ID: 1173363568

View in Genome Browser
Species Human (GRCh38)
Location 20:42365947-42365969
Sequence TCCCTTCCACACTGAGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173363566_1173363568 18 Left 1173363566 20:42365906-42365928 CCAATGCTAATATTGGAGTTGCA 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1173363568 20:42365947-42365969 TCCCTTCCACACTGAGTGCCAGG 0: 1
1: 0
2: 1
3: 30
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173363568 Original CRISPR TCCCTTCCACACTGAGTGCC AGG Intronic
900098196 1:948921-948943 TCCCTGCCACACAGAGTACCAGG + Intronic
900374632 1:2347780-2347802 CCCCTGCCACCCTGCGTGCCGGG + Intronic
900595656 1:3479069-3479091 CCCCTCCCATTCTGAGTGCCAGG - Intronic
901631448 1:10650057-10650079 CTCCTTCCCCACCGAGTGCCCGG + Intronic
902263582 1:15245686-15245708 AACCTTCCAGACTGAGGGCCTGG + Intergenic
902306410 1:15542926-15542948 TCTCTTACACAATGAGTGTCAGG + Intronic
902336012 1:15755366-15755388 TCTCTTCCACTCTCAGTGCCTGG - Intergenic
902627906 1:17687674-17687696 CCTCTTCCACACTGAGACCCTGG + Exonic
904428597 1:30447435-30447457 TCCCTTCCACACACTGTTCCTGG - Intergenic
904477454 1:30774499-30774521 TCCCTTCCCCTCTGACTGCTGGG + Intergenic
904829835 1:33299584-33299606 GCCCTTCGCCCCTGAGTGCCTGG + Exonic
904960642 1:34330314-34330336 TCCCTTCGACACTGGCTTCCTGG - Intergenic
905770589 1:40635749-40635771 TCCCCTCAACACTCTGTGCCTGG - Intronic
906007447 1:42488386-42488408 TCACTTACTCACTGAGTTCCTGG + Intronic
906476597 1:46173524-46173546 GCCCTTCCAGCCTGAGAGCCTGG + Intronic
906760057 1:48369055-48369077 TCCACTCCACACTGTTTGCCTGG + Intronic
907744200 1:57196422-57196444 TGCCTCCCACACTCACTGCCAGG - Intronic
911664138 1:100535120-100535142 TCCCTTCCAGACTCAGTCTCTGG - Intergenic
912738190 1:112168761-112168783 TCCCTGCCTCCCTGAGTGCCAGG + Intergenic
915484315 1:156209618-156209640 TCCCTCTCACACTGAAAGCCTGG - Intronic
916022621 1:160807605-160807627 CCCATGCCACACTGACTGCCAGG - Intronic
916161417 1:161919652-161919674 TCCCTTCCCTTCTGTGTGCCAGG + Intronic
916917575 1:169426488-169426510 TTCCTTCCTCCCTGAGTGTCTGG + Intronic
918373002 1:183880621-183880643 TCGCTTCCATACTAAGGGCCTGG + Exonic
920685717 1:208107756-208107778 CCCCCTCCACTCTGAGTGCTGGG + Intronic
921335718 1:214083826-214083848 TCCCTGCCACACTCAGTCACTGG + Intergenic
923769727 1:236927872-236927894 TTCCTTCCAGCCTGAGTACCAGG - Intergenic
924518093 1:244782679-244782701 TCCTTTCCACTCTGTCTGCCTGG + Intergenic
1066086304 10:31975007-31975029 TCCCTTCCACCCTGTCTGCCTGG - Intergenic
1066259966 10:33719934-33719956 GCCCTTTCACACTGACTTCCTGG + Intergenic
1066646219 10:37612554-37612576 ACCCTTGCACATTGGGTGCCTGG - Intergenic
1067433611 10:46262488-46262510 GCTCTTCCCCACTGAGGGCCTGG - Intergenic
1067440073 10:46303817-46303839 GCTCTTCCCCACTGAGGGCCTGG + Intronic
1067576456 10:47411812-47411834 GCTCTTCCCCGCTGAGTGCCCGG + Intergenic
1069309676 10:67018840-67018862 TCTCTTATACACTGAATGCCTGG - Intronic
1069980408 10:72248570-72248592 TCCCTTCCTCTCTGAAGGCCGGG - Intergenic
1070613280 10:77949246-77949268 CCCCCACCACACTCAGTGCCTGG + Intergenic
1070739550 10:78893717-78893739 TTCCATCCACACTGAGCCCCTGG - Intergenic
1073516718 10:104082488-104082510 TCACCTCCCCACTGACTGCCAGG - Intronic
1075235373 10:120723019-120723041 TCCCTGCCAAAATGAGTGACTGG - Intergenic
1076195218 10:128512980-128513002 TCCCTTCCCCACAGAGTTCTGGG + Intergenic
1076221103 10:128733797-128733819 TCCCTCCCTCACTGTGTGCTGGG - Intergenic
1078518889 11:12047669-12047691 TCCATTCCACACACAGTGCCTGG - Intergenic
1079555430 11:21753378-21753400 TCCCTGCCGCTCTGAGTGCGGGG + Intergenic
1079852078 11:25547131-25547153 TACCTTCCCCACTGTGTGCCAGG - Intergenic
1083185543 11:61015825-61015847 CACCTTCTACAGTGAGTGCCTGG + Exonic
1083290715 11:61688602-61688624 TCCCTCCCACTCTGGGCGCCTGG + Intronic
1083460158 11:62805729-62805751 CCCCTTCCTCACTGAGTTCTGGG - Exonic
1083940953 11:65895529-65895551 TCTATTCCACATTGAGTGACAGG + Intronic
1084321714 11:68377095-68377117 TCCCATCCCCACTGCCTGCCTGG + Intronic
1084509605 11:69594989-69595011 CCCCTTCCACACTTGATGCCAGG - Intergenic
1086067113 11:82757184-82757206 TCCCTTGATCACTGAGTGGCTGG - Intergenic
1086580476 11:88392813-88392835 TGCCTTCCACCCTGATTGCGAGG - Intergenic
1087312808 11:96569576-96569598 TCCCTAGCACACTGTGTGCCTGG - Intergenic
1088968056 11:114745292-114745314 TGCCTTCCACCCTGAGTGGAAGG - Intergenic
1089608259 11:119654508-119654530 TCCCTCCCATTCTGAGGGCCAGG - Intronic
1090174640 11:124637737-124637759 TTCTTTCCACACTGGGTTCCAGG - Intronic
1090395405 11:126415120-126415142 TCCCTTCCACACTGCCCTCCAGG - Intronic
1092291281 12:7160692-7160714 TCCCTTACCCATTGTGTGCCTGG + Intergenic
1097909820 12:64957920-64957942 ACCCTTCCACATTGAGGGCCAGG + Intergenic
1099869882 12:88333559-88333581 TCTCTTCCACCTTGAGAGCCAGG - Intergenic
1101202946 12:102455793-102455815 TCCCATCCAAGCTGACTGCCAGG - Intronic
1103684795 12:122723472-122723494 ACCCTTCCCCACTGTGTCCCTGG + Intergenic
1104544234 12:129696708-129696730 TCCCTCCCCCACTGAGAGCAAGG - Intronic
1105406628 13:20137491-20137513 TCCCTTGCTCACTGCGGGCCAGG - Intergenic
1105446038 13:20457910-20457932 TCCTTCCCCCACTGAGTACCTGG - Intronic
1106289003 13:28343540-28343562 ATCCATCCACCCTGAGTGCCAGG + Intronic
1107045492 13:35988133-35988155 TCCCTCCAACCCTGAGTGGCTGG + Intronic
1108419031 13:50229867-50229889 TCCCTCCAACCCAGAGTGCCAGG + Intronic
1112477590 13:99746626-99746648 TTCCTTACACACAGAGTTCCAGG + Intronic
1113493756 13:110712868-110712890 GCCGTTCCAAACTGAGTACCGGG + Intronic
1113693397 13:112327803-112327825 TTCCTTCCACACTGAGTAACTGG - Intergenic
1113748782 13:112764545-112764567 TCCCATCCAGACAGAGTCCCAGG + Intronic
1120769089 14:88358956-88358978 TCCCCTCCTCACTGGGTGACAGG - Intergenic
1121791536 14:96703030-96703052 CCCCGTCCACAGTGGGTGCCAGG - Intergenic
1122149398 14:99716800-99716822 TCCCTACCACACTGGGCCCCAGG - Intronic
1124259874 15:28179016-28179038 TCCCTTCCACAGTCACTGCAAGG + Exonic
1127382497 15:58442152-58442174 TCCCTTCCACACTGACATTCTGG + Intronic
1128712375 15:69881802-69881824 CCCCTTCCACAATAAGTACCAGG - Intergenic
1129394497 15:75236523-75236545 TCCCTGGCACACTCAGGGCCAGG + Intergenic
1130423822 15:83775216-83775238 TCCCTTCCCCACTCATTCCCAGG - Intronic
1130650823 15:85761181-85761203 TGCTTTCCCCACTGAGTGGCAGG + Intronic
1131627997 15:94144653-94144675 TGCCTTCCACCCTGAGTGGAAGG + Intergenic
1132648468 16:1009886-1009908 TCCCTCACACACTGAGTTTCAGG - Intergenic
1134227931 16:12406253-12406275 TCCCTTTCACAATGGCTGCCAGG - Intronic
1135657581 16:24264530-24264552 TCCCTGCTACACAGAGCGCCTGG + Intronic
1140869503 16:79093801-79093823 GCCCTTCGACACAGAGTGACAGG + Intronic
1142125551 16:88408677-88408699 TCCCTTCCAGGCTTACTGCCGGG + Intergenic
1142201922 16:88765192-88765214 TGCATTCCTCTCTGAGTGCCGGG - Intronic
1142238282 16:88933101-88933123 TGACTTGCACACTGAGGGCCTGG - Intronic
1143288328 17:5809219-5809241 TCACATCCACAGTGAGTGCTGGG - Intronic
1143765505 17:9135082-9135104 CCCCATCCACACCGAGGGCCCGG + Intronic
1144079739 17:11753009-11753031 TGCCTGCCACACTGGGTGACTGG - Intronic
1145209439 17:21002670-21002692 GCCTTTCCACACCGAGTGCTGGG + Exonic
1146054742 17:29575460-29575482 TCCCTTCCAGCCTGAGGCCCAGG + Exonic
1146471981 17:33131892-33131914 TCCCCTCCCCACTGTGTGTCTGG - Intronic
1148047253 17:44751716-44751738 TCCCTTCCACACTTCCTTCCTGG + Exonic
1148431894 17:47649787-47649809 GCCCTTCGACGCTGAGCGCCTGG + Intronic
1149578871 17:57733836-57733858 TCCCTCCCTAACTGAGTCCCCGG + Intergenic
1149620846 17:58043894-58043916 TCCCTTCTACACTGGGACCCAGG - Intergenic
1151944994 17:77314857-77314879 TCCCCTCCCCACTGGGTACCAGG + Intronic
1152596980 17:81242576-81242598 GCCCTTCCTCCCTGAGTGACTGG + Intergenic
1152721362 17:81925283-81925305 ACCCATTCACACTGAGAGCCAGG + Intronic
1154493791 18:14941286-14941308 TACCTTCCAAACTGAGTGGAAGG + Intergenic
1158673938 18:59501468-59501490 TCCCTTCCACACAGCTTGTCAGG - Intronic
1159576274 18:70181541-70181563 TCCCTTCCATGCTGAGTTACAGG + Intronic
1160480575 18:79236684-79236706 CCCCTTCCCCACTGTGTGCACGG + Intronic
1160480585 18:79236735-79236757 CCCCTTCCCCACTGTGTGCACGG + Intronic
1161258157 19:3321108-3321130 TCCCTTCCCCAGTGACTTCCAGG - Intergenic
1161313129 19:3606194-3606216 TCCCTGCCACACCCAGGGCCTGG + Intronic
1161636119 19:5390321-5390343 TACCTTCCCCACTGAGTCTCAGG + Intergenic
1161921466 19:7269486-7269508 TCCCCTCAACACTGGCTGCCTGG + Intronic
1163228070 19:15979108-15979130 TCCCTCCTCCACTGTGTGCCCGG - Intergenic
1163848698 19:19651654-19651676 CCCCTTCCCCACTGTGGGCCAGG + Intronic
1165304500 19:34995227-34995249 TCCCTTCCACACAAAGGGTCAGG - Intronic
1166432300 19:42738120-42738142 TCCTCTCCACTCTGAGTGTCAGG + Intronic
1166435419 19:42763309-42763331 TCCTCTCCACTCTGAGTGTCAGG + Intronic
1166452683 19:42915517-42915539 TCCTCTCCACTCTGAGTGTCAGG + Intronic
1166455168 19:42934798-42934820 TCCTCTCCACTCTGAGTGTCAGG + Intronic
1166464960 19:43024084-43024106 TCCTCTCCACTCTGAGTGTCAGG + Intronic
1166482242 19:43184176-43184198 TCCTCTCCACTCTGAGTGTCAGG + Intronic
1166484723 19:43203281-43203303 TCCTCTCCACTCTGAGTGTCAGG + Intronic
1166704388 19:44900684-44900706 TTCCACCCACCCTGAGTGCCAGG - Intronic
1167036136 19:46995987-46996009 TCCCCTCCCCACTGGCTGCCTGG - Intronic
1167473800 19:49689107-49689129 ACCCTTCCACCCTCAGGGCCTGG + Exonic
1168198823 19:54797769-54797791 TCCCATCCACACTGGGATCCAGG - Intronic
925260398 2:2523763-2523785 TCCCTTCCACGCTCAGTTCATGG - Intergenic
927853164 2:26512568-26512590 TCTCTGCAACACTGAGAGCCTGG + Intronic
929615820 2:43306422-43306444 TCTCTTCCACACTTAGTCCATGG + Intronic
930721784 2:54645288-54645310 TCCCTTCCTGACTCAGGGCCTGG - Exonic
932283658 2:70515415-70515437 TCCCTTACACACTCTGTCCCTGG - Intronic
934557079 2:95293181-95293203 TCGCTTCTAGCCTGAGTGCCAGG + Intergenic
934584804 2:95482195-95482217 TCCATTCTTTACTGAGTGCCAGG - Intergenic
934594651 2:95594521-95594543 TCCATTCTTTACTGAGTGCCAGG + Intronic
934788123 2:97031117-97031139 TCCATTCTTTACTGAGTGCCAGG - Intergenic
934841677 2:97627981-97628003 TCCCGACCCCACTGAATGCCAGG + Intergenic
935782798 2:106522843-106522865 TCCCTGCCCCACTGAATCCCAGG + Intergenic
937038595 2:118803160-118803182 TCACTTCCACCCTGACTGCGTGG - Intergenic
937156395 2:119722738-119722760 TCCTTTAGACACTGAGTTCCTGG + Intergenic
941554055 2:166953452-166953474 TGCCTTCCACCATGAGTGTCTGG + Intronic
943657634 2:190526359-190526381 TCTCTTCCCCGCTTAGTGCCTGG - Intronic
946777803 2:223161839-223161861 TGCCTTGCACCCTGAGTGCCGGG - Intronic
947070493 2:226282944-226282966 ACCCTTGCATTCTGAGTGCCTGG + Intergenic
947529596 2:230900441-230900463 TCCCGTCCACCCTGTGTGCCTGG - Intergenic
947868253 2:233416702-233416724 TCCCTTCCAGACTTACTACCAGG + Intronic
1168989884 20:2085983-2086005 TCTCTCCCTCTCTGAGTGCCAGG - Intergenic
1169226167 20:3858321-3858343 TCCCTGCCACTCTGAGTGCTCGG + Intronic
1170624615 20:18021752-18021774 TCTCTCCCACACTGTGCGCCAGG - Intronic
1170760902 20:19250758-19250780 TCCCTTCACCACTGGGAGCCAGG - Intronic
1171252010 20:23655928-23655950 TCACTTCCTCACTGAGAGACTGG + Intergenic
1172964823 20:38826983-38827005 TCCATTCCAGCCTGAGTGACAGG - Intronic
1173363568 20:42365947-42365969 TCCCTTCCACACTGAGTGCCAGG + Intronic
1175398688 20:58686356-58686378 TCCCTTCTACACTTACTACCTGG - Intronic
1176240581 20:64074083-64074105 TGCCTTCCCCACCTAGTGCCTGG + Intronic
1177154908 21:17491738-17491760 TCCCTGCCACACTTGGTCCCTGG - Intergenic
1177292067 21:19126539-19126561 TCCCTACCACAGTGAGAGCTGGG - Intergenic
1177314021 21:19433320-19433342 TCCCTTCCTGACTGCTTGCCTGG - Intergenic
1180036058 21:45250419-45250441 TCCTTACCACACTGGGTGCCGGG - Intergenic
1180902646 22:19385826-19385848 TCCCTTCTCCACTCAGAGCCAGG - Intronic
1183651108 22:39153498-39153520 TCCATTCCTCACTGGGAGCCCGG + Intergenic
1184263443 22:43332955-43332977 TGCCTTCCACACCCTGTGCCAGG + Intronic
1184780607 22:46647426-46647448 ACCCTACCACACCGAGTTCCTGG + Intronic
1185161070 22:49230195-49230217 TCCCTTCCACTGTGACTGACTGG - Intergenic
950181289 3:10915255-10915277 TTCATTCCCCACTGAGTGCGTGG + Intronic
950451947 3:13070460-13070482 TCCTTTCCACACTGAAAGGCAGG + Intronic
951996683 3:28737253-28737275 GCTCTTCCACTCTGAATGCCAGG - Intergenic
952951476 3:38528762-38528784 TTCCATCCAGCCTGAGTGCCTGG - Intronic
953277722 3:41519547-41519569 TCCCTACCACACTGTGTTTCAGG - Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954324833 3:49857917-49857939 TCCCTTCCCCACTGCCTTCCAGG + Intergenic
954406927 3:50350401-50350423 TCCCTGCCACATTGGGAGCCGGG + Intronic
958066094 3:88545972-88545994 TGCCTTCCACAATGATTGCGAGG + Intergenic
958474159 3:94559256-94559278 TCCAACCCACACTGAATGCCTGG - Intergenic
959750792 3:109832141-109832163 GCCTTTCCACACTAATTGCCAGG - Intergenic
961004441 3:123395432-123395454 TCCTTTCCATACTGAGTGGATGG + Intronic
962367168 3:134794345-134794367 TCCCACCCACACTGAAGGCCTGG + Intronic
962670414 3:137700388-137700410 TCCTTTGCAGACTGAATGCCTGG - Intergenic
962844746 3:139264255-139264277 TCCCTGCCTCACTGTGTGGCTGG - Intronic
962923318 3:139970265-139970287 TCCCTGCCACACAGGGTTCCTGG + Intronic
963043574 3:141086521-141086543 ACACGTCCACACTGTGTGCCAGG - Intronic
963220373 3:142803369-142803391 TTCCATCCACACTGGCTGCCTGG - Intronic
963889761 3:150620455-150620477 TCCTGTCCTCACTGAGTGCCAGG - Intronic
966819706 3:183914986-183915008 CCCACTCCACACTCAGTGCCTGG + Intergenic
967202872 3:187089421-187089443 TCCTTTCCTCATTGTGTGCCTGG + Intergenic
967920080 3:194607997-194608019 TCCCTTCGACACTGAGCTACTGG + Intronic
968595642 4:1481015-1481037 CCCCTTCTACACTGGGTGGCAGG - Intergenic
968665825 4:1821907-1821929 TACCTGCCACACTGTGGGCCAGG + Intronic
969207742 4:5660294-5660316 CTCCTTCCTCACAGAGTGCCTGG - Intronic
969610621 4:8225837-8225859 TCCCTTCCCCACTGGCTTCCAGG - Intronic
970106546 4:12592286-12592308 TCCCTGCCACACTCAGTCACTGG + Intergenic
970585051 4:17507302-17507324 TGCCTGCCACACTGAGTGGTTGG + Intronic
972097943 4:35371972-35371994 TCACTGCTACACTGAGTGCAAGG + Intergenic
975318613 4:72983486-72983508 TCCTTACCACAGTGAGTGTCTGG + Intergenic
976067807 4:81209226-81209248 TTCCTCCCACATTGACTGCCAGG - Intronic
982110709 4:152050977-152050999 TCCCTTCCACTCTAAATCCCTGG + Intergenic
985587574 5:748856-748878 CCTCTTCCTCACTAAGTGCCGGG + Intronic
985587591 5:748924-748946 CCCCTTCCTCACTAAGTGCCGGG + Intronic
985587609 5:748992-749014 CCCCTTCCTCACTAAGTGCTGGG + Intronic
985587617 5:749028-749050 CCCCTTCCTCACTAAGTGCCAGG + Intronic
985587634 5:749100-749122 CCCCTTCCTCACTAAGTACCAGG + Intronic
985602152 5:841017-841039 CCCCTTCCTCACTAAGTGCCGGG + Intronic
985602162 5:841053-841075 CCCCTTCCTCACTAAGTGCCGGG + Intronic
985602171 5:841089-841111 CCCCTTCCTCACTAAGTGCCAGG + Intronic
985602179 5:841125-841147 TCCCTTCCTTATTTAGTGCCAGG + Intronic
985602226 5:841283-841305 CCCCTTCCTTACTAAGTGCCAGG + Intronic
985602236 5:841319-841341 CCCCTTCCTTACTAAGTGCCGGG + Intronic
985602245 5:841355-841377 CCCCTTCCTCACTAAGTGCCAGG + Intronic
985602255 5:841391-841413 CCCCTTCCTCACTAAGTGCCGGG + Intronic
985602265 5:841427-841449 CCCCTTCCTCACTAAGTGCCGGG + Intronic
985602274 5:841463-841485 CCCCTTCCTCACTAAGTGCCAGG + Intronic
985602282 5:841499-841521 TCCCTTCCTTATTTAGTGCCAGG + Intronic
985679696 5:1249453-1249475 TCCCGTCCACACTGGGGGCTGGG + Intergenic
987092543 5:14521215-14521237 TCCCTTCCTCTTTCAGTGCCCGG + Intronic
991290929 5:65033461-65033483 TCCCTTCTGCTCTGAGTCCCCGG + Intergenic
992863523 5:80935963-80935985 ATCCTTCCACATTGAGTCCCAGG + Intergenic
994759777 5:103837558-103837580 TCTCTTTCACACTGCGTGGCTGG + Intergenic
995118377 5:108507678-108507700 TCTCATCCACACTGTCTGCCTGG + Intergenic
997055718 5:130441299-130441321 TTCCTCCTACACTCAGTGCCAGG + Intergenic
997304835 5:132829708-132829730 TCCCTGTCAGACTGAGTTCCTGG + Intronic
998487039 5:142511935-142511957 CCCCCTCCACAGTGAGTGCCAGG + Intergenic
1003115171 6:3278859-3278881 TGCCGTCCACATTTAGTGCCGGG - Intronic
1003300267 6:4874390-4874412 GGCCTTCCCCACTGTGTGCCTGG + Intronic
1003957332 6:11175896-11175918 TCCCTTGTACCCTCAGTGCCAGG + Intergenic
1004326236 6:14676334-14676356 ACCCTTCAAAACTGAGTCCCTGG + Intergenic
1005708703 6:28482581-28482603 CCCCTCCCACTCTGGGTGCCTGG - Intergenic
1007703740 6:43779123-43779145 TCCCTTCCAAAGGAAGTGCCAGG - Intronic
1013046645 6:106492250-106492272 TCCATTCCATACTGAGTACATGG + Intergenic
1014246977 6:119079203-119079225 CCCCTCCCACCCCGAGTGCCCGG + Intronic
1016798517 6:148143965-148143987 TCCCTTTCTCACTGTGTGTCTGG + Intergenic
1017080044 6:150659543-150659565 TGCCTGCCATAGTGAGTGCCTGG + Intronic
1017228953 6:152051726-152051748 TCTCTTCCACAGGGAGTCCCTGG + Intronic
1018417346 6:163612504-163612526 TCCCTTCCTCACAGAGTCCCTGG - Intergenic
1018803511 6:167241115-167241137 TCCCTTCCATCCTGGGTGCAAGG - Intergenic
1020085609 7:5308724-5308746 TCCCTGCCACTCTCAGTGCCTGG - Intronic
1022510916 7:30934326-30934348 TCTCTTCCACTGTGAGTCCCAGG + Intergenic
1023352723 7:39336309-39336331 TCCCTTCCACCTTCAGAGCCTGG + Intronic
1024217833 7:47263020-47263042 TCCTCCCCACACAGAGTGCCAGG + Intergenic
1024504836 7:50153613-50153635 TCCCTTCCTCACAGGGTTCCTGG - Intronic
1025663251 7:63568444-63568466 TCCCTGCCACTCTCAGTGCCTGG - Intergenic
1025705899 7:63863627-63863649 TCCCTTCCATACTTGGTGCTGGG - Intergenic
1029360655 7:100086260-100086282 TCCCTTAAATACTGAGTTCCTGG - Intergenic
1030196644 7:106859368-106859390 TCCCTTCCAGCCTCAGGGCCAGG + Intergenic
1030468507 7:109933510-109933532 AACCTCCCACACTAAGTGCCAGG - Intergenic
1031589335 7:123570412-123570434 TCCCTTCCACCGAGAGTGGCAGG + Intronic
1032094571 7:128931529-128931551 TCACTTCCACAGTGTGTGTCAGG + Intergenic
1032991184 7:137396349-137396371 TCCTTCCCACACTGAGTGGCTGG - Intronic
1033345567 7:140523253-140523275 TCCCTTCCACTCTGAGGGTCAGG - Intronic
1034758175 7:153642563-153642585 TCATTTCCACACTGATTACCTGG + Intergenic
1035091695 7:156318559-156318581 GCGCTCCCTCACTGAGTGCCTGG + Intergenic
1035879056 8:3223917-3223939 CTCCTTCCACACTGACTGGCAGG - Intronic
1036971692 8:13362410-13362432 TCCCCACCATACAGAGTGCCCGG - Intronic
1037211254 8:16390925-16390947 TACCTTGCATCCTGAGTGCCTGG + Intronic
1039750572 8:40474546-40474568 TTCTATCCACACTGTGTGCCAGG - Intergenic
1040862737 8:52016331-52016353 TGCCTCCCAAAGTGAGTGCCTGG + Intergenic
1041196950 8:55410265-55410287 TCCCTTCTCCACTGATTTCCGGG + Intronic
1041639690 8:60183561-60183583 TCACATCCTCAGTGAGTGCCAGG + Intergenic
1041775230 8:61515588-61515610 TACCTTCTCCCCTGAGTGCCAGG + Intronic
1046395512 8:113633770-113633792 TCACTTGCACACTGAGGCCCAGG - Intergenic
1046788515 8:118294203-118294225 TTCCTTCCACACTGACAGCCAGG + Intronic
1046831186 8:118748297-118748319 TTCACTCAACACTGAGTGCCAGG + Intergenic
1048039341 8:130710479-130710501 TCCCTTCTACAATGAGAGGCTGG + Intergenic
1048977769 8:139682536-139682558 TCCCATGCAGACTGAGTCCCAGG - Intronic
1049853817 8:144849281-144849303 TCCCACCCTCACTGAGTTCCAGG - Intronic
1052795499 9:32919856-32919878 TCCCTGCAGCTCTGAGTGCCAGG - Intergenic
1055054814 9:72013969-72013991 CCCACTCCACCCTGAGTGCCTGG + Intergenic
1056103375 9:83322362-83322384 TCTCGTCCACACTGCTTGCCTGG - Intronic
1056266940 9:84906506-84906528 TCCCTGCCAAACTGACTGCATGG - Intronic
1056722999 9:89087506-89087528 TCCCTCCCACACTGATTGCCTGG - Intronic
1057037418 9:91821449-91821471 TCCTTTCCACATTGGCTGCCTGG + Intronic
1057259412 9:93575893-93575915 TCCGTTCCCCACTGAGTTTCTGG - Intergenic
1057487934 9:95500568-95500590 GCCCTTCCACAGTGAGCACCTGG - Intronic
1062125397 9:134857988-134858010 TACCTTCCACACCAAATGCCAGG - Intergenic
1062637937 9:137501268-137501290 CCCCTCCCACACTGAGCCCCCGG + Intronic
1185579679 X:1202401-1202423 CCCCTTCGACACCGAGTGGCAGG - Exonic
1186452625 X:9686121-9686143 ACCCCTTCACACTGTGTGCCCGG + Intronic
1188506980 X:30893409-30893431 TCCCTTCCACACGGGGTGTGGGG - Intronic
1188886553 X:35558174-35558196 TCCCTCAGACACTGAGTGCATGG + Intergenic
1189227467 X:39424924-39424946 TCCCTTCCACACTCAGGGTTGGG + Intergenic
1189295264 X:39913320-39913342 TCCCCTCCACAGTGAGAGCATGG - Intergenic
1190076724 X:47322425-47322447 TCCCTCCCACACTGCCTCCCAGG + Intergenic
1198344239 X:135743765-135743787 TCCTTTCCACAATGATTTCCAGG + Intergenic
1198645896 X:138806329-138806351 CCCCATCCTCACTGCGTGCCAGG + Intronic