ID: 1173374512

View in Genome Browser
Species Human (GRCh38)
Location 20:42471458-42471480
Sequence GAACACTACGTGGCCAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173374512 Original CRISPR GAACACTACGTGGCCAAAGC AGG (reversed) Intronic
901222879 1:7593793-7593815 TAACACTAGGAGGCCAAGGCAGG + Intronic
903739184 1:25548593-25548615 GCACTCTGGGTGGCCAAAGCAGG - Intronic
905036028 1:34918818-34918840 GCACACTCCGAGGCCAGAGCTGG + Intronic
905610836 1:39349823-39349845 TATCACTATGTTGCCAAAGCTGG + Intronic
905993858 1:42363979-42364001 GAACTCTCAATGGCCAAAGCTGG + Intergenic
907017686 1:51033173-51033195 GAACTTTGCGAGGCCAAAGCCGG + Intergenic
910056948 1:83044729-83044751 GAACATTGGGAGGCCAAAGCAGG - Intergenic
910314376 1:85865910-85865932 GAAAAATATGGGGCCAAAGCTGG + Intronic
912772254 1:112474921-112474943 GCACATCACATGGCCAAAGCAGG - Intronic
913216035 1:116621146-116621168 GCGCCTTACGTGGCCAAAGCAGG - Intronic
913969772 1:143405811-143405833 GCACATCATGTGGCCAAAGCAGG - Intergenic
914064145 1:144231404-144231426 GCACATCATGTGGCCAAAGCAGG - Intergenic
914115005 1:144734950-144734972 GCACATCATGTGGCCAAAGCAGG + Intergenic
915453065 1:156020446-156020468 GGACACCATGTGGCCAGAGCAGG + Intronic
920063904 1:203250655-203250677 GAGCTCTCGGTGGCCAAAGCTGG - Intronic
920162553 1:204010515-204010537 CAACACTGGGAGGCCAAAGCAGG - Intergenic
921156711 1:212444772-212444794 GAGCATTAGGTTGCCAAAGCAGG - Intronic
1064197190 10:13254082-13254104 TCACACTACGTTGCCCAAGCCGG + Intergenic
1065019856 10:21495078-21495100 GAAACCTACGTGCCCAGAGCAGG - Exonic
1065912918 10:30325498-30325520 GCACTCTAGGAGGCCAAAGCAGG + Intronic
1067037726 10:42932326-42932348 GAGCACTAGGTGGGCAAACCTGG + Intergenic
1068898962 10:62242875-62242897 GCACACTGAGAGGCCAAAGCAGG - Intronic
1071269203 10:83991432-83991454 GCACTTTAGGTGGCCAAAGCAGG + Intergenic
1072000998 10:91195681-91195703 CAACACTGGGAGGCCAAAGCAGG - Intronic
1073248576 10:102108065-102108087 GAGCACTGGGTGGCCACAGCAGG + Exonic
1073596358 10:104804266-104804288 GACCACTAAGTGGCCAAATTAGG + Intronic
1074047882 10:109855444-109855466 GAGCCCTCAGTGGCCAAAGCTGG + Intergenic
1077090866 11:777645-777667 GAACCCGCCGGGGCCAAAGCAGG - Exonic
1078114724 11:8434948-8434970 GAACATTACCTGGCCACAGCAGG - Intronic
1079072413 11:17358841-17358863 GAGCTCCCCGTGGCCAAAGCTGG - Intronic
1079677346 11:23246782-23246804 GCACATTACATGGCCAGAGCAGG + Intergenic
1081665482 11:44914684-44914706 GAACAGTACTCGGCCCAAGCTGG - Intronic
1087997998 11:104835632-104835654 CAACATTAGGAGGCCAAAGCAGG - Intergenic
1089106986 11:116018659-116018681 GCACATTACATGGCAAAAGCAGG + Intergenic
1091420606 12:336592-336614 GAACACTGGGAGGCCGAAGCTGG + Intronic
1095061525 12:37698297-37698319 GAACCCTTTGTGGCCAAAGGTGG - Intergenic
1095298006 12:40549177-40549199 GAACATTGGGAGGCCAAAGCAGG - Intronic
1097727089 12:63087783-63087805 CAACACTGAGAGGCCAAAGCGGG + Intergenic
1098241481 12:68471861-68471883 GAACACAATGTGGCCAAAAGAGG + Intergenic
1099383095 12:81979838-81979860 GAACATCACATGGCAAAAGCAGG + Intergenic
1101617179 12:106349705-106349727 CAGCACTTCGAGGCCAAAGCAGG + Intergenic
1104120357 12:125793091-125793113 GCACACCACATGGCGAAAGCAGG + Intergenic
1104884514 12:132098685-132098707 GAACACGATATGGCCAGAGCAGG + Intronic
1106383864 13:29265700-29265722 GAACCTTACATGGCAAAAGCAGG + Intronic
1107098029 13:36557774-36557796 GCACTCTAGGAGGCCAAAGCAGG + Intergenic
1113267074 13:108631829-108631851 GAACATTGGGAGGCCAAAGCAGG + Intronic
1114358951 14:21948760-21948782 TATCACTACGTTGCCAAGGCTGG + Intergenic
1114781346 14:25541578-25541600 GAGCAATAAGTGGCCAAAGTGGG + Intergenic
1119510261 14:75205747-75205769 CAGCAGAACGTGGCCAAAGCAGG + Intergenic
1119603036 14:75990159-75990181 AACCACTACTTAGCCAAAGCTGG + Intronic
1120698771 14:87674720-87674742 GAACTCCCAGTGGCCAAAGCTGG - Intergenic
1120961096 14:90125682-90125704 GCACTCTCAGTGGCCAAAGCTGG + Intronic
1121424638 14:93840926-93840948 GAACTCTGGGAGGCCAAAGCAGG - Intergenic
1122253850 14:100462757-100462779 GACCACTATGTTGCCCAAGCTGG + Intronic
1127327198 15:57907198-57907220 GTACCCTAGGAGGCCAAAGCAGG + Intergenic
1130126097 15:81095304-81095326 TCCCACTATGTGGCCAAAGCTGG + Intronic
1136186199 16:28590330-28590352 GGAGACTACGTGGCCAGACCTGG + Exonic
1136318000 16:29465485-29465507 GGAGACTACGTGGCCAGACCTGG - Exonic
1136432575 16:30204834-30204856 GGAGACTACGTGGCCAGACCTGG - Exonic
1138021689 16:53488966-53488988 GCACATTAGGAGGCCAAAGCAGG + Intronic
1138573518 16:57891393-57891415 GAACACTGGGAGGCCAAGGCGGG + Intronic
1139153940 16:64418374-64418396 GAACACTGGGAGGCCTAAGCAGG + Intergenic
1139229898 16:65273543-65273565 GAACACCACCTGGCCTAAGCAGG - Intergenic
1139586225 16:67905611-67905633 GCACTTTAGGTGGCCAAAGCTGG + Intronic
1141160690 16:81627593-81627615 GGACACTCCGTGGCCAGAGCCGG - Intronic
1141188038 16:81802446-81802468 GAACACTTGGTAGCAAAAGCTGG - Intronic
1142958446 17:3536340-3536362 GCACACTGGGAGGCCAAAGCAGG + Intronic
1150597720 17:66621485-66621507 GAACACTAAGTGGTCAAAACGGG - Intronic
1152339720 17:79717333-79717355 GAACTTTAGGAGGCCAAAGCAGG + Intergenic
1155089072 18:22488807-22488829 GAGGACAACGTGTCCAAAGCAGG - Intergenic
1158477738 18:57795148-57795170 CAACACTAGGAGGCCAAGGCAGG + Intronic
1161571059 19:5031118-5031140 GAACACTACATGGCCACATCTGG + Intronic
1163753774 19:19094401-19094423 GAACCCTTGATGGCCAAAGCTGG - Intronic
1164979036 19:32599031-32599053 GCACACTGGGAGGCCAAAGCGGG + Intronic
1165143028 19:33713804-33713826 CAACACTAGGAGGCCAAGGCGGG - Intronic
1168491191 19:56811393-56811415 GAACATTAAGTGGAGAAAGCAGG - Exonic
925091637 2:1161169-1161191 CAGCACTACGGGGCCAAGGCGGG + Intronic
925736470 2:6968367-6968389 GAACACTTCGGGCCCAGAGCAGG + Intronic
933682388 2:85113691-85113713 GCACACTGGGAGGCCAAAGCAGG + Intergenic
934174464 2:89566722-89566744 GCACATCACGTGGCCAAAGCAGG - Intergenic
934284780 2:91641072-91641094 GCACATCACGTGGCCAAAGCAGG - Intergenic
937361508 2:121233069-121233091 GCACTCTGCGTGGCCAAGGCAGG + Intronic
941933321 2:170963889-170963911 GCACACTGGGAGGCCAAAGCAGG - Intronic
942362544 2:175187587-175187609 AGACACTAGGAGGCCAAAGCAGG - Intergenic
946360222 2:219214983-219215005 GAACACAATGAGGCCAAACCAGG + Exonic
947617268 2:231566291-231566313 GTTCACTATGTGGCCATAGCTGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173374512 20:42471458-42471480 GAACACTACGTGGCCAAAGCAGG - Intronic
1174468945 20:50741205-50741227 GAACACTTCGAGGCCAAGACGGG - Intronic
1178751768 21:35311471-35311493 AAACTCTCCGTGGCCAAAGCTGG - Intronic
1178780366 21:35597766-35597788 CAACACTAGGAGGCCAAGGCAGG + Intronic
1179295512 21:40058507-40058529 GAACAGTATATGGCCAAAGTAGG + Intronic
1179944434 21:44661731-44661753 GCACATCACGTGGCCAGAGCAGG + Intronic
1183205353 22:36415082-36415104 GATCACTCCGTTGCCCAAGCTGG - Intergenic
1184827533 22:46963291-46963313 GAGCACTGCGTGGCCCAGGCAGG - Intronic
950171226 3:10840243-10840265 GAACACCACGAGGCCAAAGAAGG - Intronic
951491871 3:23279879-23279901 GAAAATTAAGTGGCCAGAGCAGG - Intronic
954055377 3:48019089-48019111 GAACTCTGGGAGGCCAAAGCAGG + Intronic
955727466 3:61948410-61948432 GAACAATGCCTGGCCATAGCAGG - Intronic
956337477 3:68180284-68180306 GCACTCTGAGTGGCCAAAGCAGG - Intronic
957062878 3:75496361-75496383 CAACACTAGGAGGCCAAGGCAGG - Intergenic
960707837 3:120497704-120497726 GAACTCTACTTGGCCAACGATGG + Intergenic
961357513 3:126348456-126348478 GACCACCAGGTGGCCAGAGCAGG + Intronic
962477414 3:135767552-135767574 GAACCCTGATTGGCCAAAGCAGG - Intergenic
964798808 3:160530220-160530242 GCACACTGGGAGGCCAAAGCAGG + Intronic
965869786 3:173252128-173252150 GCACATTACCTGGCAAAAGCAGG + Intergenic
968821791 4:2858789-2858811 TCTCACTACGTGGCCAAGGCTGG - Intronic
969168777 4:5341797-5341819 GCACATTACATGGCCAGAGCAGG + Intronic
969828321 4:9775665-9775687 GCACATCACGTGGCCAAAACAGG - Intronic
969960094 4:10935893-10935915 TAACACTAAGTGGCAAAAGTGGG + Intergenic
973533798 4:51860624-51860646 GCACACCACATGGCGAAAGCAGG + Intronic
974743776 4:66042695-66042717 GAACATTAGGAGGCCAAGGCGGG + Intergenic
975124899 4:70770885-70770907 GAACACTTAGTGGCCATTGCAGG + Intronic
976306102 4:83560848-83560870 GCACACCACATGGCCAGAGCAGG - Intronic
980910079 4:138986379-138986401 GAACTTTAGGAGGCCAAAGCAGG + Intergenic
983267414 4:165522205-165522227 GAACATCACATGGCCAGAGCAGG - Intergenic
986658205 5:10035920-10035942 GACCTCTAGGTGGCCACAGCAGG - Intergenic
986927019 5:12766783-12766805 GCACACCACATGGCGAAAGCAGG - Intergenic
987264908 5:16243224-16243246 GCACATTACATGGCCAGAGCAGG - Intergenic
988483526 5:31649122-31649144 GAACTCTGGGAGGCCAAAGCGGG - Intronic
988655535 5:33207381-33207403 GAACACTTAGAGGCCAAAGTAGG - Intergenic
989506629 5:42233101-42233123 GCACATTACATGGCAAAAGCAGG - Intergenic
990619074 5:57540444-57540466 GCACATCACGTGGCAAAAGCAGG - Intergenic
992334251 5:75749082-75749104 GCACATCATGTGGCCAAAGCAGG - Intergenic
994159539 5:96541257-96541279 GAACTCTTAGTAGCCAAAGCTGG - Intronic
995648986 5:114346126-114346148 GCACATCACATGGCCAAAGCAGG + Intergenic
995982577 5:118122534-118122556 GAACATCACATGGCAAAAGCAGG + Intergenic
998661679 5:144245769-144245791 GCACTTCACGTGGCCAAAGCAGG - Intronic
1000545759 5:162599464-162599486 GAACTTTAGGAGGCCAAAGCAGG - Intergenic
1000830410 5:166094812-166094834 GAACATCACATGACCAAAGCAGG + Intergenic
1001151816 5:169236202-169236224 GAATTCTTAGTGGCCAAAGCTGG - Intronic
1001927805 5:175651595-175651617 GCACATTACATGGCAAAAGCAGG + Intergenic
1002981398 6:2142222-2142244 CAACAATACCTGGCAAAAGCGGG + Intronic
1003448507 6:6207711-6207733 CAACGCTACTTGGCTAAAGCTGG + Intronic
1006138465 6:31911964-31911986 GGTCACTACGTTGCCAAGGCTGG + Intronic
1007223684 6:40298083-40298105 GAACACTTCATGGCCAAGGATGG - Intergenic
1010567774 6:77438167-77438189 GAGCTCTAGATGGCCAAAGCTGG + Intergenic
1012682113 6:102195340-102195362 GCACATCACGTGGCAAAAGCAGG - Intergenic
1015798844 6:137040590-137040612 GAACTCTTAGTGGCCAAAGCTGG + Intronic
1021667171 7:22995547-22995569 GAACACCCAATGGCCAAAGCTGG + Intronic
1023287599 7:38634978-38635000 CAACACTACGCTGCCAAAGGAGG + Intergenic
1027118760 7:75501089-75501111 GCACACTGGGAGGCCAAAGCAGG - Intergenic
1027326485 7:77053454-77053476 GCACACTGGGAGGCCAAAGCAGG + Intergenic
1027925661 7:84459779-84459801 GAACTCTGGGAGGCCAAAGCGGG + Intronic
1029718727 7:102348928-102348950 GCACACTGGGAGGCCAAAGCAGG + Intergenic
1029753888 7:102560327-102560349 GCACACTGGGAGGCCAAAGCAGG - Intronic
1029771838 7:102659417-102659439 GCACACTGGGAGGCCAAAGCAGG - Intronic
1029938461 7:104453837-104453859 GAACATCACGTGGCTGAAGCAGG - Intronic
1030695200 7:112577615-112577637 GCACATTACATGGCGAAAGCAGG + Intergenic
1030815415 7:114030418-114030440 GAACTTTAGGAGGCCAAAGCGGG + Intronic
1031356604 7:120794498-120794520 GCACATCACATGGCCAAAGCAGG - Intronic
1034011636 7:147535094-147535116 TAACAATAGGTGGCCAAGGCCGG + Intronic
1034144490 7:148856710-148856732 AAACTCTCAGTGGCCAAAGCTGG + Intronic
1034325282 7:150224944-150224966 GATCACCCAGTGGCCAAAGCTGG - Intergenic
1034767920 7:153744302-153744324 GATCACCCAGTGGCCAAAGCTGG + Intergenic
1040470795 8:47734410-47734432 CCAGACAACGTGGCCAAAGCAGG - Intronic
1040677367 8:49766467-49766489 GCACATCACGTGGCAAAAGCAGG + Intergenic
1042152472 8:65802969-65802991 GCACATTATGTGGCAAAAGCAGG - Intronic
1042215409 8:66426087-66426109 GAACACTGGGAGGCCAAGGCGGG - Intergenic
1042249814 8:66744750-66744772 GCACACTGCGAGGCCAAGGCGGG - Intronic
1043801115 8:84610804-84610826 GAGCTCTGAGTGGCCAAAGCTGG - Intronic
1043863011 8:85343195-85343217 TATCACTATGTGGCCCAAGCTGG - Intronic
1044639967 8:94368871-94368893 GAACACTTAGTGGCCATTGCAGG - Intergenic
1044695009 8:94914036-94914058 CAACTCTAGGAGGCCAAAGCGGG - Intronic
1045407140 8:101878080-101878102 GAAAACTAAGTGGCCAAGGGTGG + Intronic
1048014827 8:130488056-130488078 GCACATTACATGGCCAGAGCAGG + Intergenic
1048130562 8:131692923-131692945 GTACATCACGTGGCAAAAGCAGG + Intergenic
1048178246 8:132171907-132171929 GAACTCTGGGAGGCCAAAGCAGG + Intronic
1051341776 9:16118850-16118872 GAAAATTAAGTGGCCATAGCAGG + Intergenic
1052802241 9:32979657-32979679 GAGCATTAGGTGGCCAAGGCAGG - Intronic
1058842292 9:108921623-108921645 GAAAACCACTTGTCCAAAGCTGG + Intronic
1060609978 9:124954917-124954939 GCACACTGGGAGGCCAAAGCAGG + Intronic
1061171562 9:128959784-128959806 CAACACTTGGAGGCCAAAGCAGG - Intronic
1061980345 9:134099533-134099555 GAGCACCCAGTGGCCAAAGCTGG - Intergenic
1186147058 X:6635545-6635567 GGACATTACATGGCCAGAGCAGG + Intergenic
1186701029 X:12090303-12090325 GCACTTTACGTGGCCAGAGCAGG - Intergenic
1191078321 X:56481228-56481250 GAATACTACGCAGCCAAAGAAGG - Intergenic
1192811792 X:74553614-74553636 GAAAATTAAGTGGCCACAGCGGG + Intergenic
1197094150 X:122573875-122573897 GTACACCACATGGCAAAAGCAGG + Intergenic
1200309191 X:155059897-155059919 GCACTCCACATGGCCAAAGCAGG - Exonic
1201628210 Y:16038954-16038976 GGACATTACATGGCCAGAGCAGG + Intergenic