ID: 1173369341

View in Genome Browser
Species Human (GRCh38)
Location 20:42420819-42420841
Sequence TGTTGCAGAGAACACTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 175}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173369332_1173369341 6 Left 1173369332 20:42420790-42420812 CCCCGCCAAGACCTCACAACATT 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG 0: 1
1: 0
2: 1
3: 15
4: 175
1173369331_1173369341 7 Left 1173369331 20:42420789-42420811 CCCCCGCCAAGACCTCACAACAT 0: 1
1: 0
2: 0
3: 4
4: 125
Right 1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG 0: 1
1: 0
2: 1
3: 15
4: 175
1173369340_1173369341 -5 Left 1173369340 20:42420801-42420823 CCTCACAACATTTGGGGGTGTTG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG 0: 1
1: 0
2: 1
3: 15
4: 175
1173369333_1173369341 5 Left 1173369333 20:42420791-42420813 CCCGCCAAGACCTCACAACATTT 0: 1
1: 0
2: 1
3: 10
4: 184
Right 1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG 0: 1
1: 0
2: 1
3: 15
4: 175
1173369329_1173369341 28 Left 1173369329 20:42420768-42420790 CCAACATGGGTCTAGGACCAACC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG 0: 1
1: 0
2: 1
3: 15
4: 175
1173369334_1173369341 4 Left 1173369334 20:42420792-42420814 CCGCCAAGACCTCACAACATTTG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG 0: 1
1: 0
2: 1
3: 15
4: 175
1173369330_1173369341 11 Left 1173369330 20:42420785-42420807 CCAACCCCCGCCAAGACCTCACA 0: 1
1: 0
2: 3
3: 26
4: 231
Right 1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG 0: 1
1: 0
2: 1
3: 15
4: 175
1173369337_1173369341 1 Left 1173369337 20:42420795-42420817 CCAAGACCTCACAACATTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG 0: 1
1: 0
2: 1
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173369341 Original CRISPR TGTTGCAGAGAACACTGTAG TGG Intronic
901226000 1:7613382-7613404 TGGTGCAGAGCACACAGGAGAGG + Intronic
905507593 1:38492458-38492480 TGTTGCAGAGAACTCTAGCGAGG - Intergenic
906095775 1:43223038-43223060 TGTTGCAGAGAAAGCTGGGGTGG + Intronic
907893091 1:58654625-58654647 TGTTATATAGAACACTGTAGGGG - Intergenic
911309209 1:96272705-96272727 TGATGCAGTGAACACAGTAGTGG + Intergenic
912082494 1:105953928-105953950 TGTTGAAGAAAATAATGTAGAGG - Intergenic
914394592 1:147252891-147252913 TGAGGCAGAGAAGACTGTACAGG - Intronic
916632216 1:166628590-166628612 TTTTGAAGACAGCACTGTAGAGG + Intergenic
916745372 1:167680984-167681006 TGGTGCTGAGCACACTGGAGAGG + Intronic
919051404 1:192515556-192515578 AGTTTCAGAACACACTGTAGAGG - Intergenic
920674716 1:208030943-208030965 GGTTGCAGAGATGACTTTAGGGG + Intronic
921097064 1:211895676-211895698 GGTGGCAGAGGACACTGTTGGGG + Intergenic
921948136 1:220902517-220902539 AGATGCAGAGAACATTGCAGGGG - Intergenic
922053725 1:222020213-222020235 TAGTGCAGAGAACACTGTGTTGG - Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
924768886 1:247061767-247061789 TATTGTAGAGAACACTGTCATGG + Intronic
1063011009 10:2021434-2021456 TTTTGCAGAAAAGACTGTATTGG - Intergenic
1063398733 10:5719682-5719704 TGATGGAGAGAACTCTGTAATGG + Intronic
1069601588 10:69711436-69711458 TCTTGCATAGCACACTGTGGTGG + Intergenic
1070191165 10:74113078-74113100 TCTTGCAGAGCACCCTGCAGTGG + Intronic
1071112523 10:82176529-82176551 TGTCACAGAGCACACTGAAGGGG + Intronic
1072283358 10:93890749-93890771 TGTAGGATAGAACACTGGAGAGG - Intergenic
1073218655 10:101851581-101851603 TGGTGCAGGGAACAGTGCAGAGG - Intronic
1077493411 11:2872732-2872754 TCTTCCAGAGAGCACTGTATGGG - Intergenic
1077763440 11:5129863-5129885 TTTAGCAGAGAACACTGGACAGG + Intergenic
1078333546 11:10445677-10445699 TGTAGCAGAGAAGACTGTAAAGG + Intronic
1079261566 11:18887426-18887448 TGTTGCAGAGCATCCTGGAGTGG - Intergenic
1080846764 11:36033617-36033639 TGTAGCAGAGAACTCTTCAGGGG - Intronic
1083588904 11:63880853-63880875 TTTTGCAGAGTACACTGAAGTGG + Intronic
1083680564 11:64349807-64349829 TGTTGGAGAGAGCACTGTGCTGG + Intronic
1085120536 11:73964716-73964738 TGTTACACAGGACACTGAAGAGG + Intronic
1085591653 11:77767812-77767834 TGTAGCATAGAACACTGGTGGGG - Intronic
1086326890 11:85710820-85710842 TGTTGCACAGAAAAATTTAGTGG + Intronic
1087491113 11:98828414-98828436 TGTTTCACAGAACAATTTAGAGG - Intergenic
1089700049 11:120239322-120239344 TGCTGCAAAGAGCACTGGAGTGG + Intronic
1090663929 11:128902400-128902422 TGCTGCAGAGAACAGTGTCTTGG - Exonic
1091151024 11:133327944-133327966 AGCTGCAGAGAACACTATACGGG + Intronic
1093548472 12:20376054-20376076 TGTTTCAGAGCAGACTGTAAAGG - Intronic
1094415577 12:30211740-30211762 TGTGGGAGAGAACACTGCTGAGG - Intergenic
1094740920 12:33287600-33287622 AGATGCAGAGAACACAGCAGAGG - Intergenic
1098177139 12:67804703-67804725 TAGTGCAGAGATCACTGCAGGGG - Intergenic
1101074761 12:101117257-101117279 TGTTGCAGAGGCTACTGTGGTGG - Intronic
1101818526 12:108164739-108164761 TGTTGGAGAGAAAGCTGTTGCGG - Intronic
1102550775 12:113690389-113690411 TCTTGCAGAAAACAGTTTAGTGG - Intergenic
1104119138 12:125782005-125782027 TGTTGCGCAGTACACTTTAGTGG + Intergenic
1104594818 12:130113780-130113802 TGGGGCAGGGAAGACTGTAGGGG + Intergenic
1106975216 13:35203368-35203390 TATTTGAGAGAACACTGAAGGGG - Intronic
1112161183 13:96869697-96869719 TGCTGCAGAAAACAGTGTGGTGG - Intergenic
1113215195 13:108032037-108032059 TGTTACAGAAAACAATGCAGAGG + Intergenic
1113493010 13:110706640-110706662 TGCTGCAGTGCACACTGTATTGG - Intronic
1113923139 13:113925650-113925672 TGCTGCAGAAAACACTTTGGTGG + Intergenic
1114967924 14:27986716-27986738 TGTTGCATAAAATACTGCAGTGG + Intergenic
1115123785 14:29969656-29969678 TGTTGCAGAGAGCACCAGAGAGG + Intronic
1117896406 14:60492027-60492049 TGTTGCAGAAAACACCCAAGTGG - Intronic
1117912875 14:60651199-60651221 TGTTGCAGGGTGCACTGTACTGG - Intronic
1120825293 14:88949280-88949302 TGTTGCAGACTAGAGTGTAGTGG - Intergenic
1124105840 15:26737096-26737118 TGTTCCAGAGAACACGGCTGAGG + Intronic
1126608039 15:50500789-50500811 TCTTGCAGAAAGCAGTGTAGTGG + Exonic
1127372743 15:58356082-58356104 TGTCCCAGAGAACAATGTGGAGG + Intronic
1129460801 15:75699249-75699271 TGCTGCAGAGACCTCTGTCGGGG + Intronic
1129489228 15:75906811-75906833 TGCTCCAGAGAACACTTTCGAGG - Intronic
1131206492 15:90452818-90452840 TGTTGCTGAGAAGACTGTTTTGG + Exonic
1133040343 16:3057247-3057269 TGCTGCAGAGGACACTGGATGGG - Intronic
1137955036 16:52820751-52820773 TGCTGCAGAGAAGACTGTGTCGG - Intergenic
1139657680 16:68398864-68398886 TGTGGCAGAGCACACCGAAGTGG + Intronic
1140881268 16:79200105-79200127 TGCAGAAGAGAACACTGCAGGGG + Intronic
1142621483 17:1168221-1168243 AGTTGCAGTGAGCACTGCAGAGG + Intronic
1143380644 17:6494016-6494038 TGTTGCAAAGGAGTCTGTAGGGG - Intronic
1143840896 17:9731019-9731041 TGTTACAGAGAACACTGCTAAGG - Intergenic
1144171611 17:12664652-12664674 TGTTGCTGAAAACACATTAGAGG - Intergenic
1146964809 17:37017052-37017074 AATTGCAGAGACCACTGCAGTGG + Intronic
1153954146 18:10081853-10081875 TGTTTCCAAGAACACTGCAGAGG + Intergenic
1155259919 18:24031700-24031722 TGTTGAAGAGATCACTCTGGTGG - Intronic
1155453150 18:25983937-25983959 TGCTGCGGGGAACACTGCAGAGG - Intergenic
1156101877 18:33606221-33606243 TGCAGAAGAGGACACTGTAGAGG - Intronic
1157362987 18:47035517-47035539 TGTTGCACAGCAAACTGCAGAGG - Exonic
1163242160 19:16070810-16070832 TGTGGCAGGGAACACTGGGGTGG - Intronic
1167600679 19:50453024-50453046 TGGTGCGGAGAAAACTTTAGGGG - Intronic
1167948011 19:53004800-53004822 TGTCTCAGAGAACAGTGTCGTGG + Intergenic
1167985778 19:53314078-53314100 TGAAGCAGAGAACACATTAGAGG - Intergenic
927467540 2:23348396-23348418 TGTTGCAGAGGGCAGTGTGGGGG + Intergenic
928479527 2:31667904-31667926 AGTTAGAGAAAACACTGTAGAGG + Intergenic
929750391 2:44706052-44706074 TGTTGCAGTGAACACTAATGAGG + Intronic
929901767 2:46010591-46010613 TCTTTGAGAGAACAATGTAGAGG - Intronic
930587072 2:53279733-53279755 TGTTGCAGTGAACATGGGAGTGG - Intergenic
932088160 2:68780827-68780849 GGTGGCAGAGAACACTATAAAGG - Intronic
936262621 2:110974716-110974738 TGTTGCAGAGACCTCTGTCTTGG + Intronic
937059204 2:118969109-118969131 TGCTGCAGAGAACACAGCACAGG - Intronic
942735607 2:179108363-179108385 TGTTGCAGAGAAAAGGGTAAGGG + Exonic
945340611 2:208648725-208648747 TGTTCCAGAGAACAAAGTGGAGG + Intronic
945634370 2:212329382-212329404 AGTGCCAGAGAACACTGTAATGG + Intronic
947414624 2:229881141-229881163 TGTTGCTGACAACTCTGTTGAGG - Intronic
1170194278 20:13674508-13674530 TGTTGCACAGAACACACTTGTGG - Intergenic
1170400447 20:15977445-15977467 TGTTGCAGAGAACCCTGGAATGG - Intronic
1170631392 20:18069460-18069482 TGTTGCAGTGAACACAGGAGTGG + Intergenic
1170745939 20:19099029-19099051 TGTTGCACAGACGACTGTGGCGG + Intergenic
1172607667 20:36225510-36225532 TGATGCAAAGAACTCTGTATTGG + Intronic
1173084975 20:39907234-39907256 TTTTTCAGAGTACACTTTAGGGG - Intergenic
1173369341 20:42420819-42420841 TGTTGCAGAGAACACTGTAGTGG + Intronic
1173842645 20:46168198-46168220 GGGTGCAGAGAGCACTGTACAGG - Intergenic
1174499405 20:50973406-50973428 TTTTTCAGATAACCCTGTAGGGG + Intergenic
1174562262 20:51439629-51439651 CCTGGCAGAGAACACTGGAGAGG - Intronic
1175936464 20:62516494-62516516 TGCTGCAGACAAGCCTGTAGTGG - Intergenic
1178789556 21:35687497-35687519 TCTTGCAGTGAACACTGTTGGGG - Intronic
1182101948 22:27663640-27663662 TGAGGCAGAGAAGAGTGTAGTGG - Intergenic
1183413153 22:37667005-37667027 TCATGCAGAGAACAATGTGGTGG - Intergenic
1184730505 22:46368802-46368824 TGTTGCTGAGGCCACTGGAGGGG - Intronic
1185225302 22:49648567-49648589 TGTTTCAGACAACACTTTGGGGG - Intronic
949352822 3:3142476-3142498 AGTTGCAGGGAATAATGTAGTGG - Intronic
949590123 3:5485519-5485541 TGTTGCAATGAACAATGTATGGG + Intergenic
949749783 3:7338385-7338407 GGGTGCAGTGTACACTGTAGGGG + Intronic
949771278 3:7581267-7581289 TGTTCTAGAGAACAATGTATTGG + Intronic
952422023 3:33141132-33141154 TGTTGTAGTGAATACTGTTGGGG - Intronic
953200847 3:40777280-40777302 TGATGCAGAGTTCAGTGTAGTGG - Intergenic
954229060 3:49202263-49202285 TGTTGCAGAGAAAAAAGCAGGGG + Intronic
955877991 3:63513698-63513720 TGATGCTGTGATCACTGTAGGGG - Intronic
961412062 3:126729806-126729828 TGGTGCATAGAACCCTGTGGTGG + Intronic
966566107 3:181383257-181383279 TGTTTCAGAGGACACTTTATTGG + Intergenic
966762781 3:183432019-183432041 TTTTGCAGATACCACTGTAAAGG + Intergenic
967133298 3:186492536-186492558 TGCTCCAGAGAACAGTGGAGGGG - Intergenic
967817210 3:193809573-193809595 TGTTGGTGAGAACACTGGAGGGG - Intergenic
973946785 4:55965376-55965398 TGTTGTATAGAACTCTGTATTGG + Intronic
974689504 4:65278161-65278183 TGTTGCAAAGAAAACTAAAGAGG - Intergenic
974796035 4:66751126-66751148 TGTAGCATAGTACACTGGAGTGG + Intergenic
977050583 4:92124370-92124392 TGTTGGGAAGAACACTTTAGGGG + Intergenic
977268639 4:94886860-94886882 AGTTGGAGAGACCACTGTATAGG + Intronic
980640112 4:135566132-135566154 TTTTGTAGAGAACACTGTGGTGG + Intergenic
981932654 4:150207876-150207898 TGGTATAGAGACCACTGTAGTGG + Intronic
983616584 4:169712426-169712448 TGAAGCAGAGCACACTGGAGAGG + Intronic
986325286 5:6668637-6668659 CCTTGAAGAGATCACTGTAGGGG - Exonic
987766623 5:22239921-22239943 TGCTGCAGAAAATATTGTAGAGG - Intronic
989217733 5:38922594-38922616 TGCTTCAAAGAACACTGCAGAGG + Intronic
990421213 5:55636038-55636060 TGTTGCAGACCATACTGAAGTGG - Intronic
993245717 5:85450494-85450516 TGCTGCAGAGATCACTGTAGGGG - Intergenic
993893181 5:93499843-93499865 TGATGCAGAGAAAGCTTTAGGGG + Intergenic
994866542 5:105279719-105279741 TATTACAGAGATCACTGGAGTGG - Intergenic
995079428 5:108031169-108031191 TTGTGGAGAGAACACTGTAATGG + Intronic
997422769 5:133782301-133782323 TGTGGCAGACAAGTCTGTAGTGG - Intergenic
997867462 5:137477417-137477439 GGTTGCAGAGAATTCTGGAGAGG + Intronic
1000172203 5:158713087-158713109 GGTTGCGGGGAACACTGTACAGG + Exonic
1006043863 6:31277091-31277113 TGGTGCCGAGAAGTCTGTAGAGG + Intronic
1007781141 6:44255479-44255501 GCTTGCAGAGAACACAGGAGAGG + Exonic
1007914926 6:45552560-45552582 TGTTGCAGAGAGGAGTGAAGAGG - Intronic
1008172691 6:48228884-48228906 TGTTGGAGATAACAGAGTAGAGG - Intergenic
1009682634 6:66918431-66918453 TGTTGCAGAGAAAATGGAAGGGG + Intergenic
1010023024 6:71183198-71183220 TGTGGTAGAGAGCTCTGTAGAGG - Intergenic
1013966249 6:115959291-115959313 TGTTGGAGAGAAAACTATCGTGG + Intronic
1014291855 6:119567369-119567391 TGTTTCAAGGAACACTGTATGGG + Intergenic
1015212034 6:130709526-130709548 GCTTGCAGAGAACAATGTATGGG + Intergenic
1015411706 6:132900784-132900806 TGTTCCAGAAAATACTTTAGTGG - Intergenic
1018035973 6:159881556-159881578 TGTGCCTGAGAACACAGTAGGGG - Intergenic
1024244548 7:47459458-47459480 TGTCCCAGAGAACACAGCAGAGG + Intronic
1025159821 7:56646778-56646800 TGTTTCAGAGAGCACAGTAAAGG - Intergenic
1025726894 7:64072558-64072580 TGTTTCAGAGAGCACAGTAAAGG + Intronic
1025755883 7:64340262-64340284 TGTTTCAGAGAGCACAGTAAAGG + Intronic
1025791737 7:64694161-64694183 TGTTTCAGGGACCACAGTAGAGG + Intronic
1025997454 7:66537003-66537025 AGCTGCTGAGAACACTGCAGGGG - Intergenic
1028601589 7:92606451-92606473 GGTAGCAGGGAACACTTTAGTGG + Exonic
1030861605 7:114638393-114638415 TGTTCCATAGAACACTGTTTTGG + Intronic
1031510957 7:122649061-122649083 TGTGGTAGAGAACACTGTTGGGG - Intronic
1033230755 7:139595551-139595573 TATTTCAGAGAAGAATGTAGTGG - Intronic
1033539002 7:142338825-142338847 TGCTGCAGGGAACCCTGGAGAGG + Intergenic
1034545813 7:151788169-151788191 TGCTGCAGAAAACAGTTTAGTGG - Intronic
1034548780 7:151807129-151807151 TGTTCCAGATCACACTGTGGCGG + Intronic
1034863760 7:154622991-154623013 TGCTGCAGAAAACTCTGTTGGGG + Intronic
1038426451 8:27467230-27467252 TGTTGTAGAGAACAATGTCGGGG + Exonic
1039913197 8:41840971-41840993 TGCTACAGAGAACAGTGTGGAGG + Intronic
1040787215 8:51179878-51179900 TGTTCCAGAGAACAAAGGAGAGG - Intergenic
1041007919 8:53514076-53514098 TTTTGCAGAGTACACTGTCTAGG + Intergenic
1042781765 8:72498703-72498725 TATTCCAAAAAACACTGTAGTGG + Intergenic
1044683775 8:94807551-94807573 TGTTTCAGAGAACACGGAAACGG - Intergenic
1046021096 8:108666029-108666051 TGTTGAATAGAAGACTGTGGAGG + Intronic
1047123016 8:121927239-121927261 TGAATCAGAGACCACTGTAGTGG + Intergenic
1048774249 8:137927932-137927954 TTTTGCAGAGATCAATGTTGAGG - Intergenic
1051050870 9:12930168-12930190 TGTGGGAGAGGACACTGTTGGGG + Intergenic
1051349610 9:16186570-16186592 TGTAGAAGAGAACACAGTTGGGG + Intergenic
1051393779 9:16596196-16596218 TGTTTTAAAGAACAGTGTAGAGG + Intronic
1052828214 9:33192964-33192986 ATTTGCAGAGAACCCTCTAGAGG - Intergenic
1053044674 9:34905394-34905416 TGTTGAATAAAACACTGTAGGGG + Intergenic
1055870540 9:80873275-80873297 AGTTGCAGAGAATAGTGTATTGG + Intergenic
1055894553 9:81160240-81160262 TGCTGCAGTGAACACTGTTGTGG - Intergenic
1056285445 9:85083141-85083163 TGTGCTAGAGACCACTGTAGGGG + Intergenic
1057014419 9:91638735-91638757 TGGGGCAGAGAACAGTGTACTGG + Intronic
1061318426 9:129812583-129812605 TGCTGCAGAGAGCACTGCAGGGG - Intergenic
1186546507 X:10455575-10455597 TGCTGGATAGAACACTGCAGTGG - Intronic
1186946638 X:14575832-14575854 TGTAGCCGAGAACCCTGTGGGGG - Intronic
1188095990 X:26022324-26022346 TGTTGCAGAAAAAATTGTGGAGG - Intergenic
1189314418 X:40044069-40044091 TTTTGATAAGAACACTGTAGAGG + Intergenic
1194704485 X:97158425-97158447 TGTTGAAGAGAACACTGCCGAGG - Intronic
1196608722 X:117686265-117686287 TGTTTCAGAGTAAAATGTAGAGG - Intergenic
1197739831 X:129881534-129881556 TGCTACAGAGAACACAGCAGTGG + Intergenic
1199335064 X:146609760-146609782 TGATGCAGAGAAGAATGTAAAGG - Intergenic