ID: 1173374646

View in Genome Browser
Species Human (GRCh38)
Location 20:42472416-42472438
Sequence GCTGCTGGTTGAACACATAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173374638_1173374646 29 Left 1173374638 20:42472364-42472386 CCTCGCAGGGTGTAGTGGGAGGA 0: 1
1: 0
2: 1
3: 21
4: 432
Right 1173374646 20:42472416-42472438 GCTGCTGGTTGAACACATACTGG 0: 1
1: 0
2: 0
3: 5
4: 124
1173374643_1173374646 -8 Left 1173374643 20:42472401-42472423 CCTCGGCCTCGTACTGCTGCTGG 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1173374646 20:42472416-42472438 GCTGCTGGTTGAACACATACTGG 0: 1
1: 0
2: 0
3: 5
4: 124
1173374642_1173374646 -5 Left 1173374642 20:42472398-42472420 CCTCCTCGGCCTCGTACTGCTGC 0: 1
1: 0
2: 0
3: 27
4: 331
Right 1173374646 20:42472416-42472438 GCTGCTGGTTGAACACATACTGG 0: 1
1: 0
2: 0
3: 5
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173374646 Original CRISPR GCTGCTGGTTGAACACATAC TGG Exonic
907686375 1:56615895-56615917 GCTGCTGGATGAACAAAAATTGG + Intronic
907829814 1:58054047-58054069 TCTTTTTGTTGAACACATACTGG + Intronic
908211282 1:61902961-61902983 GCTGCTCCTTGAACACATCCAGG - Intronic
911104053 1:94116330-94116352 GCTGCAGGCTGAAAACATGCCGG + Intronic
915057766 1:153151266-153151288 GCTGCAGGATCAGCACATACTGG - Intergenic
920946699 1:210535944-210535966 GCTGCTAGTTGAATAATTACTGG - Intronic
921594180 1:217037268-217037290 GCTGCTGATGAAAGACATACTGG + Intronic
924626471 1:245699905-245699927 GCAGCTGGTTGAAAAGATATTGG + Intronic
1067021109 10:42799006-42799028 GCTGCAGGAAGAACATATACAGG - Intronic
1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG + Intronic
1069497710 10:68921036-68921058 GCTGGTGGATGAATACATAGGGG - Intronic
1076558658 10:131346739-131346761 GCTGCTCATTAAACACCTACTGG + Intergenic
1076984112 11:223224-223246 ACAGCTGCTTGAACACATCCAGG + Intronic
1079165561 11:18038805-18038827 GCTGATGGAAGAAGACATACAGG + Intronic
1084196756 11:67527159-67527181 GCTGCTGATTGAACACAAGCAGG - Intergenic
1084554510 11:69867948-69867970 GCTGCTGGCGGAGCACATGCTGG - Intergenic
1085291852 11:75406380-75406402 GATGCTGGTTGATCACAGAGGGG + Intronic
1090232938 11:125122330-125122352 GAAGCTGCCTGAACACATACTGG - Intergenic
1097956740 12:65494674-65494696 GCTGCTGGCTGGACTCAAACAGG - Intergenic
1100464921 12:94836079-94836101 GCTGCTGGGTGTGCACATATAGG - Intergenic
1101823003 12:108198210-108198232 GGTGCTGATAGAACACAGACAGG - Intronic
1101988841 12:109468180-109468202 GCTGCTGCCTGAACAGAAACCGG + Intronic
1104588847 12:130068481-130068503 GGTGCTGGTTGTACAGATGCAGG - Intergenic
1105209165 13:18247735-18247757 GCTGCAGGGAGGACACATACAGG - Intergenic
1105371558 13:19806236-19806258 GCTGCAGTTTGAACACAAGCAGG - Intergenic
1106112533 13:26789576-26789598 GCTGCTAGATGAACAGATCCAGG + Intergenic
1106575994 13:30976257-30976279 GCTGCTGGTGGGAAACCTACAGG - Intergenic
1107349963 13:39503356-39503378 GCTGCTGTTTGATCAGAGACAGG - Intronic
1107428235 13:40315637-40315659 GCTGCTGGCAGCACACCTACAGG - Intergenic
1110289972 13:73794132-73794154 TCTGCTTCTTCAACACATACTGG + Intronic
1121259777 14:92557752-92557774 GGTGCTGGCTGAACACCCACTGG - Intronic
1125898012 15:43318782-43318804 GATGCTGGTTGAAGTCATAATGG + Intergenic
1126735365 15:51727287-51727309 GCTGCTGTTTGAAAACCAACTGG - Intronic
1128483068 15:68055629-68055651 GCTGCTGGGTTCACACACACAGG - Intronic
1130328212 15:82898582-82898604 GCTGTTCATTGAACACATTCTGG + Intronic
1131722292 15:95183254-95183276 GCTGCTGATTAAAGACATACCGG - Intergenic
1132345138 15:101103485-101103507 GCTGCTGGGAGAACTCATTCTGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1134698203 16:16241945-16241967 ACTGCTGGGAGAACACAAACTGG - Intronic
1134973635 16:18552732-18552754 ACTGCTGGGAGAACACAAACTGG + Intronic
1138026804 16:53528467-53528489 GCAGCTGGTTGAGCCCATAAGGG - Intergenic
1139370273 16:66463215-66463237 GCTGCTTTGTGAACACAGACTGG - Intronic
1140614653 16:76647542-76647564 GCTGCTGCTAGAACTAATACGGG - Intergenic
1140626857 16:76804573-76804595 GCTGCTGGATGAAGACAGACTGG - Intergenic
1140900965 16:79367317-79367339 GCTGCTGGTTGAAGTCACAGGGG + Intergenic
1141395313 16:83699300-83699322 GCTGTTTGTTGAACAAATGCAGG - Intronic
1144640770 17:16935396-16935418 GCTGCTGGGTGACCTCATGCAGG - Intronic
1162578592 19:11513921-11513943 GCAGCTGGTTGTACACAGCCAGG + Exonic
1163047040 19:14650822-14650844 GCTTCTGGGTGAACCCAAACCGG + Intronic
1164043039 19:21510543-21510565 GCTGCTGGTTGACCACTTTATGG + Intronic
1164412876 19:28020463-28020485 GCTGCTGCTTTAAACCATACAGG + Intergenic
1165331118 19:35141546-35141568 GCTGCTGGTTGAACTTGCACCGG - Exonic
1167051788 19:47083847-47083869 GCTGCCGGCTGAACTAATACTGG + Intronic
925246285 2:2386371-2386393 CCTGATGGTTGAACTCTTACAGG + Intergenic
927312467 2:21646769-21646791 GCTGCTGGTTGAGCCCACATAGG + Intergenic
929123161 2:38500008-38500030 GCTGCTGGCGGATCACATGCCGG - Intergenic
932759534 2:74430316-74430338 GCAGCTGGGGGAACACATCCAGG - Exonic
936918067 2:117660295-117660317 TATGCAGGTTGAACACATTCGGG + Intergenic
940033857 2:149292569-149292591 GCTGATGGCTCAGCACATACTGG + Intergenic
940268313 2:151863416-151863438 GCTGCTGGATAGAAACATACAGG + Intronic
941560074 2:167033928-167033950 GCTGAAGGTTGAAAACACACTGG + Intronic
1171290338 20:23979448-23979470 GCTGCAGGGAGGACACATACAGG - Intergenic
1173204738 20:40983858-40983880 ACTGCTGGGTGGACACAAACTGG - Intergenic
1173374646 20:42472416-42472438 GCTGCTGGTTGAACACATACTGG + Exonic
1175403873 20:58714988-58715010 GCTGCTGGCTGGACACGTTCAGG - Intronic
1176699873 21:10032974-10032996 GCTGCAGGTTGTACAAAAACAGG - Intergenic
1177340589 21:19795074-19795096 GCTCCTGGTTTAAAACTTACAGG + Intergenic
1179089231 21:38248773-38248795 CCTGCTGGTTGCACTCAGACAGG - Intronic
1181005892 22:20013367-20013389 GCTGGTGGGTGACCACACACAGG - Intronic
1181401650 22:22653423-22653445 GCTGCAGGGAGGACACATACAGG + Intergenic
1181703608 22:24634520-24634542 GCTGCAGGGAGGACACATACAGG + Intergenic
1184061745 22:42087238-42087260 GATACTCATTGAACACATACAGG + Intronic
949555035 3:5145450-5145472 GCTACTGCTTGTACACATTCGGG + Intronic
950139711 3:10607154-10607176 GAAGCTGGTTGACCACGTACTGG + Intronic
950441800 3:13014886-13014908 GCTCCTGGGGGGACACATACTGG + Intronic
950911294 3:16595914-16595936 GCTACTGATTGAAAACATATAGG + Intronic
953179368 3:40582039-40582061 GCTGTTGGTTGAAGTCACACTGG + Intergenic
953811346 3:46115486-46115508 GCTACTGCTTGCACACATTCAGG + Intergenic
954786370 3:53095794-53095816 GGTGCTGGTTGAATACATCAAGG + Intronic
957837568 3:85617498-85617520 GCTTCTGGATGAACACATGGAGG - Intronic
958075693 3:88674786-88674808 GCTTCAGTTTGAACACATAGAGG - Intergenic
959692668 3:109216536-109216558 GCAGCTGCTTGAACACGTAATGG + Intergenic
963118425 3:141754139-141754161 GCTGCTGCTTAAACAGATAAGGG + Intergenic
967536866 3:190614859-190614881 GGTGATCTTTGAACACATACTGG + Intronic
968738601 4:2314328-2314350 GCTGCTGTTTCAACCCAGACTGG + Intronic
972688979 4:41378191-41378213 GCTGCTGGAAGAAGACACACTGG + Intronic
973172263 4:47160451-47160473 ACTGCTCGTTTAACACATAAAGG - Intronic
973573854 4:52266309-52266331 GCTGCTGGTGGAAAAAATGCAGG - Intergenic
974598152 4:64039471-64039493 GCTTCTGGTGGAACACCTAATGG - Intergenic
980372284 4:131891582-131891604 GCTGCAGGTTGTACAAAAACAGG - Intergenic
981228452 4:142324349-142324371 GCTGTTGGTTGAAAACACAGAGG - Intronic
982720096 4:158850378-158850400 GCTGCTTGATGAACATCTACTGG - Intronic
988949300 5:36241543-36241565 GCTGCTGCTCGAACTCGTACCGG + Exonic
992199429 5:74369109-74369131 TCTGCTGGAGGAACACATGCAGG + Intergenic
1001767338 5:174260949-174260971 GCTGCTGCTTGAATACTTCCAGG - Intergenic
1007765397 6:44156844-44156866 GCTGGTGGTTGGACAAATATTGG + Intergenic
1008885422 6:56427511-56427533 TATGCTGGTTGAACAGAGACAGG - Intergenic
1011693340 6:89889322-89889344 GCTGCTGGTTGCAGATATAAAGG - Intergenic
1017881373 6:158564933-158564955 GCTGCTTGTTCAACTCATGCCGG - Intronic
1018258755 6:161949069-161949091 GCTGCTGGATGAACAGAGCCTGG + Intronic
1018275561 6:162126757-162126779 ACTGTTGGTTGAACAGACACTGG - Intronic
1022958054 7:35399404-35399426 GCTGCAGGCTGAGCACATCCAGG + Intergenic
1023167162 7:37354364-37354386 GCTGCTGCTTGAAGAAATGCCGG - Intronic
1024391989 7:48825374-48825396 GCTGCTTGTTGTTCACATAAGGG - Intergenic
1024855902 7:53778991-53779013 GCTGCTGGTTCAATACATGTTGG - Intergenic
1025935584 7:66033538-66033560 ACTCCTGGTTTAAGACATACAGG - Intergenic
1027153555 7:75750419-75750441 GCTCCTGGTTCAACCCATAGAGG - Intergenic
1040805060 8:51385961-51385983 GCTGCTTGATAAACACATACTGG - Intronic
1042768855 8:72356812-72356834 GCTGCTGGTGGAGTACATTCAGG + Intergenic
1043466243 8:80510155-80510177 GATGCTGGTTTAACACAGAGTGG + Intronic
1046524701 8:115369608-115369630 GCTGCAGGTTGAACAAATTTTGG - Intergenic
1047252172 8:123188958-123188980 GCTGGTGATTGAACAGAGACAGG - Intronic
1049488222 8:142877352-142877374 GCTGCAGCTCGAACACAAACAGG - Intronic
1049493111 8:142915375-142915397 GCTGCAGCTCGAACACAAACAGG - Intronic
1050188656 9:3001815-3001837 GCAGATGGTTAACCACATACAGG - Intergenic
1051041208 9:12814129-12814151 GCTGCTTGTTAAACATTTACTGG + Intronic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1053637019 9:40019443-40019465 GCTGCAGGTTGTACAAAAACAGG - Intergenic
1053769015 9:41445475-41445497 GCTGCAGGTTGTACAAAAACAGG + Intergenic
1054317846 9:63616226-63616248 GCTGCAGGTTGTACAAAAACAGG - Intergenic
1056489984 9:87096401-87096423 GCTGCATGTTGAAAACATGCTGG - Intergenic
1062027097 9:134345576-134345598 GCTCCTGGATGAACACCTAGTGG - Intronic
1202784885 9_KI270719v1_random:3033-3055 GCTGCAGGTTGTACAAAAACAGG - Intergenic
1189146388 X:38659350-38659372 GCTGGTGGTTTATCAGATACAGG + Intronic
1194993909 X:100572874-100572896 GCTACTGCTTGCACACATTCTGG + Intergenic
1195944384 X:110193297-110193319 GCTGCTAGTTGAATATATCCAGG - Intergenic
1196725194 X:118889156-118889178 GCTACTGCTTGCACACATTCAGG - Intergenic
1200690966 Y:6306173-6306195 GCTGATGGTGGAAGACATAATGG + Intergenic
1201044306 Y:9868543-9868565 GCTGATGGTGGAAGACATAATGG - Intergenic
1202115566 Y:21467032-21467054 GCTGATGGTGGAAGACATAATGG - Intergenic