ID: 1173370473

View in Genome Browser
Species Human (GRCh38)
Location 20:42430176-42430198
Sequence CACGGTCCACAGATATAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173370461_1173370473 14 Left 1173370461 20:42430139-42430161 CCATGAGCAAGGTCCCCACGGTC 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1173370473 20:42430176-42430198 CACGGTCCACAGATATAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 56
1173370460_1173370473 15 Left 1173370460 20:42430138-42430160 CCCATGAGCAAGGTCCCCACGGT 0: 1
1: 0
2: 1
3: 3
4: 80
Right 1173370473 20:42430176-42430198 CACGGTCCACAGATATAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 56
1173370466_1173370473 0 Left 1173370466 20:42430153-42430175 CCCACGGTCCACGGTCCAGGGTC 0: 1
1: 0
2: 0
3: 8
4: 53
Right 1173370473 20:42430176-42430198 CACGGTCCACAGATATAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 56
1173370467_1173370473 -1 Left 1173370467 20:42430154-42430176 CCACGGTCCACGGTCCAGGGTCC 0: 1
1: 0
2: 6
3: 19
4: 155
Right 1173370473 20:42430176-42430198 CACGGTCCACAGATATAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 56
1173370465_1173370473 1 Left 1173370465 20:42430152-42430174 CCCCACGGTCCACGGTCCAGGGT 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1173370473 20:42430176-42430198 CACGGTCCACAGATATAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 56
1173370469_1173370473 -8 Left 1173370469 20:42430161-42430183 CCACGGTCCAGGGTCCACGGTCC 0: 1
1: 0
2: 5
3: 11
4: 147
Right 1173370473 20:42430176-42430198 CACGGTCCACAGATATAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173370473 Original CRISPR CACGGTCCACAGATATAACT GGG Intronic
906132539 1:43469163-43469185 CTGGGTCCACAGCTATAGCTTGG + Intergenic
907279379 1:53336191-53336213 CACGGTCCAAAGATATTAAATGG + Intergenic
917202830 1:172534802-172534824 CACAGTCTACAAATATAACTAGG - Intronic
918575142 1:186049178-186049200 CACAGTTCACATATATAATTTGG - Intronic
921732373 1:218592814-218592836 CAGGGTCCAATGAAATAACTTGG - Intergenic
923090452 1:230736584-230736606 CACAGTTCTCAGATATAAATGGG + Intergenic
1081678106 11:44982793-44982815 CATGGTCCACAGATGCAACTGGG - Intergenic
1091695375 12:2624824-2624846 CACCGTCCACAGAAATCCCTAGG + Intronic
1094035531 12:26066333-26066355 CACTGTACACAGGTATTACTTGG - Intronic
1094316967 12:29145765-29145787 CACGCTGCACAGATATTACTAGG - Intergenic
1094733350 12:33203460-33203482 CAGGGTCCAAAAATATAAATTGG - Intergenic
1105280012 13:18957940-18957962 CCAGGCCCATAGATATAACTAGG - Intergenic
1113916971 13:113880043-113880065 CACGCTCCACAAATATTACATGG + Intergenic
1119962506 14:78875720-78875742 CTCTTTTCACAGATATAACTGGG - Intronic
1120741884 14:88117778-88117800 CACTTTCCACAGACATAGCTTGG + Intergenic
1122462182 14:101904903-101904925 CACGTTCCACAGAACTATCTGGG - Intronic
1132626982 16:895890-895912 CACGGTCCACAGACACGCCTCGG + Intronic
1132626994 16:895949-895971 CACGGTCCACAGACACGCCTCGG + Intronic
1132627006 16:896008-896030 CACGGTCCACAGACACGCCTCGG + Intronic
1132627042 16:896185-896207 CACGGTCCACAGACACGCCTTGG + Intronic
1136389190 16:29951620-29951642 CAAGGTCCACAGATACTACCTGG + Intronic
1136404095 16:30033464-30033486 CACGGAACACAGATTTTACTAGG - Intronic
1149247008 17:54721218-54721240 CACAGTCCACAGCTATAAATAGG + Intergenic
1152554331 17:81045536-81045558 CACGGTGCCCAGATATGACCAGG - Intronic
1156401498 18:36744189-36744211 CAGCGTCCACAGACATACCTTGG - Exonic
1159893200 18:73972333-73972355 CAGGGTCCCCAGAAGTAACTGGG - Intergenic
1163611971 19:18306362-18306384 CACGGTCCACAGATGCTACCCGG + Exonic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
926193716 2:10747522-10747544 CTCGGTCTACAGATTTCACTTGG + Intronic
927633577 2:24794728-24794750 AACTGTCCACAAATATTACTAGG - Intronic
933698408 2:85237341-85237363 CAGGGGCCACAGTTATAACAAGG - Intronic
939779501 2:146428144-146428166 CAGGGTCCACAAATATTAATTGG - Intergenic
940052313 2:149477713-149477735 CAAGATCCTCAGATATAACCTGG - Intergenic
943663558 2:190585216-190585238 CATAGTCCACAAATATAAATAGG - Intergenic
945163944 2:206922188-206922210 CAGGGTCCACAAAGATGACTTGG - Intergenic
947397143 2:229697517-229697539 CAGATTCCACAGATATACCTGGG + Intronic
1173370473 20:42430176-42430198 CACGGTCCACAGATATAACTGGG + Intronic
1179005441 21:37509852-37509874 CACGGTCCAAAAATATAAAGTGG + Intronic
1180597841 22:16990568-16990590 CACAGCCCACACATACAACTGGG - Intronic
955167267 3:56526982-56527004 AAAGGTCCCCAGATACAACTTGG + Intergenic
960244064 3:115380333-115380355 CAAGGGCCACAGATATAGCTTGG - Intergenic
969401824 4:6960960-6960982 CACGGCTCACACATTTAACTGGG - Intronic
974464620 4:62239185-62239207 CACAGTCCACAGGTAAAATTAGG + Intergenic
974766107 4:66348659-66348681 CAGGGTCCAGAGATATGACTGGG + Intergenic
979721031 4:123900679-123900701 CAAGGTCCTCAGATATAAACCGG + Intergenic
986162798 5:5246400-5246422 CACCATCCACAGATATTTCTAGG + Intronic
988047684 5:25979244-25979266 AAGGGTCCAAAGTTATAACTAGG - Intergenic
988321810 5:29708011-29708033 GAAGGTCCAAAGATATAGCTTGG + Intergenic
990933864 5:61125547-61125569 CAAGGTCCACATCAATAACTTGG + Intronic
998599774 5:143573602-143573624 CATGTGTCACAGATATAACTAGG + Intergenic
1000020869 5:157318405-157318427 CCCTGGCTACAGATATAACTAGG - Intronic
1002535026 5:179871506-179871528 CAATGTCCACAGGTATAGCTCGG + Exonic
1010106058 6:72169613-72169635 CACCGTGTCCAGATATAACTTGG - Intronic
1017830002 6:158117770-158117792 CATACTCCACAGATATAATTCGG + Exonic
1024186547 7:46954144-46954166 CTGGGTCTGCAGATATAACTGGG - Intergenic
1036206923 8:6812194-6812216 CCCGGGCCACAGATCTAGCTGGG - Exonic
1037223656 8:16556100-16556122 CACAGTCCACAGATGTAAATAGG + Intronic
1041868936 8:62611128-62611150 CAAGGTGAACATATATAACTGGG - Intronic
1041971082 8:63743314-63743336 CACCATCCACACATATATCTAGG + Intergenic
1048814711 8:138321607-138321629 CAAGGTCCTCAGGTATAAATGGG + Intronic
1061267227 9:129513981-129514003 CCGGGTCCACAGGCATAACTTGG - Intergenic
1186353373 X:8763345-8763367 CAGGCTCCAAAAATATAACTAGG + Intergenic
1196864324 X:120057181-120057203 CACAGGCCACAGACAAAACTAGG - Intergenic
1196878777 X:120179150-120179172 CACAGGCCACAGACAAAACTAGG + Intergenic