ID: 1173378782

View in Genome Browser
Species Human (GRCh38)
Location 20:42516355-42516377
Sequence ACAGCTAATATGTGGTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173378782_1173378786 -2 Left 1173378782 20:42516355-42516377 CCCTTTTACCACATATTAGCTGT 0: 1
1: 0
2: 1
3: 24
4: 256
Right 1173378786 20:42516376-42516398 GTCCATCTTTTGGACACTTATGG 0: 1
1: 0
2: 1
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173378782 Original CRISPR ACAGCTAATATGTGGTAAAA GGG (reversed) Intronic
900821668 1:4894437-4894459 AGAGAAAATATGTGGGAAAAAGG + Intergenic
902664347 1:17927157-17927179 ACAGCTGGTACATGGTAAAAGGG + Intergenic
907614069 1:55905963-55905985 ACAGCTAATAAGTGGTGGACAGG - Intergenic
908319098 1:62963680-62963702 ACAGCTATTATGTGCAAAAAGGG + Intergenic
908500341 1:64737275-64737297 ACAGCAAATATATGATATAAAGG - Intergenic
908777233 1:67651971-67651993 ACAGATAATATGTACTACAATGG + Intergenic
909919108 1:81358161-81358183 AAAGCTAATTTGTGGAAACAAGG + Intronic
911962969 1:104330920-104330942 ACAAGTAATATGTGGGATAAGGG - Intergenic
911994982 1:104755703-104755725 TCAGGTAATAAATGGTAAAATGG + Intergenic
914703840 1:150155732-150155754 ACAGCTTACATGTTCTAAAAAGG - Intronic
914953617 1:152141975-152141997 ACAGTTAATTTGTGTGAAAAGGG - Intergenic
915569595 1:156737271-156737293 ACAGCTGCTGTGTGGTAGAATGG - Intergenic
916486990 1:165268648-165268670 ACAGCTAATAAGTGGTAGAGTGG - Intronic
919075877 1:192811978-192812000 AAAACTACTATGTGGTAACATGG - Exonic
919408990 1:197220596-197220618 ACAGCTAATGTTTGGCAAAGTGG + Intergenic
920777043 1:208949006-208949028 ACAGCTAAAATGTGGTTTAAAGG + Intergenic
1063306866 10:4910496-4910518 ACAGCTAAAGTGGGGTAACAGGG + Intergenic
1064801840 10:19084140-19084162 CCAGGTAATATTTGCTAAAATGG - Intronic
1070685579 10:78477874-78477896 ACAGCAAATACCTGGTGAAAAGG + Intergenic
1070938937 10:80325986-80326008 GCCGCCAATATATGGTAAAATGG + Intergenic
1071039536 10:81289678-81289700 ACAGCTAAAGCGTGTTAAAAGGG + Intergenic
1071355368 10:84788450-84788472 ACAGCTAGTAAGTGGAAGAATGG - Intergenic
1071776468 10:88793979-88794001 ACATCAAAAATGTAGTAAAATGG - Intergenic
1073838780 10:107474547-107474569 ACAGCTTGTAAGTGGTAAACTGG - Intergenic
1073980309 10:109146556-109146578 ACAGCTATTATTTTTTAAAAAGG + Intergenic
1078252706 11:9630217-9630239 ACACTTAATATTTAGTAAAACGG + Intergenic
1083376162 11:62223656-62223678 AAAGCCAAGATGTGCTAAAACGG + Intergenic
1085760905 11:79240552-79240574 ACAACTAATAAATGGTAAACTGG + Intronic
1086204923 11:84246352-84246374 ACAGCTAATAAGTGAATAAAGGG - Intronic
1087028471 11:93677346-93677368 GCAGCTCTTATGTGCTAAAAAGG - Intronic
1087042372 11:93814273-93814295 AAAGCAAATGTGTGGGAAAATGG + Exonic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1088580306 11:111309237-111309259 ACAGCTAGGATGTTGGAAAAGGG + Intergenic
1088903413 11:114135942-114135964 ACAGAGAAGATGTGGGAAAAAGG - Intronic
1089320218 11:117620786-117620808 ACAGCTAATAAGTGATGAAAAGG - Intronic
1090160165 11:124484165-124484187 ACAGCTAATATGTCAGATAATGG + Intergenic
1090451491 11:126810366-126810388 AAAGCTAATATATGGTAATCAGG - Intronic
1096247838 12:50004256-50004278 AAAGCTGATATCTGATAAAATGG + Exonic
1096646197 12:53037884-53037906 ACTGCCAATATGTGGCAAAAGGG - Intronic
1096887874 12:54735620-54735642 ACAGGTATTATTTTGTAAAATGG - Intergenic
1100134653 12:91540571-91540593 CCAGCTATTTAGTGGTAAAAGGG + Intergenic
1100730131 12:97456727-97456749 TCAGCCAATCTGTGATAAAAGGG + Intergenic
1100732311 12:97485718-97485740 ATAGCTAATAAGTGGCAAAGAGG + Intergenic
1101079551 12:101169342-101169364 ATAGCTGATATATGGAAAAAGGG + Intronic
1102486748 12:113263681-113263703 ACAGGTAAAATGTGGGAAGAGGG - Intronic
1102735394 12:115154551-115154573 ACTGATAAAATGTGGTAAAAGGG - Intergenic
1107456762 13:40562694-40562716 ACTGCAAATATATGGTGAAAGGG + Intronic
1107754278 13:43602368-43602390 AGAAATAATATATGGTAAAATGG + Intronic
1108302106 13:49089160-49089182 ACACTTAAAATGTGTTAAAATGG + Intronic
1108381755 13:49861400-49861422 ACAGGTACTATGGGGGAAAATGG - Intergenic
1109857878 13:68156685-68156707 ATAGCTAATAAATGGGAAAAGGG - Intergenic
1110035335 13:70675228-70675250 AAAGCTAATATGAAGTAAAATGG - Intergenic
1110167765 13:72464044-72464066 ACAGCAAATATGAAGTAAAGGGG + Intergenic
1111126466 13:83915015-83915037 AAAGTTAATATGTGTTACAAGGG - Intergenic
1113036907 13:106060811-106060833 ACAGATTATGTGTAGTAAAATGG - Intergenic
1113251103 13:108453376-108453398 GCAGCTAATATGAGAGAAAATGG - Intergenic
1114337225 14:21702947-21702969 GAATCTAATATGTGATAAAAAGG + Intergenic
1116241549 14:42350026-42350048 ACGGTTAATATATTGTAAAAAGG - Intergenic
1116568570 14:46485242-46485264 CAAGCTAATATATGCTAAAATGG - Intergenic
1118069351 14:62228827-62228849 ACAGCTAATATATAGAAATATGG + Intergenic
1118162169 14:63301640-63301662 GTAGCTAATAAATGGTAAAAAGG - Intergenic
1120446414 14:84602346-84602368 ACAATAAATATGTGATAAAATGG + Intergenic
1121504339 14:94464955-94464977 ACTGCTAATTTCTGCTAAAAAGG + Intronic
1123916589 15:25036019-25036041 ACAGATTATATGTGTTAACAAGG + Intergenic
1123991345 15:25685876-25685898 ACAGCTAACAAGTGATAGAAAGG + Intronic
1126233729 15:46357367-46357389 ACAGCTAAAATGGTGTTAAAAGG + Intergenic
1127694024 15:61426419-61426441 ACAGCTGATGCCTGGTAAAAAGG + Intergenic
1128864197 15:71101063-71101085 ACATAAAATATGTGATAAAATGG - Intronic
1129764616 15:78154499-78154521 ACAGCGAATAATTGGCAAAATGG - Intronic
1130109737 15:80954408-80954430 ACAGCTAGGATGGGGTCAAAGGG - Intronic
1130733522 15:86524038-86524060 ACATCTACTATGTGACAAAAAGG + Intronic
1132168994 15:99628529-99628551 ACAGCTAAGAGGGGGAAAAATGG - Intronic
1133888052 16:9850326-9850348 ACAGCTAGTAAGTGGTACAGTGG - Intronic
1137975483 16:53027814-53027836 ATAGCTATTATGAGATAAAAGGG - Intergenic
1137995597 16:53207757-53207779 AGAACTAAACTGTGGTAAAATGG - Intronic
1138026978 16:53529606-53529628 ACAGCAATTATGTGGTGTAATGG + Intergenic
1138921134 16:61530618-61530640 ACAATTAATATGTGGGAAGAAGG + Intergenic
1138959076 16:62007371-62007393 ACATCTGATTTGAGGTAAAATGG + Intronic
1140970618 16:80008999-80009021 AAAGCTAACCTGTGGTAGAATGG + Intergenic
1141144203 16:81517611-81517633 ACAGCTAATATGTGAATACAGGG - Intronic
1142001060 16:87664772-87664794 ACAGCTCACATGTGGAAACATGG + Intronic
1143777275 17:9207812-9207834 ACAGCTAATATCTGAAAAATGGG - Intronic
1143805960 17:9426980-9427002 AAAGGTAATTAGTGGTAAAATGG - Intronic
1146472401 17:33135075-33135097 TATGCTAATAAGTGGTAAAATGG + Intronic
1146702485 17:34973435-34973457 ACAGCTAATTGGTGGCAAAGTGG - Intronic
1147329252 17:39687184-39687206 ACAGCCAGTATGTAGTAAAGTGG - Intronic
1149018269 17:51933832-51933854 ACTGCTATTATGTGGCAACATGG + Intronic
1149096946 17:52854509-52854531 ACATCTGATATGTGTGAAAACGG + Intergenic
1149425014 17:56546479-56546501 ACTGCTAATAAGTGGAGAAATGG + Intergenic
1151428817 17:74048962-74048984 GCAGCTAACAGGTGGTAGAATGG - Intergenic
1151643294 17:75412355-75412377 AAAAATAATATGTGTTAAAATGG + Intergenic
1153693932 18:7621213-7621235 ATAGCTAATAATTGGTAAACTGG + Intronic
1155766051 18:29634331-29634353 ACAGCTAATATCATGTACAAGGG - Intergenic
1155794535 18:30019039-30019061 CCAGCTTATATTTTGTAAAAAGG - Intergenic
1155888797 18:31240936-31240958 ACAGCTATTATTTGGTAGTATGG + Intergenic
1157243823 18:46036381-46036403 ACAGCTAATAAGGAGTAATATGG + Intronic
1157929572 18:51806572-51806594 ACATTCAATATGTGGTAAGAAGG - Intergenic
1157939740 18:51915090-51915112 ACAGAGAATATGTGATATAAAGG + Intergenic
1158047066 18:53168928-53168950 ACAGGTTATGTGTGTTAAAAGGG + Intronic
1163196116 19:15721659-15721681 ACACCTAATATGTGCTAGAATGG + Intergenic
1164043978 19:21518363-21518385 ACAGCTAATGTGAGGTTAAAAGG - Intronic
1164621908 19:29701139-29701161 ACACATAATATGTGGGAAAATGG + Intronic
1166420783 19:42634345-42634367 ATAGCTAATATGGCCTAAAATGG + Intronic
1167870339 19:52363866-52363888 ACAGCTAATATGTGACAAGATGG - Intronic
1167992984 19:53376414-53376436 ACAGATAATATGTAACAAAAAGG - Intronic
927230032 2:20812999-20813021 ACAGCTAGTAAGTTGTAAAGTGG + Intronic
928709018 2:33983474-33983496 GTAGCTAAGATGTGGTAGAAGGG + Intergenic
930619445 2:53628634-53628656 ACAGTCAATATGTGGTAGAATGG + Intronic
930794507 2:55373977-55373999 ACATTTAAAATGTGGTATAAAGG + Intronic
931079783 2:58755625-58755647 ACAGCTAATAAATGGCAGAAGGG - Intergenic
931146027 2:59519529-59519551 ACATTTAATATGTTTTAAAATGG - Intergenic
931420489 2:62122698-62122720 CCTGCCAATATGTGGTCAAAAGG - Intronic
932905302 2:75743006-75743028 ACAGCTAACATGTTGCTAAATGG + Intergenic
933380206 2:81533291-81533313 ACAGATCATATGTGGGAGAAAGG + Intergenic
933790126 2:85877024-85877046 GCAGCACAAATGTGGTAAAATGG - Intronic
936507733 2:113121319-113121341 ACAGCTGTTATGTGGACAAAAGG + Intronic
937495213 2:122411961-122411983 ACAGCTTATAGGTGGTAACTGGG - Intergenic
937867417 2:126763394-126763416 ACAGCTAATATGTGGCAGTCTGG + Intergenic
938799125 2:134744133-134744155 ACATCTAATTTTTGGTGAAATGG - Intergenic
939774336 2:146365924-146365946 AAATCTAATATGTCCTAAAAAGG - Intergenic
940099937 2:150023479-150023501 ACAGCTAATAAGTGGTAGTTAGG + Intergenic
940788195 2:158004409-158004431 ACACCTAATCTATGGAAAAATGG + Intronic
941028927 2:160490714-160490736 ACAGATAATACCAGGTAAAATGG - Intronic
941050788 2:160731355-160731377 ATAGCAAATATATGGTAAAATGG + Intergenic
941162385 2:162050601-162050623 GCAGCTAATATGTGGAAACTGGG - Intronic
942369520 2:175267544-175267566 ACAGTCAACATGTTGTAAAATGG + Intergenic
943622134 2:190160463-190160485 ATAGCTTATCTGTGCTAAAAGGG + Intronic
943807769 2:192143950-192143972 ATAGCTAATAAATGGTTAAATGG - Intronic
944039885 2:195341067-195341089 ACAGTTAATATGTTTAAAAATGG - Intergenic
945156363 2:206843610-206843632 AAAATTAATATGTGATAAAAGGG - Intergenic
946066429 2:216991419-216991441 ACAGCAAAGATGTGTTAAGAAGG + Intergenic
946100120 2:217313311-217313333 ACATATAGTTTGTGGTAAAATGG - Intronic
946492356 2:220161444-220161466 ACAGACAATATGTGGAAGAATGG - Intergenic
948038614 2:234880625-234880647 ACAGCTATTATGTGGTACCCAGG + Intergenic
1170196527 20:13694585-13694607 ACAGCTATTGTGTGGCAAGAAGG - Intergenic
1170632500 20:18077446-18077468 ACAGCCACCATGTGGTAGAATGG + Intergenic
1171154688 20:22861155-22861177 CCAGATGATATGTCGTAAAAAGG - Intergenic
1172961273 20:38801833-38801855 ACAGCTAAAAAGTGGAAACAAGG - Intergenic
1173378782 20:42516355-42516377 ACAGCTAATATGTGGTAAAAGGG - Intronic
1174933726 20:54844490-54844512 ACAGCTAATAAGTTTTAAAGAGG - Intergenic
1175021544 20:55856062-55856084 AGAGCTAATAAATGGTAGAATGG - Intergenic
1177968987 21:27764886-27764908 ACACCTAAGATGTGGTAATTTGG - Intergenic
1179334627 21:40439057-40439079 ACAGCTAATGGGTGGTAAACAGG - Intronic
1182136399 22:27907788-27907810 ACAGCTAATAAGTGACAGAATGG - Intronic
1182731035 22:32493799-32493821 AACACTAATATGTAGTAAAATGG - Intronic
1183009547 22:34933459-34933481 ACAGCCAGTAGGTGGCAAAATGG + Intergenic
1183377369 22:37473019-37473041 ACAGCTAATATGGGGCAGAGGGG - Intronic
950267250 3:11583469-11583491 ACAGGAAACATCTGGTAAAATGG + Intronic
951277426 3:20705540-20705562 ACAGCTAATAACTTGTAAACAGG - Intergenic
952573527 3:34746419-34746441 CCAGACAATATGTGATAAAATGG - Intergenic
954592135 3:51792054-51792076 ACAGATAAAATCTAGTAAAAGGG + Intergenic
954702554 3:52457986-52458008 AAAACTAATATGTGGCACAATGG - Intronic
956348257 3:68304899-68304921 ACAGCTACTATGTGGTCTACTGG - Intronic
956457887 3:69441796-69441818 ACTGCTAATATATGGGAGAAAGG - Intronic
956809408 3:72849768-72849790 ACAGCTAGTAAGTGGTGCAATGG + Intronic
957388448 3:79529612-79529634 ACAGCTAATAAGTGACAAACAGG + Intronic
957611887 3:82477986-82478008 GCAGCTAATTTCTGTTAAAATGG - Intergenic
958106675 3:89083014-89083036 ATTGCTAATATGTGGGAAAATGG + Intergenic
958797965 3:98726624-98726646 AGAGCTAATATGTGTCAAAACGG - Intergenic
958987160 3:100794699-100794721 ACATCTAAGATGTGTTAAATTGG - Intronic
959784889 3:110284199-110284221 ACAATTAATTTGTGGTATAAAGG + Intergenic
962490067 3:135884542-135884564 ACAGCTAATAGGGAGCAAAATGG - Intergenic
963369113 3:144375334-144375356 ACAGTTAATAAGTGACAAAATGG + Intergenic
964344333 3:155740800-155740822 ACAGCTAATAAATGGCAGAATGG - Intronic
965469536 3:169073766-169073788 ACAACTAGTTTGTGGCAAAAAGG + Intergenic
967014383 3:185468394-185468416 AAGGCAAATATGTAGTAAAAAGG - Intronic
967058692 3:185852287-185852309 TCAGGTAATCTGTGGTACAAGGG + Intergenic
969209222 4:5673627-5673649 CCTGCTAATATGTGATTAAAGGG - Intronic
970755864 4:19425847-19425869 ATAGGTAATATGTATTAAAATGG - Intergenic
971377518 4:26067079-26067101 ACAGGTAATAGGTGGTAACAGGG + Intergenic
972260548 4:37404165-37404187 ACAGCAAGTATATGGCAAAATGG - Intronic
972956912 4:44404163-44404185 ACAGATATTTTGTGTTAAAATGG - Intronic
973680850 4:53317737-53317759 AGAGCTAGTAGGTGGCAAAATGG - Intronic
974361163 4:60881340-60881362 CCAGGTAATATGTGGGAGAATGG + Intergenic
974482387 4:62462324-62462346 ACTATTACTATGTGGTAAAATGG + Intergenic
977442908 4:97092766-97092788 ACAGTTAAAATGTGATAAAATGG - Intergenic
979381192 4:120008797-120008819 ACAACAAACATGTTGTAAAATGG - Intergenic
979797517 4:124864545-124864567 ACAGTTAATTTGTGTTAATAGGG + Intergenic
979818790 4:125144534-125144556 AAAGCTAATCTGTGGGAAACAGG + Intergenic
979840067 4:125427746-125427768 ACATCAAATATTTGGTAAATGGG - Intronic
980620136 4:135290400-135290422 TCAGCTAAAATGTGGAAAGAAGG + Intergenic
981488082 4:145308832-145308854 GAAGCTAATATGTGCAAAAAGGG + Intergenic
981640444 4:146936690-146936712 AAAGATAATATCTGATAAAATGG + Intronic
981665011 4:147214491-147214513 ACAGCTAAGGCGTGGTAAGAGGG - Intergenic
981889018 4:149714817-149714839 ACAGCTACTAAGTGATTAAATGG + Intergenic
982436583 4:155387896-155387918 ACAGCTACTATGTGATTGAATGG - Intergenic
983630783 4:169847289-169847311 AGAGCTAATAAGTGGGATAAAGG + Intergenic
983920701 4:173341232-173341254 TCAGCTAATCTGTGGAAAATAGG - Intergenic
984222339 4:176993737-176993759 AGAGCTAAAATATGGTAAAATGG - Intergenic
985169235 4:187130622-187130644 GCACCTTCTATGTGGTAAAAGGG - Intergenic
986222836 5:5785565-5785587 AAAGCTAATATGTGGCAGACGGG - Intergenic
986853325 5:11838471-11838493 AGAGCTAATAAGTCATAAAAAGG - Intronic
986853361 5:11839123-11839145 ACAGCTAATAAATCATAAAAAGG - Intronic
987336687 5:16903492-16903514 AGAGCTAACAGGTGGTAAACGGG + Intronic
990366321 5:55074393-55074415 ACAGCTAATAAATGGCAAAGTGG - Intergenic
992584846 5:78227600-78227622 ACAGTTAATAGGTGCTTAAAGGG + Intronic
994494370 5:100491055-100491077 ACAGCCAATATATGGAAACAAGG + Intergenic
994502115 5:100592135-100592157 ACAGCTAAAATGTAGTAAAATGG + Intergenic
994661493 5:102659822-102659844 ATAGCTAAAATGGGATAAAATGG - Intergenic
994686914 5:102967259-102967281 GCAGCTAATGTGTGGAGAAAAGG - Intronic
995036830 5:107543833-107543855 ACATTTAATATGCTGTAAAATGG + Intronic
995986742 5:118185380-118185402 ACAGCAAAGATGTGGCCAAAGGG + Intergenic
997041031 5:130254437-130254459 ACACCAAATAACTGGTAAAAAGG + Intergenic
997435393 5:133870470-133870492 ATAGCTAATAAGTGGTAGAGTGG + Intergenic
998033957 5:138897436-138897458 GCTGATAATATGTGGTAAAGTGG + Intronic
998947636 5:147357674-147357696 ACATCTAAAATCTGGTAAGAAGG - Intronic
999558782 5:152775696-152775718 TCAGCCTTTATGTGGTAAAATGG - Intergenic
999768791 5:154759083-154759105 ACAGCTAACAAGTGGTACAGTGG - Intronic
1000334254 5:160230283-160230305 ACAGCTAGTAATTGGTAAAGTGG + Intronic
1000717483 5:164664112-164664134 ACAGCTATAATATGGGAAAATGG - Intergenic
1005381526 6:25239677-25239699 AAAGAAAATATGTGGTAAAGAGG - Intergenic
1007670918 6:43552915-43552937 ACAGCTAATAAATGGCAAAATGG - Intronic
1008093915 6:47319269-47319291 ACAGTTAATAAGTAGTATAATGG - Intergenic
1008806453 6:55434982-55435004 ACAGGTAAAGTGTGGTAAACTGG + Exonic
1009311888 6:62164535-62164557 ACAGATAATTTGAAGTAAAAGGG - Intronic
1009709750 6:67301516-67301538 ACAGCTTATGTCTGGAAAAATGG + Intergenic
1010248703 6:73686030-73686052 ACAGCTAATATCATGCAAAATGG - Intergenic
1010678467 6:78771243-78771265 ACAGATAATATGCTATAAAAGGG - Intergenic
1011184942 6:84663710-84663732 ACAGCAAATATGTAGATAAAAGG - Intergenic
1011276696 6:85638889-85638911 AGAGCTAAGTTGTGGTAAAAAGG - Intronic
1011748351 6:90430433-90430455 ACAGAGCAAATGTGGTAAAATGG - Intergenic
1012685125 6:102237077-102237099 ACAGCAAATATGTGAAAAATTGG - Intergenic
1013173161 6:107655476-107655498 ACAGCAAGTATGTGGTGAGAGGG + Intronic
1013262302 6:108457305-108457327 ATAGCTAATAAGAAGTAAAAGGG - Intronic
1014727429 6:124988645-124988667 TCTGCTAAAATGTGTTAAAATGG - Intronic
1014732986 6:125056230-125056252 ACAGCACATATGTGTTAAGAAGG - Intronic
1015870216 6:137768760-137768782 ACAGCTAATACGTGGTGAATAGG + Intergenic
1016174128 6:141057107-141057129 AAAGTTACTATGTGGTTAAATGG + Intergenic
1017187811 6:151620106-151620128 ACAGACAATAAGTGATAAAATGG + Exonic
1018294286 6:162328995-162329017 AATGCCAATATTTGGTAAAATGG + Intronic
1018921422 6:168178519-168178541 ACAGTGAATAAGTGGTAGAATGG - Intergenic
1019935493 7:4253843-4253865 AAAGCAAATATCTGATAAAATGG - Intronic
1021132372 7:16926702-16926724 ACATCTAATGTGTGGCTAAAAGG + Intergenic
1021647803 7:22803281-22803303 ACAGCTAAAATTGGGTAACAAGG + Intergenic
1021781052 7:24106342-24106364 ACAGCCAAAATGTCGTATAAGGG - Intergenic
1022116275 7:27263802-27263824 ACAGCCAATAAATGGTGAAAGGG - Intergenic
1022424105 7:30251620-30251642 ACAACTAGTAAGTGGTAGAAGGG - Intergenic
1023585946 7:41729827-41729849 ACTGCGAATATGTTCTAAAAAGG + Intergenic
1024374333 7:48620191-48620213 ACAGGTAAAATTTGGTTAAAAGG + Intronic
1024766384 7:52665978-52666000 ACACCTAAAATGTTTTAAAAAGG + Intergenic
1026434069 7:70378601-70378623 ACAGCTAGTATGTGGCAGACAGG + Intronic
1028717825 7:93993810-93993832 TCAGCCAGTTTGTGGTAAAATGG - Exonic
1030926656 7:115465031-115465053 ACATCAAATATATGGTAAAATGG - Intergenic
1034016522 7:147593498-147593520 ACAGATGGTAAGTGGTAAAAGGG - Intronic
1035257678 7:157642179-157642201 ACAGCCAATTTGGGGCAAAAGGG - Intronic
1035944695 8:3949265-3949287 ACAGCTATCATGTTGTACAATGG + Intronic
1037044603 8:14282752-14282774 AGAGCTAATAGGTGGGGAAAGGG - Intronic
1041319815 8:56601618-56601640 ATAGCTAAGGTGTGGTGAAAAGG + Intergenic
1042336727 8:67637731-67637753 ATAGAAAATATGTAGTAAAAAGG + Intronic
1042444312 8:68866394-68866416 ACAGCCAACATGTGATAAAGAGG + Intergenic
1042594388 8:70430270-70430292 ACAGATAAAATGAGATAAAAAGG + Intergenic
1043339078 8:79215530-79215552 ACAGCTAGTAAGTGATAACATGG - Intergenic
1045147053 8:99357674-99357696 ACAGCTATTAAGTACTAAAATGG - Intronic
1045979208 8:108164696-108164718 ACAGCTAGTAAATGCTAAAATGG + Intergenic
1047169524 8:122477862-122477884 ACAACTGATATGTGGGAAGAAGG + Intergenic
1048477746 8:134758381-134758403 ACAGCTAGTAGGAGGTAAAGTGG - Intergenic
1048591407 8:135824207-135824229 ACAGCTAGGATGGGGAAAAAAGG - Intergenic
1050666970 9:7949953-7949975 TCAGCTAATATGTGCTTCAAGGG - Intergenic
1051075229 9:13225576-13225598 ACAGTAAAAATGTGGTTAAAAGG - Intronic
1051153550 9:14114001-14114023 AAAGGTAATATATGGTAATATGG - Intronic
1052042906 9:23760118-23760140 AGAGCTGTTATGTGGCAAAATGG - Intronic
1052129314 9:24822307-24822329 ATAGCTAAGATGGGGAAAAAAGG + Intergenic
1052316373 9:27119952-27119974 AGAGCAAATATGTGCTGAAATGG - Intronic
1055505163 9:76940452-76940474 ATAGCAAATATTTGCTAAAATGG - Intergenic
1057277958 9:93686297-93686319 CCAGCTAACATGAGGTCAAATGG - Intergenic
1058917094 9:109578136-109578158 ACAACTAATATGTGGAAGAATGG - Intergenic
1060261035 9:122073740-122073762 ACAGCCAAAATATGTTAAAAAGG + Intronic
1061691658 9:132337671-132337693 ACTGATAATAAGTGGTAGAAGGG + Intronic
1185890844 X:3820588-3820610 ACAGCTAAAATGTCCTCAAAGGG + Intronic
1186206275 X:7204422-7204444 ACATCTAATATTTTTTAAAATGG - Intergenic
1187032204 X:15499495-15499517 ACAACTTATATATGGTAATATGG - Intronic
1187435564 X:19265726-19265748 ATAGCTAATAAGTGGCCAAACGG - Intergenic
1187647286 X:21361960-21361982 TCAGCTTAAATGAGGTAAAAAGG - Intergenic
1190133575 X:47773262-47773284 ACAGCTAATCTGGGCTAGAAAGG + Intergenic
1192142546 X:68658321-68658343 ACAGCTATTAAGTGGTGAATTGG + Intronic
1194957612 X:100199141-100199163 AATGCTAACATGTGGTGAAATGG - Intergenic
1196480989 X:116147861-116147883 ACAGCTAAGAAGTGGCAAAGCGG - Intergenic
1197419819 X:126224941-126224963 ATAGCTGATAGATGGTAAAATGG - Intergenic
1197883936 X:131198354-131198376 ACAGCTAATATGAGATAAGCTGG + Intergenic
1198167473 X:134071748-134071770 ACAGTTAGTAAGTGGTAGAAGGG - Intergenic
1199406997 X:147474096-147474118 AGGGCTAATACGTGCTAAAATGG + Intergenic
1201267488 Y:12222200-12222222 CCATCAAATATGCGGTAAAACGG + Intergenic