ID: 1173374906

View in Genome Browser
Species Human (GRCh38)
Location 20:42474561-42474583
Sequence CAGGGTCACCCATTTGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173374906_1173374910 9 Left 1173374906 20:42474561-42474583 CCCAAATCAAATGGGTGACCCTG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1173374910 20:42474593-42474615 CATTGAACAAGCTGTTGCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 178
1173374906_1173374913 25 Left 1173374906 20:42474561-42474583 CCCAAATCAAATGGGTGACCCTG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1173374913 20:42474609-42474631 GCTGAGGGCCTATTGTGGAATGG 0: 1
1: 0
2: 0
3: 5
4: 133
1173374906_1173374911 10 Left 1173374906 20:42474561-42474583 CCCAAATCAAATGGGTGACCCTG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1173374911 20:42474594-42474616 ATTGAACAAGCTGTTGCTGAGGG 0: 1
1: 0
2: 0
3: 33
4: 208
1173374906_1173374914 29 Left 1173374906 20:42474561-42474583 CCCAAATCAAATGGGTGACCCTG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1173374914 20:42474613-42474635 AGGGCCTATTGTGGAATGGAAGG 0: 1
1: 0
2: 10
3: 165
4: 1512
1173374906_1173374912 20 Left 1173374906 20:42474561-42474583 CCCAAATCAAATGGGTGACCCTG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1173374912 20:42474604-42474626 CTGTTGCTGAGGGCCTATTGTGG 0: 1
1: 0
2: 0
3: 13
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173374906 Original CRISPR CAGGGTCACCCATTTGATTT GGG (reversed) Intronic
901666907 1:10831290-10831312 CAGGGTTACCCATCTGCTTGAGG + Intergenic
902322843 1:15680957-15680979 CAGAGTCACCCTTTTTTTTTTGG + Intergenic
903164871 1:21513240-21513262 CAGGGTCACACAATTGCTTAGGG + Intronic
905092983 1:35444518-35444540 CAAGGTCACACAGTTGATTATGG + Intronic
907163034 1:52385457-52385479 GAGGTCCACCCATGTGATTTGGG - Intronic
912031847 1:105256551-105256573 CAGGATCACCCGATTGAGTTGGG - Intergenic
912921755 1:113875078-113875100 CAGGGTCATTGATTTGATATGGG + Intergenic
913972149 1:143423622-143423644 GAGGGTCACCCATCTGACTCCGG - Intergenic
914066530 1:144249235-144249257 GAGGGTCACCCATCTGACTCCGG - Intergenic
914112623 1:144717119-144717141 GAGGGTCACCCATCTGACTCCGG + Intergenic
917753642 1:178077521-178077543 CATGGTAACCGATTAGATTTTGG + Intergenic
919104935 1:193137711-193137733 CAGAGTCAACAATTTCATTTTGG - Intronic
923212865 1:231821519-231821541 CAGGATAACACATTTGAATTCGG + Intronic
924622632 1:245675356-245675378 AAGGATCAACCATGTGATTTAGG - Intronic
1065905756 10:30249618-30249640 CAGTCTCACCCATCAGATTTTGG + Intergenic
1066028388 10:31390000-31390022 CAGGGTCATCCAGTGGATTTTGG - Intronic
1066332563 10:34440773-34440795 CAGCATCACTCATTTGCTTTTGG - Intronic
1066452930 10:35547891-35547913 GAGGGTCACCCAACTAATTTGGG + Intronic
1073051788 10:100671732-100671754 CAGGGCCACCCAATTAATTAAGG - Intergenic
1074354298 10:112768491-112768513 CAGTTTCACCCATTACATTTGGG + Intronic
1075718426 10:124570417-124570439 TAGGGTCACACCTCTGATTTGGG - Intronic
1076261008 10:129066246-129066268 CACCGTCATCCATTTGATTTGGG + Intergenic
1078248376 11:9596940-9596962 CAGGGGCACCTATATGATCTGGG + Intergenic
1082267446 11:50134802-50134824 CGGGGTCACACATGTGACTTAGG + Intergenic
1082288641 11:50343764-50343786 CGGGGTCACACATGTGACTTAGG - Intergenic
1082719963 11:56661987-56662009 CAGGATCAGCCATTGAATTTGGG - Intergenic
1086205698 11:84255667-84255689 CTGAGTCACCAGTTTGATTTAGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1092915733 12:13187366-13187388 GAGGGGCACACATTGGATTTTGG + Intergenic
1093698719 12:22193346-22193368 GAGCGTCACCCATTTAATTCTGG + Intronic
1095289029 12:40454357-40454379 CATGGGAACCCATTTCATTTTGG + Intronic
1097690901 12:62733726-62733748 TAGAGTAACCCATTTGATTTAGG + Intronic
1099739018 12:86606861-86606883 CAGAGTGACACATTAGATTTAGG + Intronic
1102045994 12:109830690-109830712 CAGTTTCCCCCATTTGACTTTGG - Intronic
1105350005 13:19606429-19606451 CAGGGACACCCTTTTGTCTTGGG - Intergenic
1105644480 13:22302806-22302828 CAGTGTCTCCCATTTGGATTGGG - Intergenic
1106936893 13:34732321-34732343 GAGGGTCCCCCAAATGATTTTGG + Intergenic
1107273441 13:38648332-38648354 CAGGGCCACCCAAGTTATTTAGG - Intergenic
1108823492 13:54382331-54382353 CAGAGTCACATATTTTATTTAGG - Intergenic
1114444767 14:22780005-22780027 CAGGGTTCCCCATTTGACATAGG + Exonic
1114792755 14:25678377-25678399 CCTGGTCAACCATCTGATTTTGG + Intergenic
1116373783 14:44171166-44171188 CAGGGAAACCCATTACATTTGGG - Intergenic
1117723006 14:58645906-58645928 CAGGGGCACCCTCTTGCTTTCGG - Exonic
1119090583 14:71777381-71777403 CAGGTCCATACATTTGATTTTGG + Intergenic
1119503373 14:75150292-75150314 CAGGATTACACATTGGATTTGGG - Intronic
1120454154 14:84710365-84710387 AAGGGTCACCCTTTTGGCTTTGG + Intergenic
1122371579 14:101231920-101231942 CAGGGTCACACTTCTGATTCAGG + Intergenic
1122825796 14:104369806-104369828 CAGGGTCACCCTGCAGATTTTGG - Intergenic
1125469152 15:39985690-39985712 CAGGGCCACCCAGTTGCCTTAGG - Intronic
1125530207 15:40408265-40408287 TAGGCTCACCCAGGTGATTTGGG + Intronic
1126357390 15:47811132-47811154 TAGGATCACACATTTGAATTTGG - Intergenic
1127253497 15:57267625-57267647 CAGCGATACCCATTTGACTTTGG - Intronic
1127635733 15:60867827-60867849 CAATGTCTCCCATTTTATTTTGG + Intronic
1127653192 15:61029410-61029432 CAGTGCCACCCATTGCATTTAGG - Intronic
1128849431 15:70937941-70937963 AAGGGTCACTCATTTTTTTTAGG + Intronic
1131379539 15:91952693-91952715 CAGAGTCACCCTATTGATTTCGG - Intronic
1139178975 16:64723439-64723461 CAGGGTCTACCATGTCATTTGGG - Intergenic
1140231951 16:73124629-73124651 CAGGGTCACACATCTGTATTAGG + Intergenic
1140487909 16:75308705-75308727 CAAGGTTCCCCATTTAATTTGGG + Intronic
1140801605 16:78493361-78493383 CAGGCTTACCCAGTTCATTTAGG + Intronic
1143254333 17:5544388-5544410 GAGGGTCTCCCATCTGCTTTAGG + Intronic
1154490729 18:14919999-14920021 CAGGCTCAGCCACTTGATGTGGG + Intergenic
1157784764 18:50471696-50471718 CAGGGTCACCCAGTTGGTTAAGG - Intergenic
926120245 2:10237804-10237826 CAAGGTCACCCATCTGGTGTTGG + Intergenic
929662225 2:43798493-43798515 GAGGGTCACACATTTAATTCTGG + Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
933583449 2:84153371-84153393 CAAGGTCAACCTTTTCATTTAGG - Intergenic
934176846 2:89584559-89584581 GAGGGTCACCCATCTGACTCCGG - Intergenic
934287153 2:91658919-91658941 GAGGGTCACCCATCTGACTCCGG - Intergenic
934881515 2:97984897-97984919 CAGGGATACCCATTGGACTTGGG - Intronic
936473170 2:112816571-112816593 CAGGGTAACCCAAGTGATTTTGG + Intergenic
942677523 2:178444056-178444078 TAGGTTCACTGATTTGATTTAGG + Intronic
942751615 2:179294087-179294109 AAGGTTCATCCATTTCATTTTGG + Intergenic
947712074 2:232321981-232322003 CAGGGTCACCCATCTGAACCTGG - Intronic
947731315 2:232433100-232433122 CAGGGTCACCCATCTGAACCTGG - Intergenic
947820127 2:233063548-233063570 CAGTGCCACCCATGTGACTTAGG + Intronic
1173374906 20:42474561-42474583 CAGGGTCACCCATTTGATTTGGG - Intronic
1177775375 21:25561301-25561323 CTGGAGCAGCCATTTGATTTTGG - Intergenic
1177928547 21:27250067-27250089 GAGAGTCACCCAGTTGACTTGGG - Intergenic
1180814133 22:18779087-18779109 CAGGGTCACCCACTGGACTGGGG + Intergenic
1181616676 22:24059850-24059872 CAGGGTCTCCTATTTACTTTGGG - Intronic
1183027976 22:35080470-35080492 CAGGGACAACAATTTGGTTTTGG - Intronic
1184381519 22:44147697-44147719 CAGGGTCAGCCCTTTCATTCTGG + Intronic
1203264231 22_KI270734v1_random:4774-4796 CAGGGTCACCCACTGGACTGGGG + Intergenic
949473552 3:4420913-4420935 CAGGGTCACCCAGCTAATGTTGG - Intronic
949910175 3:8897636-8897658 GAGAGACACCCATTTGATTCTGG - Intronic
955669326 3:61386051-61386073 AAGGGTCACACATTTGCCTTAGG - Intergenic
958103837 3:89048173-89048195 CAGCATTATCCATTTGATTTTGG + Intergenic
959618775 3:108377776-108377798 CAGGGTAACCAACTCGATTTGGG + Exonic
961744593 3:129056305-129056327 CAGGGTTACCCATTTCCTGTTGG + Intergenic
966705719 3:182911478-182911500 CAAGGTCACCCACTTAATCTGGG - Intronic
977384160 4:96317206-96317228 CAGGGACACTCATTCTATTTGGG - Intergenic
978794977 4:112700020-112700042 CAGGGCCAGACATCTGATTTGGG + Intergenic
979762908 4:124428980-124429002 CAGGGTCTCTCACTTGAATTTGG - Intergenic
984747336 4:183234484-183234506 AAGGGTCACAGATTTTATTTAGG + Intronic
987918179 5:24243243-24243265 CAGGCTCACCCAGTTTATCTAGG + Intergenic
988521110 5:31946368-31946390 CAGGTTCACACAATAGATTTTGG - Intronic
988779951 5:34511482-34511504 CAGTGTCACCCAGGTGATCTGGG - Intergenic
995633030 5:114154491-114154513 CAGGCTCAGAAATTTGATTTTGG + Intergenic
997475143 5:134138388-134138410 CGGGGTCACCCATGGGATTTAGG - Intronic
998065761 5:139157020-139157042 CAGGGTCACCCATCAGATAGTGG - Intronic
999932801 5:156452027-156452049 CATGGTCACACAGTTGACTTAGG + Intronic
1000843128 5:166246618-166246640 CAGAGTCACTTCTTTGATTTGGG + Intergenic
1003349073 6:5298621-5298643 CAGTGTAACACATTTGATGTGGG + Intronic
1003485943 6:6579781-6579803 CAGGGTCAGTCATTTGATGAAGG - Intergenic
1004506769 6:16253399-16253421 TAGTGCCACCCATTTGCTTTTGG + Intronic
1012425498 6:99109690-99109712 CAGGATCACCAATTTGATAGGGG - Intergenic
1012502482 6:99904452-99904474 CAGTGCCACGCATTTGGTTTTGG - Intergenic
1017907939 6:158769601-158769623 CAGGGTCACCCATTGAAGGTGGG - Intronic
1019655778 7:2194279-2194301 CAGGGCTAGCCATTTAATTTTGG - Intronic
1019927433 7:4202582-4202604 GAAGGTCATCCATTTGATCTGGG - Intronic
1023243530 7:38176438-38176460 CATAGTTACACATTTGATTTTGG - Intergenic
1031167113 7:118242036-118242058 CAGGCTCACTCATTTTATTTTGG + Intronic
1031262170 7:119534560-119534582 CAGGGTGACACACTTGCTTTAGG + Intergenic
1036274578 8:7339232-7339254 CTGGCTCGCCCATTTTATTTTGG + Intergenic
1036346774 8:7971114-7971136 CTGGCTCGCCCATTTTATTTTGG - Intergenic
1036725572 8:11217839-11217861 CAGGGTCACCTAGGTGATGTGGG - Intergenic
1036825728 8:11974426-11974448 CATGGTGGCCCATTTGATATTGG + Intronic
1036842102 8:12131868-12131890 CTGGCTCGCCCATTTTATTTTGG - Intergenic
1036863931 8:12378118-12378140 CTGGCTCGCCCATTTTATTTTGG - Intergenic
1038586317 8:28792509-28792531 CAGGGTAACACATTGCATTTAGG - Intronic
1039475519 8:37837547-37837569 CAGGGTCCCCCATTAGACTGAGG + Intronic
1041082663 8:54228135-54228157 CAGGCTCCTCCATCTGATTTGGG - Intergenic
1042395436 8:68286247-68286269 GAGAGACTCCCATTTGATTTAGG + Intergenic
1042972450 8:74425088-74425110 CAGGCACACACATTTGGTTTGGG + Intronic
1045942633 8:107756315-107756337 CAGAGGCACCGAGTTGATTTGGG + Intergenic
1048376902 8:133830746-133830768 CAAGGTCACACATTTGATAAGGG - Intergenic
1049309683 8:141927085-141927107 CAGGGGCACCCCTTGGATTGAGG - Intergenic
1049992547 9:1003553-1003575 CAGGGTCACACAGTTGCTGTGGG + Intergenic
1190973907 X:55380633-55380655 CAAGGTCACCAATGTGTTTTAGG - Intergenic
1195919439 X:109968057-109968079 CAGGGCCACCCAGATGATCTAGG - Intergenic
1196604367 X:117639757-117639779 AAGGGACACTCTTTTGATTTTGG - Intergenic
1199205099 X:145139563-145139585 AGGGATCACCCATTGGATTTTGG - Intergenic
1199504301 X:148544140-148544162 CAGGGCCACCCATTTGCCTCAGG + Intronic