ID: 1173355398

View in Genome Browser
Species Human (GRCh38)
Location 20:42282888-42282910
Sequence ATGAGTGAGCAGATGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 468}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173355398 Original CRISPR ATGAGTGAGCAGATGGAAGG AGG Intronic
900498218 1:2986368-2986390 ATGGGTGAATAGATGGAAAGAGG - Intergenic
900535872 1:3177032-3177054 ATGAGTTAACAGATGGATGAGGG - Intronic
900690406 1:3977380-3977402 ACGAGGGAGCAGACGGAAGCAGG + Intergenic
900735054 1:4294548-4294570 ATGAGTGAGCCCATGGAGGCAGG + Intergenic
900950025 1:5853334-5853356 AGGAGTCAGCAGAGGGGAGGTGG + Intergenic
901216776 1:7559499-7559521 ATCAGAGAGCAGAGGGAAGCGGG + Intronic
901539079 1:9903166-9903188 ATGAGTCATTAGAAGGAAGGAGG + Intronic
902217653 1:14944766-14944788 AGAAGTGAGCACTTGGAAGGAGG + Intronic
902510302 1:16963291-16963313 GTGAGCGAGCAGCTGGGAGGGGG + Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903012601 1:20342318-20342340 GTGGGGGAGCAGAAGGAAGGAGG + Intronic
903066794 1:20704180-20704202 ATGGATGAGCAGATGAGAGGCGG + Intronic
903341645 1:22658668-22658690 ATCAGTGAACATATGGATGGAGG + Intronic
904855069 1:33491567-33491589 ATGGATGAGCAGGAGGAAGGGGG + Exonic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906283662 1:44571198-44571220 TAGAGAGAGCAGATGGAAGAGGG - Intronic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
907919763 1:58901673-58901695 ATGAGTGGACAGATGGATGATGG - Intergenic
908151659 1:61309017-61309039 ATGAGTGTGCAAATGGAAAACGG - Intronic
908780846 1:67687936-67687958 ATGACTTTGCAGATGGAAAGAGG + Exonic
909082391 1:71128562-71128584 AAGAGGGGGCAGATTGAAGGTGG + Intergenic
909216132 1:72892174-72892196 ATGAGTGATCATATGGAGAGAGG + Intergenic
910581158 1:88826576-88826598 AAGGGTGAGGAGGTGGAAGGGGG - Intronic
910835809 1:91508850-91508872 ATGATGGAGCAGGTGGAAGAAGG - Intronic
910944863 1:92579343-92579365 ATAAGAGAGCCAATGGAAGGAGG + Intronic
911154361 1:94624051-94624073 AGGAGAGAGCAGAGGGAAGAAGG + Intergenic
912438596 1:109680575-109680597 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912441117 1:109699020-109699042 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912837245 1:113007369-113007391 ATGATGGAGCAGATGGTTGGGGG - Intergenic
913507134 1:119527158-119527180 ATGAGTGAGCAGAAGCAGGGTGG - Intergenic
914676228 1:149909357-149909379 ATGGGTGAGCTGAAGGGAGGTGG - Intronic
914826976 1:151143915-151143937 ATTACTGGGGAGATGGAAGGGGG - Intronic
914850192 1:151308453-151308475 AAGAAAAAGCAGATGGAAGGAGG + Intronic
915914096 1:159930941-159930963 ATGGTTGAGCAGAGGGGAGGTGG - Intronic
915945935 1:160151896-160151918 ATGAGGGAGCAGAAAGAAAGAGG - Exonic
917006978 1:170426318-170426340 ATGGGTGAGCAGAAGCAGGGTGG + Intergenic
917231688 1:172844746-172844768 ATGAGAGAGAAGAGGGAGGGAGG + Intergenic
917345442 1:174023700-174023722 AGGAGTGAGAAGAAGGGAGGAGG - Intergenic
917422221 1:174876008-174876030 AAGAGCGAGCACAAGGAAGGAGG - Intronic
918224622 1:182470368-182470390 ATGAGTGAGGGGAGGGAAGTAGG - Intronic
920727382 1:208448862-208448884 ATGACTGAGGGGGTGGAAGGAGG - Intergenic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921936078 1:220798494-220798516 ATCTGAGGGCAGATGGAAGGTGG - Intronic
922069880 1:222181522-222181544 ATGAATTAGCAGCAGGAAGGGGG + Intergenic
922192294 1:223330045-223330067 ATAAGTGTATAGATGGAAGGAGG + Intronic
922297747 1:224266432-224266454 ATGAGAGAGCAAAAGGAAAGTGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922501236 1:226098476-226098498 ATCAGAGAGCAGATGGAGGCTGG - Intergenic
922792938 1:228320371-228320393 ATGGATGACTAGATGGAAGGAGG - Intronic
923191390 1:231623832-231623854 AGGAGTGAGCAAGTGGGAGGAGG + Intronic
923426842 1:233879068-233879090 ATGAGTGCTCAGATGGAGGTGGG + Intergenic
924189764 1:241538278-241538300 ATGAGAAAGCAGATAGAAGAAGG - Intronic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1065001384 10:21340727-21340749 TTCATTGAGCAGATGGACGGGGG + Intergenic
1065816221 10:29485167-29485189 ATGAATGAGCACATGAGAGGGGG - Intronic
1066504406 10:36026450-36026472 ATGTGAGAGCAGTTGGGAGGGGG - Intergenic
1067188791 10:44052775-44052797 ATGAGTCTGCAGAGGGAATGCGG + Intergenic
1069175123 10:65280842-65280864 TTAAGTGAGGAGATGGGAGGAGG + Intergenic
1070759753 10:79016691-79016713 AGGAGAGACCAGAAGGAAGGAGG + Intergenic
1071065194 10:81624272-81624294 AAGGGTGAGGAGGTGGAAGGGGG + Intergenic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071440560 10:85688693-85688715 ATGAGTGGCCAGGTGGATGGTGG + Intronic
1071467867 10:85957560-85957582 ATCAGAGAGCAGTAGGAAGGAGG + Intronic
1072639583 10:97201868-97201890 AGGAGGGAGCAGGTGGAGGGAGG - Intronic
1072693518 10:97586850-97586872 GTGAGTGATCAGATGGGAGCTGG - Intronic
1073345676 10:102781257-102781279 ATGACTGTGGAGAGGGAAGGGGG + Intronic
1075619041 10:123912288-123912310 GTGAGTGTGCAGATGGTGGGCGG + Intronic
1075719885 10:124578409-124578431 ATGAGTGAGCAGATCGGAGAAGG - Intronic
1075962843 10:126584362-126584384 ATGGATGGACAGATGGAAGGTGG - Intronic
1075962854 10:126584417-126584439 ATGGATGGACAGATGGAAGGTGG - Intronic
1077357545 11:2125619-2125641 ATGAGTGGGTGGATGGATGGAGG + Intergenic
1077531309 11:3096938-3096960 AAGAGGGAGGAGATGGGAGGAGG + Intronic
1078541715 11:12218351-12218373 ATGAGTGGGGGGATGGAAGAAGG - Intronic
1078758402 11:14232878-14232900 AGCAGTGAGCACATGGCAGGGGG + Intronic
1080247568 11:30196804-30196826 ATGAGTGAGCTTTGGGAAGGTGG - Intergenic
1080824283 11:35834869-35834891 AGCAGTGAGCAGGGGGAAGGTGG - Intergenic
1081091900 11:38880587-38880609 ATGGTTGAGCAGATGGATGCTGG + Intergenic
1081312585 11:41592125-41592147 ATGGATGAGGAGCTGGAAGGGGG + Intergenic
1081589147 11:44408853-44408875 AGGAGTGGGCAGAGGGAATGTGG + Intergenic
1081850608 11:46272755-46272777 AAGAGCGAGGAGATGGAGGGTGG + Intergenic
1081994725 11:47355855-47355877 ATGTGTGAGCATGTGTAAGGAGG - Intronic
1082198967 11:49339892-49339914 ATAAGTCAGCAGGTGAAAGGAGG + Intergenic
1083342615 11:61968104-61968126 ATGATTGGGAAGGTGGAAGGTGG + Intergenic
1083495383 11:63047582-63047604 ATGAGTGAGTAGGTGGCCGGGGG - Intergenic
1083609390 11:63997956-63997978 ATGAGGGAGCAGATGAAGTGTGG - Exonic
1083636862 11:64125484-64125506 ATGAGTGGGCAGATGGCAACTGG - Intronic
1083737663 11:64690827-64690849 ATGAGCGAGCAGTTGAAAGGGGG - Intronic
1084460082 11:69292326-69292348 GTCTGAGAGCAGATGGAAGGAGG - Intergenic
1084464452 11:69313929-69313951 ATGAGTGGTTAGATGGATGGGGG - Intronic
1084482831 11:69432035-69432057 ATTAATGTGCAGATGGATGGAGG + Intergenic
1085529459 11:77182919-77182941 AGGGGTGAGCAGGTGGACGGTGG + Intronic
1086306425 11:85485564-85485586 GTGAGTAAGGAGAGGGAAGGGGG + Intronic
1086656845 11:89368195-89368217 ATAAGTCAGCAGCTGAAAGGAGG - Intronic
1088074530 11:105830588-105830610 ACAAGTGAGCAGATAGTAGGTGG + Intronic
1088720697 11:112589526-112589548 CTGGGTGGGCAGATGGAAAGGGG + Intergenic
1088907799 11:114167985-114168007 AAGAGCGATCAGATGGAGGGCGG - Intronic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089137885 11:116264004-116264026 AGGAGTGAGAAGAGGGGAGGGGG + Intergenic
1089325417 11:117653438-117653460 ATGAATGAGCTGGGGGAAGGGGG - Intronic
1090334081 11:125951131-125951153 ATGACTGTGCAGAGGGCAGGCGG - Intergenic
1090467245 11:126945397-126945419 AGGAGTGAACTGCTGGAAGGAGG - Intronic
1091826300 12:3515299-3515321 ACCAGTGAGCAGGTGGAGGGTGG - Intronic
1091837287 12:3594889-3594911 AGGAGAGAGGAGATTGAAGGAGG + Intergenic
1091855502 12:3736139-3736161 ATGGGGAAGAAGATGGAAGGAGG + Intronic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1092397000 12:8135483-8135505 AAGAGAGAGCACATGGAAGCTGG - Intronic
1092403274 12:8196068-8196090 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1092595917 12:10004400-10004422 ATGAATGGGGAGCTGGAAGGTGG + Intronic
1093411458 12:18873334-18873356 ATGAGAGAGCACATGAAATGTGG - Intergenic
1093687027 12:22068414-22068436 ATGAGGGAGCAGCTGGTTGGTGG + Intronic
1094475385 12:30836795-30836817 ATGAGTGAACGGTAGGAAGGTGG - Intergenic
1094540982 12:31363047-31363069 AAGACTGAGGAGATGGAGGGAGG + Intergenic
1095502772 12:42858923-42858945 ATGAGCGATGAGATGGAAAGGGG - Intergenic
1095702003 12:45200354-45200376 AGGAGTGAGCACATGGAAGAAGG - Intergenic
1095795757 12:46216883-46216905 ATGAGAGCTCAGATGGAAAGAGG + Intronic
1096194400 12:49640478-49640500 ATGAGTGAGGACAAAGAAGGCGG + Exonic
1097300009 12:58007950-58007972 GTGAGTGGGCAGATGGCAGGCGG + Intergenic
1098460769 12:70730842-70730864 GAGAGAGAGCAGAAGGAAGGAGG + Intronic
1100719571 12:97343417-97343439 GTGAGTGAGGAGCTGGAACGAGG - Intergenic
1101059303 12:100954453-100954475 ATGGGTGCTCAGATGGAAGGTGG - Intronic
1101331438 12:103761029-103761051 ATGAGTGATCAGAAGGAAAGTGG - Intronic
1101484358 12:105137337-105137359 ATGAGATAGCAGATGGACTGTGG + Intronic
1101677812 12:106935520-106935542 ATGAGGGGGAGGATGGAAGGGGG - Intergenic
1101801049 12:108022180-108022202 ATGAGTGAGCAGATTCTGGGTGG - Intergenic
1102775446 12:115514931-115514953 ATGTGTGAGGAAATCGAAGGTGG + Intergenic
1103583910 12:121936915-121936937 ATGAAAGAGCAGGTGGCAGGAGG + Intronic
1103931131 12:124451688-124451710 GTGAGTGATCAGATGGAACAGGG + Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104096812 12:125565598-125565620 ATGGGTGGGGAGCTGGAAGGGGG + Intronic
1104443024 12:128810775-128810797 ATGAGGGAGCACATGGGACGCGG - Intronic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1104971665 12:132533595-132533617 ATGGGTGAGCAGATGGGTGCGGG - Intronic
1106451769 13:29888821-29888843 GTGAGTTATCAGAAGGAAGGAGG + Intergenic
1106710113 13:32322129-32322151 ATGGGTGAGCAGGTGGAACTCGG - Intronic
1106936945 13:34732983-34733005 GTGTGCGAGCAGATGGAAAGGGG + Intergenic
1108151714 13:47542799-47542821 AGGAGGTAGCAGATGGATGGGGG - Intergenic
1108724757 13:53167868-53167890 ATTTGTGAGCAAATGGGAGGGGG - Intergenic
1108963065 13:56261390-56261412 ATGAGTGAGAAGGTGGATGGAGG - Intergenic
1109159962 13:58958921-58958943 ATTAGTGAACAGAATGAAGGTGG - Intergenic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1110034786 13:70669394-70669416 ATGAGTGAGTAAATAAAAGGAGG - Intergenic
1110333993 13:74305054-74305076 ATGAGTGGGGAGAAGGGAGGAGG - Intergenic
1113116428 13:106879040-106879062 ATGAGAGAGAAGAATGAAGGAGG - Intergenic
1113154778 13:107307316-107307338 ATGAGAGAACAGAGGGAAAGAGG + Intronic
1113555910 13:111234350-111234372 ATGCTGGGGCAGATGGAAGGTGG - Intronic
1113641469 13:111960490-111960512 ATGAATGAATAGATGGATGGAGG + Intergenic
1114612442 14:24051789-24051811 AGGATTGAGTAGATGGAAAGCGG + Intergenic
1115607235 14:35015756-35015778 ATGAGTGAGAAGAAGCAAAGAGG - Intronic
1115705320 14:35992544-35992566 ATGTGTGAGCAGATGGGCGTAGG + Intergenic
1116950702 14:50875995-50876017 AGGAGCCAGCAGCTGGAAGGAGG + Intronic
1118295675 14:64566706-64566728 ATGTGTGTGCAGAGGGAATGGGG - Intronic
1118687102 14:68302168-68302190 ATGACCTAGCAGATGGTAGGTGG - Intronic
1119215095 14:72863473-72863495 ATGAGTAAGCTGATTGAAGCTGG + Intronic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1121321695 14:92995266-92995288 GTGGGTGAGCAGAGGGCAGGGGG - Intronic
1121447535 14:93988242-93988264 ATGAGAGAGGGGATGGAAGGAGG + Intergenic
1121936705 14:98026308-98026330 ATGAGTGAGTGGATGGTGGGTGG + Intergenic
1121940726 14:98068123-98068145 AGGAATGAGCAGAGGAAAGGAGG + Intergenic
1122365186 14:101191032-101191054 ATGAGAAAGAAGATGGAAAGAGG + Intergenic
1123072259 14:105647595-105647617 CTGAGTGCACAGATGGGAGGAGG - Intergenic
1123779415 15:23611172-23611194 ATGAGTAAGAAGATGAAAGCTGG + Intronic
1124003446 15:25778191-25778213 ATGAATGATCAGTTGGAAGTGGG - Intronic
1124682083 15:31740415-31740437 CTCAGTGAGCAGATGGTGGGGGG + Intronic
1125456517 15:39865548-39865570 AAGGGTGAGGAGGTGGAAGGAGG + Intronic
1126367485 15:47910802-47910824 ATGAGAGAGTAGAGGGGAGGAGG - Intergenic
1126424327 15:48510235-48510257 ATGAGTTTGCAAATGGAGGGAGG - Intronic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1129668237 15:77591772-77591794 AGGAGGGAGGAGATAGAAGGTGG + Intergenic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1133310493 16:4843045-4843067 TTGACTGAGCATCTGGAAGGTGG + Intronic
1133652919 16:7829847-7829869 ATGGGTGAGTGGGTGGAAGGTGG - Intergenic
1133816787 16:9203716-9203738 ATGAATGAGGAGCTGGAAAGGGG - Intergenic
1135596303 16:23745987-23746009 ATTAGTGAGCAGAAGGGAGATGG + Intergenic
1135967134 16:27045434-27045456 AAGAGTGTGCAGGTGGGAGGTGG - Intergenic
1136314527 16:29444705-29444727 AGGAGTGAGGAGAGGGAACGAGG + Intronic
1136442654 16:30286474-30286496 AGGAGTGAGGAGAGGGAACGAGG + Intergenic
1136579210 16:31141844-31141866 ATGAGTCTGCAGAGGGAAGAAGG + Exonic
1136579518 16:31143112-31143134 GTGAGTGAGCTGTTGGAATGGGG - Intronic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1137580097 16:49628316-49628338 ATGCGTGGGTAGATGGAAGATGG - Intronic
1137784294 16:51125186-51125208 AGGAGAGGGCAGAGGGAAGGTGG + Intergenic
1137922378 16:52503522-52503544 ATGAATGAGCAAATGAAAGGAGG + Intronic
1138266517 16:55663776-55663798 ATAAGGGAGCAGATGGAAGGAGG - Intronic
1138495766 16:57408313-57408335 ATGAGTGAATGGATGGATGGAGG - Intronic
1139328050 16:66167099-66167121 ATGAATGGGGAGCTGGAAGGGGG + Intergenic
1141483706 16:84324825-84324847 ATGGGTGGGTAGATGGATGGAGG - Intronic
1141854832 16:86673856-86673878 ATGAATGAGTAGATGGATGAAGG - Intergenic
1142152351 16:88518250-88518272 GTGGGTGAGTAGATGGATGGTGG + Intronic
1142478624 17:204589-204611 GTGAGTGAGGAGATGGATGGAGG - Intergenic
1143712326 17:8743533-8743555 AGGAGTCAGCAGAAGCAAGGAGG + Intronic
1143714652 17:8758216-8758238 TTGACTGAGGAGAGGGAAGGGGG - Intronic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1144391211 17:14795234-14795256 GTGTGTGAGAACATGGAAGGAGG + Intergenic
1145203217 17:20966041-20966063 CTGAGTTAACATATGGAAGGGGG - Intergenic
1145262463 17:21362792-21362814 ATGGATGTGCAGATGGATGGAGG + Intergenic
1146375086 17:32288421-32288443 ATGAGTGAGTAGATGAAGGAAGG + Intronic
1146446186 17:32934659-32934681 ATGAGTGTGCAGGGGGAAGCAGG - Intronic
1146582557 17:34052088-34052110 ATGAATGAGTGGATGGATGGAGG - Intronic
1146625916 17:34435304-34435326 AGGAGGTAGGAGATGGAAGGAGG - Intergenic
1147916515 17:43890802-43890824 ATGAGAGACCACATGGAAAGGGG + Intronic
1147969954 17:44213914-44213936 ATGAGTGGGCTGAGGGAGGGAGG - Intronic
1148020198 17:44548274-44548296 CAGAGTGAGAAGATGGGAGGGGG + Intergenic
1148583559 17:48760641-48760663 ATGAGTGAACAGACAGGAGGTGG + Intergenic
1149102946 17:52928005-52928027 ATGGATGGGGAGATGGAAGGGGG + Intergenic
1149247279 17:54725266-54725288 ATGTGTTGTCAGATGGAAGGAGG + Intergenic
1149394239 17:56222449-56222471 ATGACTCAGCAGTTTGAAGGAGG + Intronic
1149737684 17:59011489-59011511 ATGAGTGCAGAGGTGGAAGGTGG + Intronic
1150013163 17:61525201-61525223 AAGAGTGAGTAGGTGGAAGCTGG + Intergenic
1150551087 17:66210905-66210927 AAGGGTGAGGAGAAGGAAGGTGG + Intergenic
1151345737 17:73500255-73500277 AGGATGGAGGAGATGGAAGGAGG - Intronic
1151345744 17:73500285-73500307 AGGATGGAGGAGATGGAAGGAGG - Intronic
1151460955 17:74253655-74253677 ATGGGTGAGCACATGGGAGGTGG - Intronic
1152311292 17:79551547-79551569 ATGGATGGGCAGATGGAAGGTGG + Intergenic
1152554919 17:81048383-81048405 ATTCCTGAGCAGACGGAAGGTGG + Intronic
1153355945 18:4135269-4135291 AGGGGGGAGCAGATGAAAGGGGG + Intronic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1154006880 18:10538241-10538263 ATGAATGAGCAGCTGGGACGTGG + Intronic
1155049772 18:22136513-22136535 ATGAGAAAACAGCTGGAAGGAGG + Intergenic
1156111419 18:33731847-33731869 ATGTGTGAGGAGGAGGAAGGGGG - Intronic
1156869877 18:41933534-41933556 ATGGGTGAGGAGATGAGAGGTGG - Intergenic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1159467416 18:68802821-68802843 AAGAATCAGCAGATGGGAGGTGG - Intronic
1160177276 18:76605728-76605750 ATGAGTGAATGGATAGAAGGTGG - Intergenic
1160398236 18:78587986-78588008 AGGTGTGTGCAGAAGGAAGGGGG + Intergenic
1161155828 19:2731568-2731590 ATGAGTGACGAGGTGGGAGGTGG + Intronic
1161347731 19:3776547-3776569 ATGTGTGAGTGGATGGTAGGTGG + Intergenic
1161653859 19:5501186-5501208 ATGAGAGGGAAGGTGGAAGGAGG + Intergenic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1163171642 19:15535590-15535612 ATGAGTGGATAGGTGGAAGGTGG - Intronic
1163179301 19:15587663-15587685 AGGAGGGAGCAGATGGAATTTGG + Intergenic
1164144617 19:22504420-22504442 ATGATATAGCAGATGGAAGGAGG - Intronic
1164322958 19:24167204-24167226 CTGAATGAGAAGATGGAACGAGG - Intergenic
1164580934 19:29434428-29434450 ATGAGTGAGCAGTTGAAACGTGG + Intergenic
1165144419 19:33722227-33722249 ATGAATGGGTGGATGGAAGGTGG + Intronic
1165759524 19:38312638-38312660 ATGAGTGATCAGATGACAGTGGG + Intronic
1165791716 19:38496608-38496630 ATGAGTGAGCTGGTGGAAAGTGG - Intronic
1165802798 19:38563151-38563173 AGGGGTGAGCAGAAGGAAGCGGG - Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166273369 19:41732987-41733009 ATGAAGGAGCAGATGGATGAGGG - Intronic
1166288895 19:41849145-41849167 ATGAGTGGGCAGCTGGAGGGAGG - Exonic
1166305140 19:41933050-41933072 ATTGGTGGGCAGATGGACGGAGG + Intergenic
1166562620 19:43743320-43743342 ATGAGTGAGCAGAGAAGAGGAGG + Intronic
1167037121 19:47001133-47001155 GGGTGTGTGCAGATGGAAGGTGG - Exonic
1167455210 19:49594269-49594291 ATGAATGAGGGGAGGGAAGGGGG - Intronic
925440234 2:3879356-3879378 ATGAGTCTGCAGAGGGAAGCCGG + Intergenic
926354419 2:12027520-12027542 ATGAGTGAGAAGAAGAAGGGAGG - Intergenic
927415292 2:22872983-22873005 AGGTGTAAGCAGATAGAAGGAGG - Intergenic
927879282 2:26679400-26679422 AGAAGTGAGCAGATGGGAAGAGG + Intergenic
929848240 2:45555445-45555467 CTGAGTGAAGAGATGGGAGGAGG - Intronic
929868314 2:45736958-45736980 GGGAATGAGCAGATGGAAGAGGG + Intronic
930000695 2:46859766-46859788 ATGAGTGAGCAGAGTTACGGAGG + Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
934511329 2:94946715-94946737 AAAAGTGAGTAGATGGAGGGGGG - Intergenic
936291311 2:111225998-111226020 AGGAGTGAGCAGAAAGGAGGTGG + Intergenic
936964533 2:118114502-118114524 AAGAGTGAGTAGCTGGATGGAGG - Intergenic
937250250 2:120519348-120519370 ATGAAGGAGGAGAGGGAAGGAGG - Intergenic
937479209 2:122241579-122241601 AAGGGTGAGAAGAAGGAAGGAGG + Intergenic
937814047 2:126231620-126231642 ATGGAGGAGGAGATGGAAGGAGG - Intergenic
937854659 2:126663612-126663634 ATGAGTCAGCAAACGGATGGAGG + Intronic
938230300 2:129653343-129653365 ATGAGTACCCAGATGGAGGGTGG + Intergenic
938601929 2:132851290-132851312 ATGAGGTAGTAGATGGAAGTGGG + Intronic
939271866 2:139949425-139949447 ATCAGTGGGCAGAAGGGAGGAGG + Intergenic
940448052 2:153801495-153801517 ATGAATGAACAGCTGGTAGGTGG + Intergenic
941708023 2:168680473-168680495 GTCAGTGAGCAGATGGAGGAAGG - Intronic
943320900 2:186440917-186440939 ATGAGTAAGAAGATGGAGTGTGG - Intergenic
944444882 2:199779513-199779535 ATGAGTGCACATGTGGAAGGTGG - Intronic
945078448 2:206064207-206064229 GTCAGTGAGAAAATGGAAGGAGG + Intronic
945079182 2:206071693-206071715 AAGAGTGAGCTGATGGAATCAGG - Intronic
945859319 2:215102723-215102745 ATGAGTGAGGACATAGAATGTGG - Intronic
945991027 2:216395417-216395439 ATGAGTGAGCAGATTGGAGCAGG + Intergenic
946428761 2:219613599-219613621 GTGAGGGAGGAGATGGAATGAGG + Intronic
946987226 2:225286776-225286798 ATGAATGGGGAGCTGGAAGGGGG - Intergenic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
948581313 2:238988886-238988908 GTGAGTGAGCAGATGGGACAGGG - Intergenic
1168861883 20:1051615-1051637 ATGATAAAGCAGATGGGAGGTGG - Intergenic
1168954433 20:1824925-1824947 AAGAGTGAGCAGCTGGCTGGAGG + Intergenic
1169589472 20:7124237-7124259 ATGAGAGAGGAGCTGGAAGGAGG + Intergenic
1170268721 20:14499623-14499645 ATGAGGAAGAAGAGGGAAGGTGG + Intronic
1170405605 20:16032668-16032690 ATGGATGAGAAGAGGGAAGGAGG + Intronic
1170710795 20:18788766-18788788 ATGAGAGATCACATGGAATGAGG - Intergenic
1171412064 20:24953991-24954013 ATGGGGGAGCAGCTGCAAGGTGG - Intronic
1171905053 20:30893704-30893726 AGGAGAGAACAGAGGGAAGGAGG - Intergenic
1172203989 20:33148968-33148990 ATGAGTAGGTAGATGGATGGAGG + Intergenic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1172899096 20:38320998-38321020 ATGGGTAAGTAGATGGGAGGTGG + Intronic
1172940883 20:38653709-38653731 ATGTCTGAGGAGTTGGAAGGAGG - Intergenic
1172943496 20:38670825-38670847 AAGAGTGAGCTGCTGGAATGGGG - Intergenic
1173134089 20:40423942-40423964 ATGTGTGTGCAGAGGGGAGGAGG - Intergenic
1173355398 20:42282888-42282910 ATGAGTGAGCAGATGGAAGGAGG + Intronic
1173833888 20:46112594-46112616 AAGAGTCAGCAGATGAAAGGTGG + Intergenic
1173902164 20:46598827-46598849 ATGAGTGAGCACATGGTAGGAGG - Intronic
1174356020 20:49998347-49998369 ATGAATGAGCAGACTGAGGGAGG + Intergenic
1174518066 20:51108630-51108652 ATGAGTGAGCAGATCCAGGCAGG - Intergenic
1175142537 20:56871824-56871846 ATGGGTGATCAAAAGGAAGGCGG - Intergenic
1175375622 20:58521668-58521690 ATGGGTGTGGAGATGGAAGAGGG + Intergenic
1175565420 20:59971951-59971973 ATTATTGAACAGCTGGAAGGAGG - Exonic
1175613676 20:60373909-60373931 ATGAGCGGGCAGCGGGAAGGAGG + Intergenic
1175817855 20:61892986-61893008 ATGGGTGAGTAGAGGGATGGTGG + Intronic
1176272588 20:64243995-64244017 AGGAGTGAGGAGATGAAAGAGGG - Intergenic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1177730483 21:25022417-25022439 ATGAGCTAGCAAATAGAAGGTGG - Intergenic
1177816867 21:25987267-25987289 ATGAGTGAGCAGGCTGAAGGAGG - Intronic
1178183496 21:30191944-30191966 ATGAATGCGAAGATGGAAGAAGG - Intergenic
1179003636 21:37487985-37488007 AAGAGTGAGGAGAAGGCAGGAGG - Intronic
1179043888 21:37828729-37828751 TTGAGTGAGCAGATGGTCAGAGG - Intronic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1181536826 22:23550642-23550664 ATGCATGAGAAGATGGAAGGAGG - Intergenic
1182060690 22:27395040-27395062 GTGAGTGAGCAGATGGATGAGGG + Intergenic
1183283525 22:36947621-36947643 CTGAGTGACGAGATGGGAGGAGG - Intergenic
1183398609 22:37587894-37587916 ATGGGTGAGGAGGTGGAGGGAGG + Intergenic
1183470943 22:38006427-38006449 CTGAGTGAGCGGCTGGAGGGTGG - Intronic
1184067775 22:42130006-42130028 AGGAGTGAGCAGGTGGAAGGAGG + Intronic
1184070510 22:42143678-42143700 AGGAGTGAGCAGGTGGAAGGAGG + Intergenic
1184072250 22:42153313-42153335 AGGAGTGAGCAGGTGGAAGGAGG + Intergenic
1184410463 22:44323195-44323217 ATGGGTGGACAGATGGATGGTGG - Intergenic
1184414668 22:44345394-44345416 ATGAGTGAACAGATGGTAGATGG + Intergenic
1185193378 22:49452809-49452831 ATGAGTGAGTCGATGGATGGTGG + Intronic
950474322 3:13205983-13206005 ATGGATGAGTAGATGAAAGGAGG - Intergenic
951240056 3:20276472-20276494 ATGTGTGAGATGATGGAAGGGGG + Intergenic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
952851379 3:37732543-37732565 AAAAGTGGGCAGCTGGAAGGGGG + Intronic
954350745 3:50041419-50041441 ATGAGATAGAAGAGGGAAGGAGG - Intronic
954881101 3:53836466-53836488 AGGAGTGAGTAGGTGAAAGGAGG - Intronic
955034527 3:55253567-55253589 ATGAGTTTTCAGATTGAAGGAGG + Intergenic
955037329 3:55281918-55281940 AAGTTTGGGCAGATGGAAGGAGG - Intergenic
955599392 3:60628981-60629003 ATGAGTAAGCTGAGGCAAGGGGG + Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
956190386 3:66602242-66602264 ATGAGGGAGGAAATGGATGGAGG - Intergenic
956511197 3:69995254-69995276 ATGAGTGAGCCCAAGTAAGGGGG + Intergenic
957311053 3:78519488-78519510 ATGGTTTTGCAGATGGAAGGGGG - Intergenic
957587008 3:82145906-82145928 GTGAGTCAGCAGATTGAATGGGG + Intergenic
959254089 3:103989068-103989090 ATGGGTGAGGAGCTGGAAGTAGG + Intergenic
959771616 3:110105746-110105768 ATGACTGAGCACAGGGAAGATGG - Intergenic
959943511 3:112104171-112104193 GTGATTGGGCAGATGGATGGCGG + Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
961920636 3:130421749-130421771 ATCAGGGAAAAGATGGAAGGAGG - Intronic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962350723 3:134653736-134653758 TTGTGTGAGCAGCTGGAGGGAGG - Intronic
962382577 3:134909549-134909571 ATGAATGAGCAGATGAAATCTGG + Intronic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
964276151 3:155010950-155010972 GTGTGTAAGCAGATGGAAGGAGG - Intergenic
964643351 3:158933097-158933119 ATGATTGAGCACTTGAAAGGTGG - Intergenic
964928977 3:161992239-161992261 AAGAGAGAGTAGATGGAGGGAGG - Intergenic
967069775 3:185952597-185952619 ATGAGTGGGGAGCTGAAAGGGGG - Intergenic
968268679 3:197382668-197382690 ATCAAGGAGAAGATGGAAGGAGG - Intergenic
968614949 4:1573564-1573586 ATGAGGGAGCAGCTGGGATGAGG - Intergenic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969445978 4:7244945-7244967 AGAAGTGGGCAGTTGGAAGGGGG + Intronic
969499272 4:7543280-7543302 ATGAGTCAACAGATGAACGGAGG - Intronic
969762792 4:9201792-9201814 ATGGGAGAGCAGATGGCAGAAGG + Intergenic
970311655 4:14788230-14788252 AGGAGTGAGGGGAAGGAAGGGGG + Intergenic
971467274 4:26977030-26977052 GTTAGTGAGCAGATGGAACAAGG + Intronic
971763537 4:30800805-30800827 ATGAGTGACTAGATGGGAAGTGG + Intronic
972718632 4:41674198-41674220 AGGAGTGGGCAGATAGGAGGAGG - Intronic
975674673 4:76814250-76814272 ATGAGTGGTCAGATGTAAGCGGG - Intergenic
976373401 4:84316304-84316326 ATGAATGAGCAGATTTAATGGGG + Intergenic
980070980 4:128242813-128242835 ATGAGAGATCAGATTGAAGATGG + Intergenic
980716094 4:136631783-136631805 ATGAGTGAGAACATGGAATATGG - Intergenic
980743926 4:136990654-136990676 ATGAGAGGGGAGATGAAAGGAGG + Intergenic
981154174 4:141414364-141414386 ATGAGTGGGCTGGTGGAGGGGGG + Intergenic
981924497 4:150123376-150123398 ATGAGGGAGCAGCTGGTTGGTGG + Intronic
983113144 4:163778849-163778871 ATGAGTGAGAGGGTGGGAGGGGG + Intronic
983527565 4:168774804-168774826 AGGAGGGAGCAGGTGGCAGGAGG - Intronic
987259025 5:16184965-16184987 GTGAGTGGGCAGGTGGATGGGGG + Intergenic
988695192 5:33614850-33614872 ATGAGTAAACACATGGAAAGTGG + Intronic
989199444 5:38749147-38749169 ATGAATGAGTACATGGACGGTGG - Intergenic
989242899 5:39220602-39220624 ATGAATGAGTAGAAGGAAGGTGG - Intronic
989465349 5:41748326-41748348 AGGAGAGGGCTGATGGAAGGAGG + Intronic
989734722 5:44690034-44690056 ATGAATGAGTGGATGGATGGAGG - Intergenic
991258198 5:64638286-64638308 AGCAGTGACAAGATGGAAGGGGG + Intergenic
995259356 5:110083809-110083831 ATGAGGAAGAAGAGGGAAGGTGG - Intergenic
995378434 5:111504672-111504694 ATGAGAGAGCAGATTTATGGTGG - Intronic
995855140 5:116584006-116584028 AGGTCTGAGCAGACGGAAGGAGG - Intergenic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
997110380 5:131067838-131067860 ATGAGTAAGCAGAAGTTAGGAGG + Intergenic
997470863 5:134115960-134115982 ATGCATGAGCAGATTGAAGGCGG - Exonic
998904588 5:146890913-146890935 ATGAGTCAGCATTTGGAAGCAGG - Intronic
998931902 5:147190577-147190599 ATGAGTGACCATGTGGAGGGAGG - Intergenic
999309421 5:150542345-150542367 ATGAGTGAGCAGAGGGTATTGGG + Intronic
999639278 5:153655356-153655378 ATGAGTTAATAGATGGATGGTGG - Intronic
999749752 5:154618895-154618917 ATGAATCAGCAGATGGATGTGGG + Intergenic
1000139540 5:158388547-158388569 ATGTGTCAGCTGATGGAAAGAGG + Intergenic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001425768 5:171621322-171621344 ATATATGAACAGATGGAAGGTGG + Intergenic
1001437042 5:171707560-171707582 ATGACTGAGCACATGAAATGTGG - Intergenic
1002061670 5:176629410-176629432 ATGAGTCAGCAGATGGGGCGAGG - Intronic
1003513752 6:6802204-6802226 ATGAGTGAGTGGAGGCAAGGGGG + Intergenic
1003945306 6:11070127-11070149 ATGAGAGAGCAGAGGAAAGGGGG + Intergenic
1003972587 6:11313350-11313372 ATGGCTGAGTAGATGGATGGTGG + Intronic
1004869416 6:19889653-19889675 ATGACAGACCACATGGAAGGTGG + Intergenic
1005704877 6:28441540-28441562 ATGAGTGGGCAGTTGGAAGAGGG - Intronic
1006026305 6:31149255-31149277 TTGAGTGGGCACATGGAATGTGG - Intronic
1006299817 6:33187743-33187765 GTGAGTGAGTATATTGAAGGAGG + Intronic
1006433032 6:34009886-34009908 ATAACTGAGCAGATGGAGTGGGG - Intergenic
1006650579 6:35548028-35548050 GTGAGTGAGAAAATGGAAAGGGG - Intergenic
1007160840 6:39790824-39790846 ATGAGAGAGGGAATGGAAGGAGG + Intergenic
1007350098 6:41266241-41266263 AATGGTGAGCACATGGAAGGTGG + Intergenic
1007474312 6:42108645-42108667 AGGGGTGTGCAGAAGGAAGGTGG + Intronic
1008323472 6:50147464-50147486 AGGAGAGAGGAGATGGCAGGAGG + Intergenic
1008546352 6:52587134-52587156 ATGAGTGAGCAGAAGATAGATGG + Intergenic
1010325345 6:74556741-74556763 ATGAGTCTGCAGATCCAAGGAGG - Intergenic
1011231608 6:85167959-85167981 ATGAGTGAGGAGATGAAGGGAGG - Intergenic
1013176175 6:107679013-107679035 ATAAGTAAGCAGATGGTAGATGG - Intergenic
1013453775 6:110311101-110311123 AGGAGTGAGAACAGGGAAGGTGG - Intronic
1015000589 6:128209673-128209695 ATGAGTGAGCAAAAGGAAAGGGG + Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1016385431 6:143526216-143526238 AGGAGTGAGGACATGGAAGGAGG + Intergenic
1017748521 6:157468622-157468644 ATGATAAAGCAGATAGAAGGAGG + Intronic
1017780787 6:157713725-157713747 AGGAGGAAGCAGATGGAAGGTGG + Intronic
1018801630 6:167227210-167227232 ACCAGTCAGCAGAAGGAAGGAGG - Intergenic
1019018815 6:168900664-168900686 AGGAGTGAGAAGAGGGAAGCAGG + Intergenic
1019103418 6:169650106-169650128 ATGAGTGAGTGGATGGATGGAGG - Intronic
1019224474 6:170498780-170498802 ATGCGTGAACAGAATGAAGGGGG + Intergenic
1019383081 7:738145-738167 ATTAGTGAGCAGCTTGAAGACGG - Intronic
1019758722 7:2792773-2792795 AGGAATGTGCAGATGGAAAGGGG + Intronic
1019920043 7:4157540-4157562 GTGGGTGGGCAGATGGAAGCGGG + Intronic
1020444555 7:8255675-8255697 TTGAGAGTGCAGATGGAAAGAGG - Intronic
1022454335 7:30545395-30545417 CTGAATGAGAAGATGGAACGAGG + Intronic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1024072563 7:45798749-45798771 ATGAGAGAGGGGAGGGAAGGGGG + Intergenic
1024307944 7:47943887-47943909 GTGAGTGAGCAGCAGGAATGGGG - Intronic
1024410517 7:49036109-49036131 ATCACTGAGCATGTGGAAGGGGG - Intergenic
1026904292 7:74053986-74054008 ATGAATGAGCACATGGTTGGAGG + Intronic
1028411545 7:90535805-90535827 ATAAATGAGTAGATAGAAGGTGG - Intronic
1028720492 7:94025347-94025369 ATGAATGAGCAAATGAAAGTGGG - Intergenic
1028892881 7:96008307-96008329 GGGAGAGAGCAGAGGGAAGGGGG + Intronic
1029604821 7:101592216-101592238 ATGAATGAGTGGATGGATGGTGG - Intergenic
1030477153 7:110050222-110050244 ATGACTGAGAACATGGATGGTGG - Intergenic
1033849549 7:145478821-145478843 ATGAGTGAGAAGTTGGCATGAGG - Intergenic
1033853771 7:145531724-145531746 ATGAGTGAGCAGAGAGAAAGAGG - Intergenic
1035311085 7:157969500-157969522 ATGAGTGGGGAGCTGGGAGGTGG + Intronic
1035332988 7:158108298-158108320 AGGAGGGAGCAGGTGCAAGGCGG - Intronic
1035905386 8:3503922-3503944 ATGAGTGAGAATATGGAGGCGGG + Intronic
1036484056 8:9163852-9163874 CTCAGTGAGCAGATGAAAGAGGG + Intronic
1036708439 8:11061771-11061793 AAGAATGAGAAGAAGGAAGGGGG + Intronic
1036865108 8:12389604-12389626 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1037627723 8:20622625-20622647 ATGAGTGAGAGGATGGGAGATGG + Intergenic
1038982477 8:32775095-32775117 ATGCGAGAGGGGATGGAAGGAGG - Intergenic
1039447466 8:37644073-37644095 AAGGGTGAGCAGAAGGCAGGTGG + Intergenic
1039903936 8:41772781-41772803 AGGATGGAACAGATGGAAGGAGG - Intronic
1041340982 8:56845107-56845129 GGGAGTGAGCAGATGGGAGAGGG + Intergenic
1041578121 8:59423063-59423085 ATGTATGAGCAGAGGGCAGGGGG - Intergenic
1041657019 8:60362901-60362923 ATGTGGGAGCAAATGGAAAGAGG + Intergenic
1041732951 8:61081246-61081268 AAGAGAGAGCAGAAGGAATGAGG + Intronic
1043660961 8:82739932-82739954 ATCAGAGAGCAGAGGGAAGATGG + Intergenic
1043815107 8:84792275-84792297 ATGGATGGGGAGATGGAAGGGGG + Intronic
1044350990 8:91166452-91166474 ATGAGAGAACAGATGGGAAGAGG + Intronic
1044832989 8:96268390-96268412 ATGAGGGAGAAGATGGGAGGGGG + Intronic
1045691485 8:104764190-104764212 ATGACTGGGAGGATGGAAGGTGG - Intronic
1046028403 8:108752912-108752934 ATAAGTGAGCAGCTAAAAGGAGG + Intronic
1046129658 8:109951491-109951513 ACTAGAGAGCAGAAGGAAGGAGG - Intergenic
1046528591 8:115414413-115414435 ATGAGGAGGCAGATTGAAGGTGG + Exonic
1046973805 8:120251115-120251137 ATGAATGACCAAATGGAAGCAGG - Intronic
1047007217 8:120632789-120632811 ATGAGTGAACGAATGGATGGCGG - Intronic
1047215940 8:122876088-122876110 ATGAGTGAGTAGGTGGGTGGAGG - Intronic
1047462894 8:125085733-125085755 AGGGGTGAGCAGATGGTAGAAGG + Intronic
1047845484 8:128801147-128801169 ATGAGTGAGGAATCGGAAGGAGG + Intergenic
1048256514 8:132908990-132909012 ATGAGTGAGCAGAGCAAAAGAGG + Intronic
1048694287 8:137007388-137007410 ATGAGAAAGCTGATGTAAGGAGG + Intergenic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1049372044 8:142272585-142272607 ATGGGTGGGTGGATGGAAGGAGG - Intronic
1049428487 8:142548460-142548482 ATGAGTGGGTGGATGGATGGGGG + Intergenic
1049464921 8:142746732-142746754 ATGGATGGGGAGATGGAAGGGGG + Intergenic
1049474729 8:142791489-142791511 ATGAGTGGGCAGATGGTAGATGG - Intergenic
1049632672 8:143667028-143667050 ATGTGTGTGCACATGGAGGGAGG - Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050732041 9:8720107-8720129 ATGAGTGACCACATGGGAGGTGG - Intronic
1051263472 9:15288538-15288560 ATGAATGGGGAGCTGGAAGGGGG - Intronic
1051575095 9:18606139-18606161 ATGACTGAGGAGAGGGGAGGAGG - Intronic
1051867811 9:21700982-21701004 ATGATTGCTCAGAAGGAAGGGGG - Intergenic
1053199974 9:36145665-36145687 ATGGGTGGGTAGATGGAGGGAGG + Intronic
1053234681 9:36442371-36442393 ATGAGTGGGTAGGTGGATGGAGG - Intronic
1053260963 9:36663521-36663543 AAGGGTGAGGAGATGGAAGGGGG - Intronic
1055042795 9:71893532-71893554 ATGGCTGAGCACATGGAGGGTGG - Intronic
1056813092 9:89779539-89779561 ATCATTTAGCAGATGTAAGGCGG - Intergenic
1057167273 9:92938889-92938911 ATGAGTGAGCAAGAGGAAGAAGG - Intergenic
1057384200 9:94593077-94593099 ATGAGAGAGCAGATGCAGGAAGG + Intronic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1057788260 9:98104831-98104853 GAGAGTGAGGAGATGAAAGGAGG + Intronic
1058093857 9:100836988-100837010 ATGGATGGGCAGCTGGAAGGGGG - Intergenic
1058445791 9:105053776-105053798 CTGAGTGAGGAGATGGGAGGAGG - Intergenic
1058566326 9:106289091-106289113 GTGAGTGAGAAGATAGAAAGGGG - Intergenic
1059457597 9:114409427-114409449 ATGAGTGAGCAGAGCAAAGAAGG + Intronic
1060416215 9:123432556-123432578 GTGAGTGAGCAGAGGTACGGTGG - Intronic
1060688751 9:125637333-125637355 AGGAATGAGCAGATAAAAGGTGG + Intronic
1061244772 9:129395850-129395872 ATGGATGAGAAGGTGGAAGGAGG + Intergenic
1061298035 9:129687543-129687565 TTGAGTGTGCAGAGGGAAGCCGG - Intronic
1061431739 9:130535651-130535673 CTGAGTGAGCAGCTGGAGGCGGG + Intergenic
1061433215 9:130544333-130544355 AAGAGTGAGCAGATGCAAGAGGG - Intergenic
1062100628 9:134726560-134726582 ATGAGTGGACAGACGGATGGAGG + Intronic
1062172270 9:135141566-135141588 ATGAGTGGACAGATGGATGATGG + Intergenic
1062185651 9:135216873-135216895 GTGAGTGAGGAGGGGGAAGGGGG + Intergenic
1062394914 9:136348915-136348937 ATGGGTGAGCAGGTGGCAGATGG - Intronic
1185605239 X:1365151-1365173 AGGATTGAGTAGCTGGAAGGAGG - Exonic
1185608514 X:1380612-1380634 ATGAGTGGGGAGGGGGAAGGAGG + Intronic
1185660440 X:1724213-1724235 ATATGTGTGCAGATGGATGGAGG - Intergenic
1185883180 X:3758812-3758834 ATGGGTGGGCGGATGGATGGAGG - Intergenic
1185895406 X:3854160-3854182 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1185900523 X:3892584-3892606 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1185905639 X:3931015-3931037 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1185962486 X:4560371-4560393 AGCAGTGAGCAAATGGAAGTAGG + Intergenic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189288981 X:39871927-39871949 GTGGGTGGGCTGATGGAAGGAGG + Intergenic
1190109582 X:47581502-47581524 ATGAATGAGCATTGGGAAGGGGG - Intronic
1190983884 X:55483474-55483496 ATGAGAGAGAAAAGGGAAGGAGG - Intergenic
1193481810 X:82036226-82036248 ATGAGACAGCAGGTGGAAAGGGG + Intergenic
1193889215 X:87022509-87022531 AGGAGAGAGCAGAGGGAAGGAGG + Intergenic
1193987797 X:88267748-88267770 TGGAGTAAGCAGATGGAAGTAGG - Intergenic
1194709735 X:97220601-97220623 ATGTGGGAGCAGATGGCAGCTGG + Intronic
1195069148 X:101262731-101262753 ATGGTTGAGCAGGTGGTAGGCGG + Exonic
1195279617 X:103318350-103318372 ATCAGTGAACAAAGGGAAGGAGG + Intergenic
1195756752 X:108206216-108206238 ATGGGTGAGGAAATGGAAGGTGG + Intronic
1196251056 X:113460465-113460487 GTGAGGGCTCAGATGGAAGGGGG - Intergenic
1196918180 X:120560839-120560861 AGGAGTGAGCAGAACGAGGGGGG + Intronic
1198700527 X:139392651-139392673 GTGTGTGTGCACATGGAAGGAGG - Intergenic
1198801370 X:140451238-140451260 AAGAGTGAGCACAAGAAAGGAGG + Intergenic
1199533089 X:148871542-148871564 ATGTGAGGGCTGATGGAAGGAGG - Intronic
1199660749 X:150048133-150048155 ATGAGAGAGAAGATGTAAGAAGG - Intergenic
1200006006 X:153084671-153084693 ATGAATGATCAAATGGCAGGTGG - Intergenic
1200154993 X:153970523-153970545 GTGAGGGAGGAGATGGAGGGAGG + Intronic
1200155003 X:153970553-153970575 GGGAGGGAGCAGATGGAGGGAGG + Intronic
1201382258 Y:13394778-13394800 ATGAGTGAGGAGAAGCAAGGAGG - Intronic
1201441320 Y:14011818-14011840 ATGAGAGAGCAGAGAGAAAGAGG + Intergenic
1201443251 Y:14030890-14030912 ATGAGAGAGCAGAGAGAAAGAGG - Intergenic
1201751497 Y:17436646-17436668 ATGAATGGGGAGATGGAAAGGGG + Intergenic
1201900896 Y:19045473-19045495 ATGGGAGAACAGATGGATGGAGG + Intergenic