ID: 1173372173

View in Genome Browser
Species Human (GRCh38)
Location 20:42446861-42446883
Sequence CAGGATTACCAGATGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173372173_1173372178 12 Left 1173372173 20:42446861-42446883 CCTCCTTCCATCTGGTAATCCTG 0: 1
1: 0
2: 0
3: 11
4: 189
Right 1173372178 20:42446896-42446918 AGCTCCCTGCAACTTCTAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 138
1173372173_1173372179 13 Left 1173372173 20:42446861-42446883 CCTCCTTCCATCTGGTAATCCTG 0: 1
1: 0
2: 0
3: 11
4: 189
Right 1173372179 20:42446897-42446919 GCTCCCTGCAACTTCTAAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173372173 Original CRISPR CAGGATTACCAGATGGAAGG AGG (reversed) Intronic
900961435 1:5923610-5923632 GAGGATTACCAGGTGGCTGGAGG - Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
906137714 1:43511396-43511418 TAGGACAAACAGATGGAAGGTGG - Intergenic
907727269 1:57031354-57031376 CAGTATTATCAGATGGAACATGG - Intronic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
908590797 1:65630992-65631014 AAGGATTACCAGATATTAGGAGG - Intronic
908842111 1:68290535-68290557 CAGTATAACCAGGTGGAAAGAGG - Intergenic
911118623 1:94272447-94272469 CTGGATAACCAGGTGCAAGGAGG + Intronic
911365655 1:96934529-96934551 CAGGCTTTGAAGATGGAAGGGGG - Intergenic
917539003 1:175895518-175895540 CAGGAGTTACAGATGGAAGCAGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
921766999 1:218983704-218983726 GAGGGGTCCCAGATGGAAGGGGG + Intergenic
922792938 1:228320371-228320393 ATGGATGACTAGATGGAAGGAGG - Intronic
922865988 1:228861962-228861984 CAGGATTACGAAAGGGAAGAGGG + Intergenic
922998134 1:229983145-229983167 GAGGATTCCCAAAGGGAAGGAGG + Intergenic
924804655 1:247352739-247352761 CAGGCTTTTCAGATTGAAGGTGG - Intergenic
1064309065 10:14195669-14195691 CATGATTCCCAGCAGGAAGGTGG + Intronic
1068968909 10:62942598-62942620 AAGGATTGCTAGATAGAAGGGGG - Intergenic
1071445819 10:85746036-85746058 AAGGATTACCATTTGTAAGGAGG - Intronic
1077283519 11:1756051-1756073 CATGAGTGCCAGGTGGAAGGAGG - Intronic
1083096558 11:60256850-60256872 CAGGAGTATCTGAAGGAAGGAGG - Intergenic
1083228617 11:61300667-61300689 AATCCTTACCAGATGGAAGGTGG - Intronic
1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG + Exonic
1084367324 11:68710712-68710734 CAGGATTAGCCCATGGAGGGAGG + Intronic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1085981978 11:81736148-81736170 CAAGATTGCCAAAAGGAAGGTGG - Intergenic
1087586223 11:100125324-100125346 GAGGATTACTAGAGGGAAGTAGG - Intronic
1091792344 12:3279069-3279091 AAGCCTTACCAGATGGGAGGGGG + Intronic
1092507364 12:9117341-9117363 CAGGAAGACCAGATGGGAGCTGG + Intergenic
1096815934 12:54201726-54201748 CAGGGTCACCAGATGGAGAGCGG - Intergenic
1097287922 12:57891957-57891979 CAGGGGTACCAGATGTAAGGGGG + Intergenic
1098231459 12:68375694-68375716 CAGGATCTCCAGCTTGAAGGGGG - Intergenic
1098722172 12:73914031-73914053 CAGGGTGACTAGATGGAAGCAGG + Intergenic
1099073390 12:78075047-78075069 CAGGATTACAGGATCCAAGGAGG - Intronic
1099810794 12:87579727-87579749 CAGGATTTCCTGATGGATTGGGG + Intergenic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101034047 12:100687330-100687352 CAGGACAACCAGCAGGAAGGAGG - Intergenic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1104684573 12:130776366-130776388 CTGGCTTCCCAGCTGGAAGGAGG + Intergenic
1104973564 12:132542132-132542154 CAGGATGACCAGATGGCACAGGG + Intronic
1106622075 13:31380359-31380381 GTGGACTACTAGATGGAAGGAGG + Intergenic
1108042160 13:46349232-46349254 TAGGATTAGCAGATGTATGGAGG + Intronic
1111636264 13:90907865-90907887 CAGGATTTCCAGCTTGAGGGTGG + Intergenic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113834790 13:113321691-113321713 CAGGCTTTCAAGGTGGAAGGTGG + Exonic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1115663464 14:35520968-35520990 CAGGAATACCAAAGGGAAGTAGG + Intergenic
1119165314 14:72487614-72487636 CTGGCTTTGCAGATGGAAGGGGG + Intronic
1119173945 14:72555404-72555426 CAGGATTTCCAAATGGGATGAGG + Intronic
1119194115 14:72704387-72704409 CAGGATTCCCAGATGCCTGGGGG - Intronic
1119414054 14:74457658-74457680 CAGGATTATCCTATAGAAGGGGG + Intergenic
1121125798 14:91406030-91406052 AAGGACTTCCAGATGGAAAGAGG - Intronic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122448825 14:101787346-101787368 CAGATTTGCCAGGTGGAAGGAGG + Intronic
1128332185 15:66763145-66763167 CAGAACTAGGAGATGGAAGGTGG + Intronic
1128690888 15:69723999-69724021 CAGAATTACAAGGTGGAGGGTGG + Intergenic
1129590168 15:76907698-76907720 AAGTATTTCCAGAAGGAAGGAGG - Intergenic
1137693964 16:50448860-50448882 CAGGATTAGCAGATCAAGGGAGG - Intergenic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG + Intronic
1140274541 16:73496933-73496955 CAGGGCTACCTGTTGGAAGGTGG - Intergenic
1140444280 16:75012288-75012310 AAGGATCATGAGATGGAAGGAGG + Intronic
1141382369 16:83588021-83588043 CAGGTGTACGGGATGGAAGGAGG - Intronic
1141815157 16:86404708-86404730 CAGGAAGACCTGAGGGAAGGCGG - Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142677260 17:1521460-1521482 CATCATTACTAGAGGGAAGGAGG + Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1148478726 17:47946169-47946191 CAGGATGGCCAGATGGACAGAGG - Intronic
1148862576 17:50612378-50612400 CCGGCTTCCCAGATGGAGGGAGG + Intronic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1152052791 17:77995124-77995146 CAGGAATAGCAGATATAAGGAGG + Intergenic
1152513007 17:80803082-80803104 CAGGATAAACAGATCCAAGGAGG - Intronic
1154144172 18:11852421-11852443 CAGAATGATCAGATTGAAGGTGG + Exonic
1156016578 18:32553436-32553458 CAGGAAGACCAGTTAGAAGGCGG - Intergenic
1157235453 18:45961114-45961136 CAGGATTGTCAGAGAGAAGGTGG - Intronic
1161759277 19:6159366-6159388 CAGCATTCCCAGCTGGAAGAAGG - Intronic
1166599589 19:44082223-44082245 CAGGACAACCAGCAGGAAGGAGG - Intronic
925190229 2:1876487-1876509 CAGGAGCCCCAGATGGACGGGGG - Intronic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926108966 2:10170067-10170089 CAGGCTTTCCAGAGAGAAGGAGG + Intronic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
928795028 2:35007773-35007795 CAGGATAAACAGGTGAAAGGAGG + Intergenic
929270624 2:39967392-39967414 TGGGAATTCCAGATGGAAGGTGG + Intergenic
932177263 2:69614346-69614368 CAGGTGTAACAGCTGGAAGGAGG + Intronic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
936460720 2:112712245-112712267 CAGGGATGCCAGAAGGAAGGGGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
939726744 2:145729985-145730007 CAGGATGACCATATGGTAAGGGG + Intergenic
940165309 2:150764307-150764329 CTGGCTTCCCAGTTGGAAGGTGG - Intergenic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
943124305 2:183777396-183777418 CAGGATTACTAGATGAGGGGAGG - Intergenic
943354814 2:186839895-186839917 CAGGAGTAGGAGATGGAAGGGGG - Intronic
946067258 2:216998639-216998661 CATTATAACCAGATGAAAGGGGG - Intergenic
948169256 2:235888070-235888092 CATGATAAGCAAATGGAAGGAGG - Intronic
1172392677 20:34576523-34576545 CTGGATTTGCAGCTGGAAGGGGG - Intronic
1172560882 20:35887419-35887441 CAGGCTTACCTGATGGTTGGCGG + Intronic
1172669786 20:36627080-36627102 CAGGCTTTCCAGATGGAGGGAGG + Intronic
1172904624 20:38359893-38359915 CAGGAGTACCAGCAGGAATGGGG + Intronic
1173339304 20:42139404-42139426 CAGGAATACCAGTAGGAAAGGGG + Intronic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1179297901 21:40079629-40079651 CAGGAACTCCAGAAGGAAGGAGG - Intronic
1179566325 21:42251333-42251355 CAGCAGCACCAGGTGGAAGGAGG + Intronic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1181760746 22:25057243-25057265 CAGGATCCCCAGGTGGAAGAAGG + Intronic
1181785209 22:25221803-25221825 TGGGATTAGTAGATGGAAGGTGG + Intronic
1183162387 22:36123519-36123541 CAGGCTTTCAACATGGAAGGTGG + Intergenic
1183210267 22:36446993-36447015 CACCATCACCAGATGGATGGGGG - Intergenic
949352956 3:3144210-3144232 CAGGATTAACAGAAGAAACGAGG - Intronic
950787729 3:15450065-15450087 CAGCATTGCCAGATGGAGGGAGG - Intronic
951791605 3:26491626-26491648 CAGGGCTACCAAGTGGAAGGAGG + Intergenic
952055489 3:29439952-29439974 CAGGAAGACCAGACGGAAGTCGG + Intronic
954099347 3:48357585-48357607 CAGGATTACCAGCTGCAGAGAGG - Intergenic
954360872 3:50122215-50122237 CAGGGCTCCCAGATGGAAGCAGG + Intergenic
958675552 3:97265007-97265029 CAGGATGACCAGCTGCAAAGAGG - Intronic
958774137 3:98461056-98461078 CAGGGTTTGAAGATGGAAGGGGG + Intergenic
959524671 3:107363300-107363322 CAGGAGTTCCAGACGGCAGGCGG + Intergenic
959978788 3:112491520-112491542 CAAGATCACCAGCTGGTAGGAGG + Intronic
962433591 3:135344474-135344496 CTTGGTTGCCAGATGGAAGGGGG - Intergenic
962631477 3:137280510-137280532 GAGGAATACCAGGTGGAAGCTGG + Intergenic
963334482 3:143957290-143957312 CAGGATTACTACATGGTAGAAGG + Intergenic
965635972 3:170781060-170781082 GGGGATTAGCATATGGAAGGTGG + Intronic
967311457 3:188110264-188110286 CAGCATTACAGGAAGGAAGGAGG + Intergenic
968351935 3:198064939-198064961 GAGGCTTACCAGATTAAAGGAGG + Intergenic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
971564511 4:28120431-28120453 CAGGATAACTAGATGTAATGTGG + Intergenic
973897680 4:55431592-55431614 CAGGAGTCCCTGTTGGAAGGGGG - Exonic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
982587773 4:157264380-157264402 CAGGATTTGGAGATGGAAGGAGG - Intronic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984973489 4:185210134-185210156 CAGGATCCCCAGCAGGAAGGCGG - Intronic
986054415 5:4121632-4121654 CAGCAATAACAGATGGAAGTTGG - Intergenic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
986411778 5:7488408-7488430 CAGGATTTCCAGGTGGTATGTGG + Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987539553 5:19236424-19236446 TTGGATTACCAGAGGGAGGGGGG + Intergenic
988856738 5:35234405-35234427 CAGGATTAGATGAAGGAAGGAGG - Intergenic
990363963 5:55050308-55050330 CAGGATTACTAGAAGAAGGGAGG - Intergenic
993533301 5:89049881-89049903 CAGGATTAAGAGATGAAAGTAGG - Intergenic
995970467 5:117964154-117964176 AAGGCTCATCAGATGGAAGGTGG - Intergenic
997598844 5:135125894-135125916 CAGGAATGCCAGGTGGATGGAGG + Intronic
998745635 5:145256203-145256225 CTGGATTTGAAGATGGAAGGAGG - Intergenic
999740038 5:154542933-154542955 TAGGGATACCAGGTGGAAGGTGG - Intergenic
1001766666 5:174253823-174253845 CAAGATTACCAGATTAAAAGGGG + Intergenic
1002099099 5:176848599-176848621 CCCTATTCCCAGATGGAAGGTGG + Intronic
1002959002 6:1896722-1896744 CAGGATTACCTTCTGGATGGTGG + Intronic
1006394629 6:33779076-33779098 CAGGATGACCATATTGAAAGTGG - Intronic
1008675483 6:53813487-53813509 CAACTTTACCAGCTGGAAGGTGG + Intronic
1011962898 6:93113510-93113532 CTGGAGTACAAGGTGGAAGGTGG - Intergenic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1015951160 6:138554003-138554025 CAGTATGTCCAGATGGAGGGAGG + Intronic
1016325744 6:142899143-142899165 CAGGATTACAAAGTGGGAGGAGG - Intronic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1018505903 6:164468318-164468340 CAGGATTACCACATGTAAAATGG + Intergenic
1019400953 7:853541-853563 CGGGTGGACCAGATGGAAGGCGG + Exonic
1020863065 7:13519254-13519276 CAGGATTGCAAGATGGGGGGCGG + Intergenic
1020967239 7:14886712-14886734 CAGGTGGGCCAGATGGAAGGTGG - Intronic
1022287725 7:28970479-28970501 CAGGATTACAGTATTGAAGGTGG + Intergenic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1023098457 7:36687818-36687840 CAGGATTCCTTGAGGGAAGGTGG + Intronic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1024614557 7:51100032-51100054 CAGGATTACCACAGTGGAGGTGG - Intronic
1025887775 7:65614523-65614545 GAGGAGGAGCAGATGGAAGGAGG - Intergenic
1026395693 7:69951676-69951698 CAGGATTCCAAGATGGCAGCTGG + Intronic
1028055456 7:86235453-86235475 CAGCATTTCTAAATGGAAGGTGG + Intergenic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1031013728 7:116550247-116550269 CAGGGTTTCAAGATGGAAGAGGG - Intronic
1031854602 7:126907187-126907209 GAGGAGGAGCAGATGGAAGGAGG + Intronic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1035242175 7:157539458-157539480 CAAGATGATCACATGGAAGGCGG - Exonic
1038012577 8:23486737-23486759 CAGGATTAACACCTGGAAGGGGG + Intergenic
1038187720 8:25290904-25290926 CAGAATTACCAGTTGGCAGAGGG + Intronic
1038275853 8:26120060-26120082 CAGGACTTCGAGATGTAAGGAGG - Intergenic
1038309448 8:26435052-26435074 CAGGATTAACATATGTGAGGTGG + Intronic
1038387779 8:27165729-27165751 CAGAAATACCTGATGGAAGTGGG - Intergenic
1038696868 8:29813952-29813974 TAGGATTACCTGAAGGATGGTGG + Intergenic
1039526601 8:38222054-38222076 CATGATGACCAAATGTAAGGTGG - Intergenic
1044079657 8:87867801-87867823 CAGGAGCACCAGGTGGGAGGAGG + Intergenic
1045416667 8:101974410-101974432 CAGAATTTCCACATAGAAGGGGG - Intronic
1046499984 8:115062964-115062986 CAGGATTAGACGATGGAAAGTGG + Intergenic
1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG + Intronic
1047179869 8:122576779-122576801 CTGGATTCAGAGATGGAAGGGGG - Intergenic
1051419810 9:16877815-16877837 CAGGCTTTGAAGATGGAAGGGGG - Intergenic
1052380779 9:27768478-27768500 CAGAATTTACAGATGGAAAGTGG - Intergenic
1055558183 9:77496980-77497002 GAGGAATACGAGATGGAGGGTGG - Intronic
1055658142 9:78472921-78472943 GAGGATTTCCAGAAGGAAGGTGG + Intergenic
1058090953 9:100804752-100804774 CTGGATTTGAAGATGGAAGGAGG + Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1060379883 9:123158048-123158070 AAGGCTTACTAGATGGAAGGGGG + Exonic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062456708 9:136643247-136643269 CAGAATTATCAGATTGAAGGTGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1188576377 X:31655722-31655744 CATGATTCCATGATGGAAGGTGG - Intronic
1190369533 X:49727496-49727518 CAGGATGACCAGCTGCAAAGAGG + Intergenic
1190370414 X:49735047-49735069 CAGTCTTACCAGATTGTAGGTGG - Intergenic
1200933129 Y:8715186-8715208 CTGGACTTCCAGATTGAAGGAGG - Intergenic
1201784515 Y:17759481-17759503 CAGCATTACCATAAGGTAGGAGG - Intergenic
1201817038 Y:18146506-18146528 CAGCATTACCATAAGGTAGGAGG + Intergenic