ID: 1173376125

View in Genome Browser
Species Human (GRCh38)
Location 20:42484895-42484917
Sequence GGAAGCAGAATGTGGCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173376125 Original CRISPR GGAAGCAGAATGTGGCAGCT AGG (reversed) Intronic
901147438 1:7075566-7075588 GGAACCAAAATGTGACAGCAGGG - Intronic
901722152 1:11207789-11207811 GGAAGTAAATTGTGGGAGCTGGG - Intronic
904376269 1:30084355-30084377 GGGAGCAGAAGGTGGGAGCACGG + Intergenic
904406498 1:30293461-30293483 GGTAGCAGATTGTGGGAGCCAGG + Intergenic
905879549 1:41454717-41454739 AGAAGCAGAGCTTGGCAGCTGGG - Intergenic
906267928 1:44448496-44448518 GGCATCAGAAAGTTGCAGCTTGG - Intronic
909909204 1:81240766-81240788 GGAAGCAGATTGAGGAAGCAGGG - Intergenic
911664235 1:100535900-100535922 GGCAACACAAAGTGGCAGCTGGG + Intergenic
912570620 1:110618516-110618538 GGAGGTAGGATGAGGCAGCTTGG + Intronic
912921532 1:113872059-113872081 GGAAACAGAAGGTGTCAACTTGG - Intergenic
914246853 1:145892566-145892588 GGAAGCAGAGGGTGGGAGCATGG + Exonic
915314917 1:155023087-155023109 GGAAGCAGGAGTTGGCACCTGGG - Intronic
917122206 1:171654703-171654725 GGAAGGAAAATGTGGCTGTTGGG + Intergenic
917355653 1:174124224-174124246 GGAAGCAGAATGTAAAAGTTGGG + Intergenic
917965077 1:180173582-180173604 GGGAGCAGAAGGTTGCAGATGGG + Intronic
919217341 1:194575592-194575614 GCAAGCAGAAGATGGCATCTAGG + Intergenic
920505835 1:206514517-206514539 GGGAGCAGAAGGTGGCACATAGG - Intronic
921213744 1:212920599-212920621 TGTAGCAGCATGCGGCAGCTCGG - Intergenic
922248443 1:223823397-223823419 GGTTGCAGAATGTGGAGGCTTGG - Intronic
923427974 1:233891118-233891140 GGAAGCAGAATATAACAGTTTGG + Intergenic
1062945101 10:1454644-1454666 GGAAGCAGAGGGTGGTTGCTGGG + Intronic
1063391761 10:5654252-5654274 GTGAGCAGAGTGTGGAAGCTTGG - Intronic
1065867782 10:29928626-29928648 GGAAGCGGCATGTGTTAGCTTGG - Intergenic
1067057480 10:43060707-43060729 AGAAGCAGAGTGGGGCAGGTCGG + Intergenic
1067605188 10:47655539-47655561 GAAACCAGAAGGTGGCTGCTGGG + Intergenic
1068374737 10:56164374-56164396 GGAAGCAGAGTGTGAAAGTTTGG + Intergenic
1068604421 10:58989884-58989906 GGAAGCAGAGTGTAAAAGCTTGG + Intergenic
1070625450 10:78047808-78047830 TGAAGCAGAATCGGGCTGCTGGG - Intronic
1071007690 10:80901637-80901659 GGAAACAGAAGGTGACAGCAAGG + Intergenic
1071422462 10:85514232-85514254 GGAAGCAGGCAGAGGCAGCTTGG - Intergenic
1071620746 10:87116938-87116960 GAAACCAGAAGGTGGCTGCTGGG + Intronic
1073308659 10:102523664-102523686 GGAATGAGAAATTGGCAGCTTGG - Intronic
1074500178 10:114016741-114016763 GGAATAAGAATGTGGCCTCTGGG - Intergenic
1075797514 10:125131194-125131216 GGATTCAGAACGTAGCAGCTGGG + Intronic
1075920918 10:126211982-126212004 GGAGGCAGAATGTGGGTGATGGG + Intronic
1076533468 10:131160630-131160652 AGAAGCAGAACAAGGCAGCTTGG - Intronic
1076848120 10:133080057-133080079 GGAACCAGGCTGAGGCAGCTGGG + Intronic
1077178338 11:1200648-1200670 GGAGGCAGAGAGTGGGAGCTGGG + Intronic
1077300907 11:1846513-1846535 GGAGGCAGGAGGTGCCAGCTGGG - Intergenic
1078169044 11:8914598-8914620 GGAGGCAGCAGGTGGCAGCACGG + Intronic
1079275261 11:19029686-19029708 GGAAGCAGACTGAGGCAGTGAGG - Intergenic
1079610168 11:22423098-22423120 GGAAGCAGAATGCTGCAGCCTGG - Intergenic
1080532033 11:33186109-33186131 GATTGCAGAATGTGGCAGGTGGG - Intergenic
1080691754 11:34564430-34564452 GGAAGCAGTATCTGGGTGCTTGG - Intergenic
1081001022 11:37671709-37671731 AGAAGCAGAATGTGGGAACTGGG + Intergenic
1081441543 11:43086279-43086301 GGAAGCAGAATGTAAAAGTTTGG - Intergenic
1082835695 11:57648908-57648930 GCATGGAGAATGGGGCAGCTTGG + Exonic
1083558642 11:63654074-63654096 TGAAGGAGAATGTGGGAACTGGG + Intronic
1083773974 11:64884157-64884179 GTGAGAGGAATGTGGCAGCTGGG - Intronic
1083998998 11:66285874-66285896 GGAAGCAGAATGTGGAGGTCAGG - Intronic
1084208127 11:67607685-67607707 ACAAGCCGAGTGTGGCAGCTTGG - Intronic
1084835168 11:71796741-71796763 GGCAGCAGTCTGTGGGAGCTCGG - Intronic
1084933923 11:72576933-72576955 GTGAGCAGAGTGTGGCATCTTGG - Exonic
1084969668 11:72764244-72764266 GGAAGGAGGATGGGGCAGCATGG - Intronic
1086607199 11:88709940-88709962 GGAAGCTGGAAGAGGCAGCTTGG - Intronic
1088084926 11:105966025-105966047 CAAAGGAGAATGTGGCAGCGGGG + Intronic
1088621500 11:111689078-111689100 AGAAGCAGAATGTTGCAGGCAGG + Intronic
1088793746 11:113249516-113249538 TGAAGAAGAATGTGGCTCCTGGG - Intronic
1089135806 11:116248077-116248099 AGAAACAGAATGTGGAAGCTGGG - Intergenic
1089770957 11:120802597-120802619 GGAAGAGGAAGGTGGCAGCAGGG + Intronic
1090670733 11:128943388-128943410 GGAAGCAGAGTGTGGGAAGTTGG - Intronic
1095279113 12:40328869-40328891 GGAAGCAGGTGGAGGCAGCTAGG - Intronic
1100372694 12:93983051-93983073 GGAAGGAGAAAGTGGCACTTGGG + Intergenic
1100434594 12:94560309-94560331 GGAAGCAAAATGTTTCAGATGGG + Intergenic
1100728766 12:97440536-97440558 GGAAGCAGCCTGTGGCAGTATGG + Intergenic
1100831958 12:98524498-98524520 GGAGGCAGAAGGTTGCAGCAAGG + Intronic
1101878838 12:108612998-108613020 GGCAGCAGAAGGCTGCAGCTTGG - Intergenic
1102505460 12:113381638-113381660 GGAAGGGGACTGAGGCAGCTGGG + Intronic
1102913245 12:116734973-116734995 GGAAGCAGAGACTTGCAGCTGGG + Intronic
1103369588 12:120408731-120408753 GGAATAAGGAAGTGGCAGCTGGG + Intergenic
1104061257 12:125270495-125270517 GGAAGTGGAATGGGGCAACTGGG + Intronic
1104437245 12:128765925-128765947 GGAAGCAGACTGTGCCGGCAGGG - Intergenic
1105443901 13:20436440-20436462 GGGAGGAGAATGTGACGGCTGGG - Intronic
1107707632 13:43123090-43123112 GGAAGCCAAATGGGGCAGATGGG + Intergenic
1107879690 13:44822241-44822263 GGAAGGAGAATGTGTAAGCAAGG - Intergenic
1107996319 13:45864669-45864691 GGCAGAAGAATGCGGCAGCAAGG + Intergenic
1111271818 13:85896366-85896388 GGGAGCAGAATTTGGCACCCAGG - Intergenic
1112229864 13:97578684-97578706 AGAAGCAGCAGGTGGCAGATTGG - Intergenic
1113067869 13:106390064-106390086 GGAAGAAGAATATGGAAGCCAGG + Intergenic
1113708899 13:112451658-112451680 GGAGGCAGAAGGTGGGAGGTGGG + Intergenic
1113825430 13:113249076-113249098 GGAAGCAGATAGTGGCTGCCGGG - Intronic
1114849396 14:26365500-26365522 GGAAGAAGAAGGTGGCATGTTGG + Intergenic
1115121321 14:29941406-29941428 GGAAGCAGAAAGTAAAAGCTTGG + Intronic
1115889601 14:38011990-38012012 GGAAGCAGAATGTAAAAGATTGG + Intronic
1117203620 14:53418156-53418178 GGAAGCAGAGTGTATAAGCTTGG + Intergenic
1117289093 14:54315234-54315256 GGAGGCAAAATGTGGCTGGTAGG + Intergenic
1118589527 14:67391046-67391068 GGAGGCAGCAGGTGTCAGCTGGG + Intronic
1118607115 14:67512650-67512672 GGCAGTAGAGTGAGGCAGCTTGG - Intronic
1121846767 14:97178966-97178988 GGAAGCAGGATGTGGCTTCAGGG + Intergenic
1127475637 15:59330030-59330052 TGAAGCAGAATATTGAAGCTGGG - Intronic
1128115242 15:65101233-65101255 GGCAGCAGAAGGTGGCAGCGGGG - Intronic
1130571517 15:85049369-85049391 GAAAGCAGAATGTGTTTGCTAGG - Intronic
1131083177 15:89554131-89554153 AGAACCAGAGTGTGGCAGCCAGG - Intergenic
1131623223 15:94089468-94089490 GGAAGCAGGATGGGGCAGGTGGG + Intergenic
1132141334 15:99399161-99399183 GGAAGACGAGTGTGGCAGCAGGG + Intergenic
1132469254 16:92804-92826 AGAAGCAAAGTGTGGCAGGTGGG + Intronic
1133327400 16:4950090-4950112 GAAAGGAGACTGTGGCTGCTGGG + Intronic
1133385186 16:5364071-5364093 AGAAGCAGAAACTGGCAGCCAGG + Intergenic
1134181136 16:12048655-12048677 GGAATCAGAATGTGGCGGATGGG + Intronic
1135307871 16:21382410-21382432 GGAATCAGAATGTGGCTGATGGG + Intergenic
1136304616 16:29361530-29361552 GGAATCAGAATGTGGCTGATGGG + Intergenic
1138389455 16:56659433-56659455 GGAAGCACAGTGAGGCAGCCTGG - Intronic
1138569720 16:57862066-57862088 GGAAGCGAATTCTGGCAGCTGGG + Intronic
1139262285 16:65606274-65606296 GGAAGCACAGTTTGGCAGCATGG - Intergenic
1142032394 16:87845054-87845076 GGAAGGGGAAGGTGGCACCTTGG + Intronic
1142072539 16:88099129-88099151 GGAAGCAGAAGGAGCCAGATGGG + Intronic
1142491081 17:280184-280206 CGAAGCAGACAGAGGCAGCTGGG + Intronic
1142636226 17:1259468-1259490 GGGAGCAGAGTGTGGGAACTGGG + Intergenic
1146110549 17:30085106-30085128 GGAAGCAGATTGCCACAGCTGGG - Intronic
1147332880 17:39709262-39709284 GGAAGCAGAAGGTGACAGAAGGG + Intronic
1147586647 17:41656974-41656996 GGAAGGGGCATGTGGCAGCGGGG - Intergenic
1148216445 17:45836197-45836219 GGAAGCAGAATTAGGATGCTGGG + Intergenic
1149303982 17:55331139-55331161 GGAAGCAGAAGTGGGCAGGTAGG - Intergenic
1150757831 17:67931634-67931656 GGAAGGAGCATGTGCCAGCGAGG - Intronic
1151081118 17:71329950-71329972 GAAAACAGAACCTGGCAGCTGGG - Intergenic
1151684137 17:75636901-75636923 GGAAGCTGAATTTGCCAGCCAGG - Exonic
1152205113 17:78970476-78970498 GACAGCAGACTGTGGAAGCTGGG - Intergenic
1152459368 17:80433147-80433169 AGAAGCACAGTGTGGAAGCTGGG + Intronic
1152765624 17:82136389-82136411 GGAGGCAGAATGTGGGTGCTGGG + Intronic
1152878310 17:82800972-82800994 TGAAGCCGAAGGTGGCAGCATGG + Exonic
1154350760 18:13581433-13581455 GAAAACAGAATGCAGCAGCTCGG - Intronic
1154396717 18:13997582-13997604 TGAAGCAGGGTGTGGAAGCTGGG + Intergenic
1155166968 18:23239564-23239586 GGAAACAGAGTGGGGCAGTTGGG + Intronic
1155592044 18:27438517-27438539 GGAGGCAGAAGGTGGGAGGTTGG + Intergenic
1156407324 18:36795348-36795370 GGAAAGAGAATGAGCCAGCTGGG + Intronic
1157332219 18:46712322-46712344 GGAAGGAGAAGGAGGCAGCTAGG - Intronic
1158562519 18:58526694-58526716 AGAAGAAGAAAGTGGTAGCTTGG - Intronic
1159942963 18:74422703-74422725 GGAAGCACCATATGGCAACTTGG - Intergenic
1161447005 19:4324068-4324090 GGAAAAAGAATCTGGCCGCTGGG + Exonic
1161637302 19:5396895-5396917 GGAAGCAGGTGCTGGCAGCTGGG + Intergenic
1162398545 19:10431609-10431631 GGAGGCAGAAGTTGGCAGCCCGG + Intronic
1162985322 19:14265811-14265833 GGAAGGAGGATTTGGGAGCTGGG + Intergenic
1163016024 19:14455271-14455293 GGAAATAGAATATGGCAGCCAGG + Intronic
1163734069 19:18967915-18967937 GGAAGCAGAGTGAGGCGGCCTGG - Intergenic
1166682934 19:44779022-44779044 GGAACCAGAATTGGGCTGCTGGG - Intronic
1166783719 19:45355431-45355453 GGCAGCATAATGTGACAGGTGGG - Intronic
1167097483 19:47382097-47382119 GGAAGCAGCACGTGTGAGCTGGG + Exonic
1168156196 19:54474088-54474110 CGGAGCAGAATGGGGAAGCTGGG + Intergenic
925564591 2:5236341-5236363 GGAAGCAGAACTTGGCAGTGGGG - Intergenic
926228199 2:10983313-10983335 GGAAGCAGGATGGAGGAGCTCGG - Intergenic
927177855 2:20422765-20422787 GGGACCAGAAAGAGGCAGCTAGG - Intergenic
927780895 2:25938719-25938741 GGAAGCAGGTTTTGGCAGCCCGG + Intronic
929642456 2:43595631-43595653 GGAAGCAGTAAGTGGGACCTAGG - Exonic
929839412 2:45441899-45441921 GGCATGAGAATTTGGCAGCTTGG - Intronic
929871335 2:45761787-45761809 GGGATCAGAATATGGCAGCGAGG - Intronic
930128174 2:47820653-47820675 GGATTCAAAATGTGGCAGCTCGG - Intronic
930586651 2:53275360-53275382 GGCAACAGAATGTGACAGCCTGG + Intergenic
930700087 2:54450889-54450911 GAAAGCAGATTGTGGCTGCCAGG - Intergenic
933451984 2:82466294-82466316 GGAAGCAGAATGTGGAATGATGG - Intergenic
939249099 2:139662970-139662992 GGAAGTAGAATGTGTAAGTTTGG - Intergenic
939294420 2:140241229-140241251 TGAAAGAGAATCTGGCAGCTTGG + Intronic
939689554 2:145241026-145241048 TGAAGCAAATTGTGGCAGCCAGG + Intergenic
942895462 2:181047980-181048002 GGAAGCACAATGTGGCAGAAGGG - Intronic
943753186 2:191531338-191531360 CGAAGCAGAATGTGGCATTTGGG - Intergenic
945900835 2:215535398-215535420 GGAAGTAGAATGTGGTTGCCAGG + Intergenic
946231064 2:218291663-218291685 GGAAGCAGAGGGAGGCTGCTGGG - Intronic
947582952 2:231333027-231333049 GGAAGCAGAAAGTGCCTGCCAGG + Intronic
948233731 2:236371096-236371118 GGACGCAGAATGTGGTTGCCCGG - Intronic
948277904 2:236724163-236724185 GGAAGGAGAATGTGGGATGTGGG + Intergenic
948838907 2:240639899-240639921 GGAAGCAGAGTGCGGCTGTTTGG - Intergenic
1171174261 20:23039642-23039664 GGAATGAGAATGTGGGAGATGGG - Intergenic
1171358033 20:24565737-24565759 GGAAGGAGAAGGTGGGAGTTGGG - Intronic
1172117391 20:32581174-32581196 GGAAGTAGAAGGTGGAAGCAGGG - Intronic
1172740645 20:37163952-37163974 GGAGGCAGGCTGTGGCAACTGGG - Intronic
1172902903 20:38347781-38347803 GGAGGCAGACATTGGCAGCTGGG + Intronic
1173245857 20:41336954-41336976 GGAAGCTGAATGTGGCAACATGG + Intergenic
1173376125 20:42484895-42484917 GGAAGCAGAATGTGGCAGCTAGG - Intronic
1174990657 20:55505701-55505723 GGAATCAGAGTGTGGATGCTAGG + Intergenic
1175387404 20:58606060-58606082 GGAAGCAGGATGTGGCAGGGAGG - Intergenic
1175679327 20:60974233-60974255 GGCAGCAGCATGAGGCAGCTGGG + Intergenic
1176060547 20:63170671-63170693 GGCAGCTGAATGTGTCTGCTGGG - Intergenic
1176203988 20:63878217-63878239 GGAAGGAGAACGTGGCCGGTGGG + Intronic
1177047211 21:16185296-16185318 GAAAGCAGATTGTGGCTGCAGGG + Intergenic
1177383043 21:20370573-20370595 GGAAGGAGAATATGGCATATTGG + Intergenic
1179049333 21:37875372-37875394 GGAAGCAGGATGGGCGAGCTTGG - Intronic
1179679291 21:43006720-43006742 GGAAGCAGCTTGGGGCAGCGGGG - Intronic
1179819567 21:43929004-43929026 GGAAGCAGAGTGTGCCACCCTGG + Intronic
1180605450 22:17055830-17055852 GGGAGCAGAATGTGAGAGGTGGG + Intergenic
1180956628 22:19744133-19744155 AGAAGCAGCCTGTGGCATCTGGG - Intergenic
1184521196 22:44995245-44995267 GGGAGAAGAGTCTGGCAGCTTGG - Intronic
1184659450 22:45959184-45959206 GGCAGCAGGATGGGGCATCTGGG + Intronic
949756308 3:7414718-7414740 GGATGCAGAATGTGGCATAATGG + Intronic
951992092 3:28686719-28686741 GAAAGCATAATTTGGCAGTTAGG + Intergenic
952796120 3:37240953-37240975 TGAAGCAGAATGTGGCTGTGAGG + Intergenic
952876286 3:37947155-37947177 GGAAGCACACTGGGGCTGCTGGG - Exonic
953083550 3:39644213-39644235 GGGAGCAAAATGCTGCAGCTGGG - Intergenic
953844016 3:46412618-46412640 GGGAGCAGAAGGAGGCTGCTGGG + Intronic
953972657 3:47359252-47359274 GGAAGCAGAATGTGTAAGTTTGG + Intergenic
953993813 3:47504283-47504305 GGAAGCAACACGTGGCAGGTGGG - Intronic
955371216 3:58353863-58353885 GGTAGAAGAATTTGGAAGCTAGG + Intronic
956134889 3:66088875-66088897 TGTAGCAGAATGTGGCAGTATGG + Intergenic
956747934 3:72324217-72324239 GGAAGAGGAAGGTGGCAGGTTGG - Intergenic
958504438 3:94956231-94956253 GGAAGCAGCAAGTGTCAGCGAGG - Intergenic
960353357 3:116620576-116620598 GCAAGAAGAATCTGGCAACTGGG + Intronic
961832090 3:129628217-129628239 GGGAGCAGAATGTTAAAGCTTGG - Intergenic
962267160 3:133952062-133952084 GGAAGGAGAAGGTGGCAGAACGG + Intronic
962320689 3:134388094-134388116 GGAGGGAGAAAGTGGCAGTTTGG - Intergenic
962374019 3:134845631-134845653 GGATGCAGAATGTGGCTGGGTGG - Intronic
964351868 3:155810881-155810903 TGAAGGATAATGAGGCAGCTTGG - Intergenic
965455672 3:168896839-168896861 GGAAGCAGACTGTAAAAGCTTGG - Intergenic
966879379 3:184341376-184341398 GGAAGAAGAGTGTGGCATCCAGG - Intronic
967099055 3:186200959-186200981 GGAAGTAGAATATTGCAGCTGGG + Intronic
967381357 3:188862550-188862572 GAAAGCTCAGTGTGGCAGCTGGG + Intronic
968038601 3:195569547-195569569 GAAGGCAGAATGTGCCAGCCTGG - Intronic
968313161 3:197700776-197700798 GGCAGCAGAATCTGGCTTCTGGG + Exonic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968981024 4:3849416-3849438 GGAAGCAGAAGAAGGCAGTTGGG - Intergenic
969177109 4:5406982-5407004 GGAAGCAGAATGTAAAAGTTTGG - Intronic
969247423 4:5944738-5944760 GGAAACAGAAGAGGGCAGCTGGG + Intronic
972710594 4:41590686-41590708 TGACCCAGAAGGTGGCAGCTGGG - Intronic
972711223 4:41597028-41597050 GGAAGGAGATTGTTGCAGGTGGG - Intronic
974025635 4:56730988-56731010 GGAAGTAGGATTTGGGAGCTGGG + Intergenic
975768707 4:77697853-77697875 GGAATCAGAAAGTGACATCTGGG - Intergenic
977412674 4:96688292-96688314 GGAAGCAGAGTTTGCCACCTAGG - Intergenic
979969196 4:127113872-127113894 GGAAGCAGAATGTAAAAGTTTGG + Intergenic
980211003 4:129787249-129787271 GAAAGCAGAATGTGGCTGAGTGG + Intergenic
981488765 4:145317701-145317723 GGAAGCAGGATGGGGCAGGGTGG - Intergenic
983833660 4:172363157-172363179 TGAAGCAAAATTTGGCATCTTGG - Intronic
984008411 4:174341617-174341639 AGCAACTGAATGTGGCAGCTAGG + Intergenic
984257245 4:177403511-177403533 GTAGGCAGAAAGTGACAGCTGGG - Intergenic
984434871 4:179696587-179696609 GGCAGCAGCATGTTGAAGCTTGG + Intergenic
984707134 4:182855826-182855848 GGGAGCTCAATGTTGCAGCTAGG + Intergenic
986266951 5:6198894-6198916 GGATGCAGAATGTGGGGGCTAGG + Intergenic
987623747 5:20370741-20370763 GTTAGAAGACTGTGGCAGCTGGG + Intronic
990792862 5:59501559-59501581 GGCAGAAGAAAGAGGCAGCTGGG + Intronic
991244877 5:64499793-64499815 GGAAGAGGAATGTGACTGCTGGG - Intergenic
991584480 5:68187970-68187992 TGAATCACAATGGGGCAGCTTGG + Intergenic
992346149 5:75880324-75880346 GGAAGCAGAGTGTGAAAGTTTGG - Intergenic
992617337 5:78557507-78557529 GGAGGCAGAATGTGGTGGCAAGG + Intronic
996239080 5:121171821-121171843 GGAAGCAGAGTGTAAGAGCTAGG - Intergenic
996770481 5:127080418-127080440 TGGAGCAGAGTGTGGCAGCTGGG + Intergenic
997061641 5:130512021-130512043 GGAGGCAGACTGTGTCAGTTTGG - Intergenic
998770617 5:145540513-145540535 GACAACAGAATGTGGCACCTAGG + Intronic
999325393 5:150640563-150640585 GGAAGATGAATCTGGCAGCGTGG + Intronic
999795259 5:154982859-154982881 GGAAGTAGAATGTGGTTGCCAGG - Intergenic
1000270878 5:159681834-159681856 GGAAACAGAATGTGAAAGATTGG - Intergenic
1001084634 5:168691739-168691761 GGGAGAAGAAGGAGGCAGCTGGG + Intronic
1001303778 5:170556608-170556630 GGAGGTGGGATGTGGCAGCTGGG + Intronic
1002617935 5:180467169-180467191 AGAGGCAGGGTGTGGCAGCTTGG + Intergenic
1004565234 6:16789702-16789724 GGAAGCAGAAAGTGAAAGTTTGG - Intergenic
1005996430 6:30934205-30934227 GGAAGCAGGATTTGGAAGCTGGG - Intergenic
1006419992 6:33927054-33927076 GGAAGTAGAATGTGGCAGCTAGG + Intergenic
1007511986 6:42380869-42380891 GGAGGGAGAGTGTGGCAGCCTGG - Intronic
1007525872 6:42492552-42492574 GTAAGAAAAATGTGGCAGGTGGG - Intergenic
1008392683 6:50971146-50971168 GGAAGGAGAAGTTGGGAGCTGGG + Intergenic
1009833818 6:68971962-68971984 GGAGGCAGGATGGGGCAGCAGGG + Intronic
1011090868 6:83597793-83597815 GGAACCAGAATGTGACATTTGGG - Intronic
1011691734 6:89876479-89876501 GGAAGCAGAAAGGGGTATCTGGG - Intergenic
1011701168 6:89956330-89956352 GGAAGCAGTCTGTGGGAGGTTGG - Intronic
1011955997 6:93026003-93026025 GGAAGCAGAGTGTAAAAGCTTGG - Intergenic
1012676776 6:102124271-102124293 GGAAGCAGGAGGCGGGAGCTTGG + Intergenic
1015217151 6:130763241-130763263 GGAAGATGAATGTGGCAGATGGG + Intergenic
1015730603 6:136343647-136343669 GCAAGAAAAATGTGACAGCTGGG + Exonic
1016059525 6:139615175-139615197 GGTGGCAGAATGTGCCACCTGGG + Intergenic
1016904469 6:149135403-149135425 GGAAGCAGGAAGAGGCAGCTAGG - Intergenic
1017257766 6:152353197-152353219 TGCAGGAGAATGGGGCAGCTTGG + Intronic
1018228810 6:161656073-161656095 AAAAGCTGACTGTGGCAGCTCGG + Intronic
1019506435 7:1393774-1393796 GGAGGCAGAGAGTGGCAGCCAGG + Intergenic
1021258590 7:18425645-18425667 GGAAGCAGAAAGTGCCATGTGGG + Intronic
1021447473 7:20748985-20749007 GGAAGCAGGACATGGCAGATTGG - Intronic
1022784690 7:33626878-33626900 GGAAGCAGAGTGTGAAAGTTTGG + Intergenic
1023913679 7:44572769-44572791 TCAGGCAGAATGTAGCAGCTGGG + Intronic
1028244108 7:88455133-88455155 TGAAGCATAATGTGGCAGGAGGG + Intergenic
1029275836 7:99403873-99403895 GGCAGCTGCATGTGGCAGGTGGG - Intronic
1030132763 7:106217173-106217195 GGAAGCAGAAAGTGCCTGCACGG + Intergenic
1031920921 7:127600076-127600098 GCAGGCAGGATGGGGCAGCTAGG + Intronic
1032307005 7:130744014-130744036 GGAAGCCGAATGTGGCAGTCTGG - Intergenic
1032512201 7:132481107-132481129 GGAAGCTGAATCTGCCATCTAGG + Intronic
1032667317 7:134049483-134049505 GGAAACAGAATGTGTGAACTGGG - Intronic
1033434897 7:141324278-141324300 GGTAGCAGAATGTAGCAGCCTGG + Intronic
1033970815 7:147036983-147037005 GAAAGAAGAATTTGTCAGCTAGG - Intronic
1034087793 7:148335963-148335985 GGAAGGAGAATGAGGGAGGTGGG - Intronic
1034602875 7:152279773-152279795 GGGAGGAGAATGTGGCAGAAAGG - Intronic
1036591048 8:10168436-10168458 CCATGCAGAATGTGGCAGCCTGG + Intronic
1036635518 8:10547624-10547646 GGAAGGGGAAGGTGCCAGCTTGG - Intronic
1036933048 8:12974619-12974641 GGAAGCAAAACGTGGCAGTCTGG + Intronic
1041727326 8:61030286-61030308 GGAAAGAGAAGGTGGCAGCGGGG + Intergenic
1043488379 8:80721380-80721402 GGAAGGAGTGAGTGGCAGCTGGG + Intronic
1044321324 8:90804783-90804805 GGAAGCAGAGTCAGGCAGTTTGG + Intronic
1044855197 8:96468336-96468358 AGGAGCAGAATCTGGCAGCATGG - Intergenic
1045012267 8:97968428-97968450 GGAAGCAGAATGTACGAGTTTGG - Intronic
1045069008 8:98480526-98480548 GAAATCATACTGTGGCAGCTAGG - Intronic
1046644247 8:116767393-116767415 GGGAGCAGTATGTGGCATATAGG - Intronic
1047720398 8:127633659-127633681 GGAAGGAGCAGGTGGCATCTGGG - Intergenic
1048234446 8:132675750-132675772 GGAAGCAGTCTGTGGCAAGTCGG - Intergenic
1048261971 8:132952926-132952948 GGAAGCAGAAGGCGGCAGCCAGG - Intronic
1049322672 8:142005307-142005329 GGAAGGAGAGTGAGGCTGCTGGG + Intergenic
1049421185 8:142517368-142517390 GGCAGGAGAGTGTGGGAGCTGGG - Intronic
1049441743 8:142612777-142612799 TGTAGCAGAATGAGGAAGCTGGG + Exonic
1050524620 9:6534675-6534697 TGAATCTGAATGTGCCAGCTGGG - Intronic
1051041503 9:12817872-12817894 GAAAGCAGAGTGCAGCAGCTGGG + Intronic
1053219103 9:36296675-36296697 GGAAGCAGAGGGTGGAAGGTGGG + Intronic
1055503481 9:76924957-76924979 GGAGGCAGAAGATGTCAGCTGGG + Intergenic
1056277065 9:85003768-85003790 GGCAAAAGAATGTGGCAGCTTGG + Intronic
1056846655 9:90044054-90044076 GGAAGAGGAATGGGCCAGCTGGG - Intergenic
1057341657 9:94207522-94207544 GGAGGCAGAATTTGGCAGGGAGG - Intergenic
1058683261 9:107458319-107458341 GGCAGCAGGATGTGGGTGCTGGG + Intergenic
1058694619 9:107548742-107548764 GGAAGCAGAATGAGGAAACGAGG + Intergenic
1058778780 9:108312169-108312191 GGAGGCAGAATTTGGCAGCTGGG + Intergenic
1058967833 9:110053669-110053691 GGAGGCAGAATGCTGCTGCTGGG + Intronic
1059195974 9:112371325-112371347 GGATGTAGAATGAGGCAGCAAGG - Intergenic
1060230418 9:121821559-121821581 GGCAGCAGAAGGTGGCATTTTGG - Intergenic
1060735868 9:126066298-126066320 GGCAGCAGCATGTGGAGGCTGGG - Intergenic
1061210071 9:129186320-129186342 GGAAGCAGAAGGTGGCTTCCAGG + Intergenic
1061252823 9:129436607-129436629 GGAGGGAGACTGAGGCAGCTCGG + Intergenic
1061499525 9:130993933-130993955 GGAAGCAAACTGTGGCCCCTGGG - Intergenic
1062044764 9:134419894-134419916 GGGAGCAGAATGTGGCAGGCTGG - Intronic
1062059803 9:134489049-134489071 GGAAGCAGAAGGAGGGTGCTTGG + Intergenic
1062378155 9:136274269-136274291 GGAGGGTGAATGCGGCAGCTCGG - Intergenic
1062506874 9:136882100-136882122 GGAGGCAGAATGTCCAAGCTGGG - Intronic
1186578390 X:10790611-10790633 GGGAACAGAATGTGGCACCAGGG - Intronic
1187567628 X:20467603-20467625 AAAAGCAGAATGGGGTAGCTTGG + Intergenic
1187655635 X:21469237-21469259 AGAAGCAGCATGTGGAAGCTGGG + Intronic
1189017153 X:37296151-37296173 GGAAGCAGAATGTAAAAGTTTGG - Intergenic
1192583481 X:72303172-72303194 GGAAGCAGTATGTCCCATCTTGG - Intronic
1194107850 X:89793339-89793361 GGAAGCAGAGTGTGAAAGTTTGG - Intergenic
1195065011 X:101232579-101232601 GGATGGAGAATGTGGATGCTGGG + Intronic
1196020668 X:110987498-110987520 GGAGTCAGAGTGTGGCAGCTTGG + Intronic
1196201472 X:112890787-112890809 GAAAACAGAATTTGGTAGCTAGG - Intergenic
1197736398 X:129852220-129852242 GGCAGGAGACTGTGGCATCTTGG + Intergenic
1198693539 X:139310539-139310561 GTAAGGAGAATTGGGCAGCTGGG + Intergenic
1200459802 Y:3441124-3441146 GGAAGCAGAGTGTGAAAGTTTGG - Intergenic