ID: 1173378646

View in Genome Browser
Species Human (GRCh38)
Location 20:42515057-42515079
Sequence AAGCTAATCTATAGATCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173378646_1173378648 7 Left 1173378646 20:42515057-42515079 CCATCGGATCTATAGATTAGCTT 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1173378648 20:42515087-42515109 ATCAACATCTTAAACACACTGGG 0: 1
1: 0
2: 0
3: 14
4: 212
1173378646_1173378647 6 Left 1173378646 20:42515057-42515079 CCATCGGATCTATAGATTAGCTT 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1173378647 20:42515086-42515108 AATCAACATCTTAAACACACTGG 0: 1
1: 0
2: 0
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173378646 Original CRISPR AAGCTAATCTATAGATCCGA TGG (reversed) Intronic
901971131 1:12909794-12909816 AAGGTAATTTATAGATTCAATGG + Intronic
902014039 1:13291965-13291987 AAGGTAATTTATAGATTCAATGG - Intergenic
908942044 1:69446869-69446891 AAGGTAATTTATAGATTCAATGG + Intergenic
909065061 1:70926244-70926266 AAGGTAATTTATAGATTCAATGG - Intronic
909957275 1:81795013-81795035 GAGTTAATTTATAGATCAGAAGG + Intronic
912755096 1:112317736-112317758 CAGCTATTCTCTATATCCGAGGG + Intergenic
912930942 1:113960518-113960540 AAGCTCATCTATAGCCCCCAGGG - Intronic
916697592 1:167255339-167255361 AGGCTAATCTATAGATTCATGGG - Intronic
920304512 1:205009978-205010000 AAGCCAATTTATAGAACAGATGG - Intronic
921379655 1:214511642-214511664 AAGAGAATCCATAGATCCTAAGG - Intronic
923933041 1:238724471-238724493 AAGCAAATCAATAGATACGAAGG - Intergenic
1064899430 10:20277459-20277481 AAGCAAATATAAAGATCCTAGGG + Intronic
1067398231 10:45944221-45944243 AAGCTTATCTAGAGATTTGAAGG - Intergenic
1067866550 10:49913306-49913328 AAGCTTATCTAGAGATTTGAAGG - Intronic
1072406754 10:95161885-95161907 AAGGTAATTTATAGATTCAATGG - Intergenic
1075891950 10:125959510-125959532 CATCTAATCTATATATACGATGG + Intronic
1080002043 11:27361332-27361354 TAGCTGAGCTATAGTTCCGATGG + Intronic
1080710469 11:34742352-34742374 AAGGTAATTTATAGATTCAATGG + Intergenic
1088927555 11:114317676-114317698 AAGCTGATCTATACATGAGAAGG - Intergenic
1089107046 11:116019580-116019602 AAATTAATCTATAGATTCAATGG - Intergenic
1089888949 11:121859760-121859782 AAGGTAATTTATAGATTCAATGG + Intergenic
1089901883 11:121994964-121994986 AAGGTAATTTATAGATTCAATGG + Intergenic
1092838629 12:12516651-12516673 AAGCAAATATATAGCTGCGATGG - Intronic
1093073533 12:14732788-14732810 AAGCTCATCTATGGATATGAGGG + Intergenic
1093309397 12:17560664-17560686 AAGGTAATTTATAGATTCAATGG - Intergenic
1097774766 12:63632641-63632663 AAGGTAATTTATAGATTCAATGG + Intronic
1100085522 12:90905419-90905441 AAGCTAATATAAATATCGGAGGG - Intergenic
1103868650 12:124074791-124074813 AAGCTCATCTATAAAACCAATGG - Intronic
1111582702 13:90245326-90245348 AAGCTAATTTATAGAACCACTGG + Intergenic
1115782140 14:36781975-36781997 AAGCTATTCTTTAGAAACGAAGG - Intronic
1116550074 14:46226358-46226380 AAGGTAATTTATAGATTCAATGG + Intergenic
1116678984 14:47941761-47941783 AAGGTAATTTATAGATTCAATGG + Intergenic
1125331319 15:38585286-38585308 AAGGTAATTTATAGATTCAATGG + Intergenic
1126854860 15:52828562-52828584 AAGGTAATTTATAGATTCAATGG + Intergenic
1135226286 16:20661619-20661641 AAGCAAATCCAGAGATCCAAAGG - Intronic
1136281653 16:29216371-29216393 AAACTGAGCTATAGATCCAATGG + Intergenic
1142086026 16:88182302-88182324 AAACTGAGCTATAGATCCAATGG + Intergenic
1146462855 17:33060725-33060747 AAGGTAATTTATAGATTCAATGG - Intronic
1149677756 17:58481540-58481562 AAGCTAATCTGTAAAACGGAGGG + Intronic
1164110510 19:22152938-22152960 AAGGTAATTTATAGATTCAATGG + Intergenic
941059037 2:160825098-160825120 AAGCTAATCTTTAGATATGAGGG - Intergenic
941409204 2:165132207-165132229 AAGGTAATTTATAGATTCAATGG + Intronic
942108007 2:172652897-172652919 AAGGTAATTTATAGATTCAATGG + Intergenic
942717800 2:178914105-178914127 AAGATAATCTATAATCCCGAAGG + Intronic
942878630 2:180832601-180832623 AAGGTAATTTATAGATTCAATGG + Intergenic
943001830 2:182337530-182337552 AAGCTAATTTCTAGATTCTAAGG - Intronic
943011408 2:182454345-182454367 AAGGTAATTTATAGATTCAATGG + Intronic
1169749530 20:8977450-8977472 AAGCTATACTAGAGGTCCGAGGG - Intergenic
1171356902 20:24553873-24553895 AAGGTAATTTATAGATTCAATGG - Intronic
1173378646 20:42515057-42515079 AAGCTAATCTATAGATCCGATGG - Intronic
1177954161 21:27576647-27576669 AAGGTAATTTATAGATTCAATGG + Intergenic
1179164645 21:38925909-38925931 ATGCTAACCCATAGATCAGAAGG + Intergenic
1179338751 21:40484294-40484316 AAGCTAAGGTATAGATAGGATGG - Intronic
949766374 3:7531376-7531398 AAACTAATCTATAGATTCAATGG - Intronic
954762718 3:52888454-52888476 AAGCTGCTCTAATGATCCGATGG + Intronic
958217258 3:90602734-90602756 AAGCTATTCTATCGAAACGATGG + Intergenic
958873883 3:99593431-99593453 AAGGTAATTTATAGATTCAATGG + Intergenic
959043345 3:101443514-101443536 AAGGTAATTTATAGATTCAATGG - Intronic
959044075 3:101452291-101452313 AAGGTAATTTATAGATTCAATGG + Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964580021 3:158223563-158223585 AAGCTAAACTATAGATCAGGTGG - Intronic
967612688 3:191526469-191526491 AAGCTATAATATAGAACCGATGG + Intergenic
972085741 4:35212436-35212458 AAGCTAATCTATAGATCCTGAGG + Intergenic
974953421 4:68608586-68608608 AAGGTAATTTATAGATTTGATGG - Intronic
984334175 4:178366365-178366387 AAGCTAATTTACAGAGCCCAGGG + Intergenic
987524638 5:19031409-19031431 AAGCTAAACTATAGACCAGTCGG + Intergenic
991211145 5:64106160-64106182 AAGGTAATTTATAGATTCAATGG - Intergenic
991934261 5:71786230-71786252 AAGCTTCTCTATTGATCCAAGGG + Intergenic
992001504 5:72440977-72440999 ATGCTAATGTATAAATCAGATGG + Intergenic
997300970 5:132804794-132804816 AAGGTAATCTATAGATTCAATGG + Intronic
998806910 5:145926792-145926814 AAGGTAATTTATAGATTCAATGG - Intergenic
998961811 5:147495825-147495847 AAGGTAATTTATAGATTCAATGG + Intronic
1003354454 6:5354053-5354075 AAACTAATCTCTAGATGAGATGG - Intronic
1007864380 6:44952251-44952273 AAGCCATTCTATGGATCCAAGGG - Intronic
1008506045 6:52230810-52230832 AAGCTAACCAATAGATCCTTGGG - Intergenic
1015629909 6:135221820-135221842 AAGCTAAACTATAAATCTTATGG + Intergenic
1018187387 6:161278494-161278516 GAGCTAATCAATAGAAACGAAGG - Intergenic
1022118541 7:27284355-27284377 AACCTACTCTGTAGATCTGAAGG + Intergenic
1022952327 7:35350934-35350956 AAGCCAATCTGTAGATACAAAGG - Intergenic
1023630133 7:42155475-42155497 AAGCTACTCTATGGCTCTGATGG - Intronic
1028799393 7:94945010-94945032 AAGGTAATCAATAGATCCTTAGG - Intronic
1030202881 7:106923379-106923401 AAGATAATTTATAGATTCAATGG + Intergenic
1033902639 7:146161589-146161611 AAGGTAATTTATAGATTCAATGG + Intronic
1034826490 7:154269686-154269708 TAGAAAATCTATAGATCTGATGG - Intronic
1036955407 8:13182883-13182905 AAGCTAATTTACAGATTCAATGG - Intronic
1038765091 8:30420374-30420396 AAGCTAATCTATAAGTCAGCTGG + Intronic
1043130943 8:76460394-76460416 AAGCTCAGCTATAGATTTGAGGG - Intergenic
1044923455 8:97189060-97189082 AAGCAAAACTGTAGATACGAGGG - Intergenic
1045450668 8:102321515-102321537 AAGGTAATTTATAGATTCAATGG + Intronic
1045596606 8:103663709-103663731 AAGGTAATTTATAGATTCAATGG + Intronic
1046392084 8:113587883-113587905 AATCAAATCTATAAATCCAAAGG + Intergenic
1046994575 8:120503311-120503333 AAGCTAAGCTCTAGATGAGAGGG - Intronic
1047478874 8:125261666-125261688 AAGCTAATCTTTAAATCCCTTGG - Intronic
1053561675 9:39202645-39202667 AAGGTAATTTATAGATTCAATGG + Intronic
1054135444 9:61416307-61416329 AAGGTAATTTATAGATTCAATGG - Intergenic
1056414577 9:86364067-86364089 AATCTAATCCACAGACCCGAAGG - Intergenic
1058409739 9:104718472-104718494 AAGGTAATTTATAGATTCAATGG + Intergenic
1188466954 X:30492616-30492638 AAGCTGATCTTGAGATCCAAAGG + Intergenic
1189485528 X:41428257-41428279 AAGGTAATTTATAGATTCAATGG - Intergenic
1189525258 X:41813168-41813190 AAGGTAATTTATAGATTCAATGG + Intronic
1189696735 X:43672007-43672029 AAGGTAATTTATAGATTCAATGG - Intronic
1191127370 X:56972077-56972099 AAGGTAATTTATAGATTCAATGG + Intergenic
1196148789 X:112349427-112349449 AAGGTAATTTATAGATTCAATGG - Intergenic
1196211087 X:112996425-112996447 AAGGTAAAATATAGATCAGAAGG - Intergenic
1198069182 X:133131094-133131116 AAGCTGATCTAGAGATCAGCTGG + Intergenic
1200712386 Y:6498640-6498662 AAGGTAATTTATAGATTCAATGG + Intergenic
1201021530 Y:9663319-9663341 AAGGTAATTTATAGATTCAATGG - Intergenic