007619 GTAAAATGAATCTGAAGTTCAGG + Intergenic
1155365239 18:25042981-25043003 ATAAAATCAGTCTGCAGTTTGGG - Intergenic
1156083784 18:33374923-33374945 CTAAAATCATACTGGAGTTGTGG + Intronic
1156814579 18:41294462-41294484 CTATAATCAAGGTGATGTTCTGG + Intergenic
1157664462 18:49474109-49474131 CTAAAATCAGGATGCAGGCCAGG - Intergenic
1158696445 18:59708313-59708335 CTAAAATCAAGGTGCTGGGCAGG + Intergenic
1159278621 18:66253709-66253731 CTCACTGCAAGCTGCAGTTCAGG - Intergenic
1165590389 19:36964390-36964412 CAGAAATCAAGCTTGAGTTCTGG - Intronic
1165691937 19:37870378-37870400 ATAAAATCAAGCTGCAGCCCGGG - Intergenic
926353357 2:12017331-12017353 CTAGAATCCAGATGCTGTTCGGG - Intergenic
927327350 2:21820413-21820435 CTGAAATCAAGGTGCCGGTCTGG + Intergenic
927509643 2:23636318-23636340 CTACAAGCAACCTGTAGTTCAGG - Intronic
933008561 2:77026763-77026785 CTAAAATAAAGCTGCATATTTGG + Intronic
940717883 2:157248231-157248253 CTAAGAAGGAGCTGCAGTTCTGG - Intergenic
943255079 2:185584278-185584300 TTAAAATCAAGCTGAAATTCTGG + Intergenic
943263216 2:185693052-185693074 CTAAAATCAAGTTGTCATTCAGG - Intergenic
944182835 2:196914323-196914345 CTAAAAGCAAGTTGCAGGCCAGG + Intronic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
949029348 2:241783987-241784009 CTAAATTCAAGCTGTAGCTATGG + Intronic
1169340041 20:4789750-4789772 CTAAAATCCAGGTGCGGTACAGG + Intronic
1169997837 20:11578300-11578322 TTAGATTCAAGCTGCAGTTTGGG + Intergenic
1170879498 20:20283616-20283638 CTAAAATCAAGGTGCCAATCAGG + Intronic
1171244836 20:23602882-23602904 CTCAAATCACGTTGTAGTTCAGG - Exonic
1173352416 20:42257199-42257221 CTAAAATCAAGCTGCAGTTCTGG - Intronic
1177318404 21:19490963-19490985 CTAAAATCAAGATGCTGTCAGGG + Intergenic
1177383203 21:20372179-20372201 CTAAAATCAAGGTGTAGGTAAGG - Intergenic
1177742413 21:25170121-25170143 GTAAAATCAACTTGTAGTTCAGG + Intergenic
1179063447 21:38001957-38001979 AAAAAAACAAGCTGCAGTTTGGG - Intronic
1179461139 21:41536130-41536152 CAAAAATAAAGCTGGAGTTTTGG - Intergenic
1182186304 22:28406093-28406115 CTAAGAACAAGATGCAGTGCAGG - Intronic
1182568678 22:31219534-31219556 CTTAAATCAAGCTCCTTTTCTGG + Intronic
1185149317 22:49155011-49155033 GTAACATCAAACTGAAGTTCAGG - Intergenic
950141226 3:10617434-10617456 CTAAAATGAAGTTGCCCTTCAGG + Intronic
956361994 3:68458452-68458474 TGAAAAACAAGCTGCAATTCTGG - Intronic
957745672 3:84339242-84339264 TTAAAGTCAAGCTGAAATTCTGG - Intergenic
958711947 3:97727496-97727518 ATAAAATCATGCTGCATTTCAGG - Intronic
959845535 3:111028291-111028313 CCAAACACAAGCTGCAGTTAGGG - Intergenic
961764222 3:129195876-129195898 CTAAATTCTAGCTGCAGTGCTGG - Intergenic
962483498 3:135817779-135817801 TTAAAATCAAGCAGAAATTCTGG + Intergenic
962835043 3:139182433-139182455 CTAAAGTCCAGCTGCTTTTCAGG - Intronic
962953133 3:140239228-140239250 ACAAAAACAAGCTGCAGGTCTGG - Intronic
963107814 3:141661261-141661283 CTGAGATCAAGCTGCCGTTGAGG + Intergenic
963353120 3:144176616-144176638 TGAAAATCAAGCTGCAGTTCCGG - Intergenic
964784452 3:160379759-160379781 CTAAATTCTAGCTGTGGTTCAGG + Intronic
965243939 3:166242048-166242070 CTCTAATCAAGGTGCAGTTCAGG - Intergenic
967677256 3:192315481-192315503 ATAAAATAAAGCTACAGTCCAGG - Intronic
970449036 4:16148928-16148950 CTAAAATCATGCAGCAGGTGGGG - Intergenic
970836301 4:20411513-20411535 CTAGAATCTTGCTGCATTTCAGG + Intronic
971584459 4:28387750-28387772 CTAAAATCAAGCTGCCATCAGGG + Intronic
971789042 4:31143222-31143244 CTAAAATCATGCTTCAGCTTAGG - Intronic
972080758 4:35145660-35145682 CTAAAAGCAATCTGCAGATTGGG - Intergenic
974237293 4:59198568-59198590 CTAAAAACTGGCTCCAGTTCAGG + Intergenic
975251251 4:72180782-72180804 AGAAAATGAAGCTGCAGTTTGGG - Intergenic
975889277 4:79006338-79006360 CCAAATTCAAGATCCAGTTCAGG + Intergenic
977361946 4:96016405-96016427 CTAAAATCAAGGTGCAGGCAGGG - Intergenic
978625097 4:110676465-110676487 CAAAAATGAGGATGCAGTTCAGG + Intergenic
979789246 4:124757466-124757488 CTAAAATCAAGCTGTGGACCAGG + Intergenic
981975217 4:150720057-150720079 CAAAAATCAAACTGTAGCTCAGG + Intronic
982736624 4:159013447-159013469 CTAAAATCAAGTTGCTGTTAGGG + Intronic
983052781 4:163068393-163068415 AAAAAATCAAGCTCAAGTTCTGG + Intergenic
983755538 4:171329933-171329955 TTAAAATCAAGCAGGAATTCTGG + Intergenic
985486706 5:155958-155980 CATAAATCAAGCTGCAGGCCTGG - Intronic
985689871 5:1301382-1301404 CTAAAATCGAGCTGCAGAATTGG - Intergenic
989625419 5:43425067-43425089 CTAAGATGAAACTGCAGTCCAGG - Intergenic
990036485 5:51327185-51327207 TTAAAATGAAGCTACAGATCAGG + Intergenic
993069976 5:83148259-83148281 ATAAAATATAGCTGCAGTTTTGG + Intronic
993222642 5:85120802-85120824 CTAAATTCTAGCTACAGTTCAGG + Intergenic
995137149 5:108692007-108692029 TAAAAATCAATCTGCAGATCAGG + Intergenic
995857696 5:116610779-116610801 CTAAAATCAAGTAGCAGGTTAGG - Intergenic
997129914 5:131265976-131265998 TTAAAATAAAGCTTCATTTCAGG + Intronic
999130020 5:149275319-149275341 CTAAGATCAAGGTGCAGTCAGGG + Intronic
1000942217 5:167375377-167375399 ATAAAATCCAGGCGCAGTTCCGG + Exonic
1007291144 6:40787828-40787850 CTTGAATCAAGCTCTAGTTCTGG - Intergenic
1008754478 6:54777799-54777821 CCAAAATGAAGGTGCAGTGCTGG + Intergenic
1012049047 6:94316371-94316393 CCAATATCAATCTGCATTTCTGG - Intergenic
1013916152 6:115339369-115339391 CTTAAATTAATCTGCATTTCTGG - Intergenic
1013981174 6:116131486-116131508 CTATAATAAAGCTGCAGTTCAGG - Intronic
1014779447 6:125546735-125546757 CCAAAATTAAGCTGCAGTTTTGG + Intergenic
1015852170 6:137585401-137585423 CTAAGATCAAGGTGCAGGTAGGG - Intergenic
1020366653 7:7387891-7387913 CTAAAACAAAGCTGCAGGTGTGG + Intronic
1020888176 7:13846014-13846036 CTAAAATCAATGTTCTGTTCTGG - Intergenic
1020990972 7:15195688-15195710 GTAAAATCAAGCTGCAGTCATGG - Intergenic
1022874220 7:34512127-34512149 CTGAAATCAAGGTGTTGTTCGGG - Intergenic
1024218763 7:47270657-47270679 ATAAAAACAAACTTCAGTTCTGG + Intergenic
1024309430 7:47955939-47955961 CTAAAAGGAAGCTTCAGTTTTGG - Intronic
1028594959 7:92538519-92538541 CTAACAGCAAGCTGCAGATAAGG + Intergenic
1028822400 7:95227773-95227795 CTAAAATAAAGTTACAGATCTGG - Intronic
1028953669 7:96665147-96665169 CTAGGATCAAGCTGCCTTTCTGG - Intronic
1031523754 7:122798831-122798853 CAAAAATCAAGCAGAAGTTGAGG - Intronic
1031910226 7:127508738-127508760 CTACAATCAAGCTACAATTATGG + Intergenic
1031918017 7:127581359-127581381 CTAAGATCAAGCTGGTGCTCAGG + Exonic
1034532412 7:151704602-151704624 CTAAAAGCAAGCAGCAATTCTGG - Intronic
1037039107 8:14208949-14208971 GTAAAATCAAGCTGCAGACATGG + Intronic
1037797009 8:22004534-22004556 TTAAAATTAAGATGCAGTTGGGG + Intronic
1039002191 8:32994268-32994290 CAAAAATCAAGCAGAAATTCTGG - Intergenic
1040704392 8:50108287-50108309 GTAAAATCAAGTTGCTGTTAGGG + Intronic
1041207128 8:55510652-55510674 CTGAGATCAAGCTGCTGCTCCGG + Intronic
1043491119 8:80749998-80750020 CTAAGTTCAAGCTGAAGTTAAGG - Intronic
1043757692 8:84023782-84023804 GTAAAATCATGCTGTAGTTTGGG - Intergenic
1044545198 8:93451477-93451499 ATGAAAACAAGCTGCAGTTGTGG - Intergenic
1045400024 8:101805489-101805511 CTAAAAGCAAGCTGCATTGAGGG - Intronic
1045495899 8:102708299-102708321 CTAAAATCAAGGTGTAGTCAAGG - Intergenic
1045585956 8:103537751-103537773 CTATAATCAAGCAGCAGTCAGGG - Intronic
1050189022 9:3005684-3005706 CTAAAATCACCCTGCAGTACAGG + Intergenic
1050451284 9:5784008-5784030 ATAAAGTCAAGATGCAGTTATGG - Intronic
1051039006 9:12784007-12784029 TAAAAATCAAGCTGAAATTCTGG - Intronic
1052095145 9:24374801-24374823 CTAACAGCAATCTGCAGATCGGG + Intergenic
1052095687 9:24380989-24381011 CAAAAAGCAATCTGCAGATCGGG + Intergenic
1055490263 9:76797731-76797753 CTAAAAAGCAGCAGCAGTTCTGG + Intronic
1057210013 9:93195829-93195851 TAAAAATACAGCTGCAGTTCAGG + Intronic
1057586931 9:96336957-96336979 GTAAAATGAATCTGAAGTTCAGG - Intronic
1060035199 9:120249423-120249445 CTAAAACAAAGCAGCAGTTTGGG - Intergenic
1186651101 X:11560986-11561008 ATAAAAACAGGCTGCAGTCCAGG - Intronic
1186925473 X:14329007-14329029 CTAAACTCAAGTTGCAGTTAAGG + Intergenic
1187300756 X:18047300-18047322 CAAAAAACTAGCTGAAGTTCTGG - Intergenic
1187665381 X:21602983-21603005 CTAAAATCAAGATGAAGCTCAGG - Intronic
1189631200 X:42955235-42955257 CTAAAATCAAGATGTAGGTAAGG - Intergenic
1189855611 X:45222189-45222211 TTAAAATCAAGCAGAAATTCTGG - Intergenic
1189910129 X:45802486-45802508 CTAAAATGAAACTTCAGTACTGG - Intergenic
1190790190 X:53692367-53692389 CTCAAATCCAGCTCCAGTGCTGG - Intergenic
1194039084 X:88917506-88917528 CTGAAATCAAGCTGTTTTTCAGG - Intergenic
1195336694 X:103861887-103861909 CTGTAATCAAGCTGCTATTCAGG + Intergenic
1196593244 X:117513538-117513560 CTAAAATCAAGGTGTTGTTGTGG + Intergenic
1197657828 X:129136693-129136715 CTAAAATCAAGATGCAGGTAGGG - Intergenic
1198659268 X:138949285-138949307 TTAAAATCAAGCTGTTGTTTTGG + Intronic