ID: 1173383657

View in Genome Browser
Species Human (GRCh38)
Location 20:42568682-42568704
Sequence ACAGCTCTCTGTAGGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173383657_1173383660 -4 Left 1173383657 20:42568682-42568704 CCTCCTGGCCTACAGAGAGCTGT 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1173383660 20:42568701-42568723 CTGTCTGAGCTGCTAAACCCAGG 0: 1
1: 0
2: 0
3: 2
4: 115
1173383657_1173383663 14 Left 1173383657 20:42568682-42568704 CCTCCTGGCCTACAGAGAGCTGT 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1173383663 20:42568719-42568741 CCAGGATGCTTCAACTGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 98
1173383657_1173383664 24 Left 1173383657 20:42568682-42568704 CCTCCTGGCCTACAGAGAGCTGT 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1173383664 20:42568729-42568751 TCAACTGTCCTGGATTCATCTGG 0: 1
1: 0
2: 0
3: 11
4: 102
1173383657_1173383665 25 Left 1173383657 20:42568682-42568704 CCTCCTGGCCTACAGAGAGCTGT 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1173383665 20:42568730-42568752 CAACTGTCCTGGATTCATCTGGG 0: 1
1: 0
2: 0
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173383657 Original CRISPR ACAGCTCTCTGTAGGCCAGG AGG (reversed) Intronic
900799200 1:4727131-4727153 ACAGCTCTCACTGTGCCAGGCGG + Intronic
905973502 1:42157984-42158006 GCTGCTCTCTGTGGGCCTGGCGG + Intergenic
908846168 1:68326503-68326525 ACAGCCTTCTGAAAGCCAGGAGG + Intergenic
912786257 1:112606772-112606794 ACTGCTCTCTGAAGGCCAGGAGG - Intronic
913971284 1:143420159-143420181 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
914065661 1:144245772-144245794 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
914113490 1:144720582-144720604 GCAGCTCTATGGAGGCCTGGCGG - Intergenic
915554865 1:156655809-156655831 ACAGTTCTGTATAGTCCAGGTGG - Intronic
916876838 1:168978554-168978576 ATAGCTCTCAGGAAGCCAGGTGG + Intergenic
918039906 1:180907738-180907760 GCAGCTGTCTGCAGGCCAGGAGG - Intergenic
920935922 1:210434364-210434386 ATAGCTTTCTGAAGGCCAGTGGG + Intronic
921074199 1:211686502-211686524 ACAGTTCACTGGAGGCCATGTGG - Intergenic
922226238 1:223648283-223648305 ACAGCTCCATGTGGCCCAGGGGG - Intronic
922474333 1:225896951-225896973 ACAGCTCTCTGCATGCCTGAGGG - Intronic
922709655 1:227816893-227816915 ACATCCCTCTGGAGGCCAGATGG - Intronic
923059885 1:230462068-230462090 ACAGATCACTTGAGGCCAGGAGG + Intergenic
924607350 1:245546412-245546434 ATAGCTCTCTGTTGTTCAGGAGG + Intronic
1065069105 10:22003676-22003698 ACAGCTGTGTGTAGGCCTGGGGG - Exonic
1067053073 10:43036301-43036323 TCAGCTCTCTAGAGGCAAGGAGG + Intergenic
1070497211 10:77035333-77035355 ACATCTCCCTGTAGGCTGGGGGG - Intronic
1070498663 10:77049342-77049364 ACATCTCTCAGGAGGCCATGTGG + Intronic
1073682458 10:105719109-105719131 ACAGAACTCTGGAAGCCAGGTGG - Intergenic
1074109307 10:110411169-110411191 AAAGCTTGCTGTAGGCGAGGAGG - Intergenic
1074572490 10:114636689-114636711 TAAGCTCTCTGAAGGCAAGGAGG + Intronic
1075629945 10:123994821-123994843 CCAGCTCACTGGAGACCAGGAGG - Intergenic
1076248493 10:128966327-128966349 ACAGCTGGCTGGAGGCCACGGGG - Intergenic
1077116006 11:884934-884956 CCAGCTCTCCCTGGGCCAGGCGG - Intronic
1077310472 11:1886758-1886780 GCAGCTCTATGGAGGCCTGGCGG - Exonic
1077556635 11:3229105-3229127 GCTGGTCCCTGTAGGCCAGGTGG + Intronic
1080989790 11:37517401-37517423 TCAGCTCACTGTAGAGCAGGAGG - Intergenic
1083365294 11:62138557-62138579 ACAGCCCCCTGTAGGATAGGAGG - Intronic
1083609529 11:63998440-63998462 AGAGCTCTCGGTGAGCCAGGCGG - Intronic
1084158320 11:67328648-67328670 ACAGCCATCTATAGGCCAAGGGG + Intronic
1084171048 11:67401304-67401326 ACAGCTGCCTGTGGGCAAGGAGG - Intronic
1086345546 11:85892104-85892126 AAAGCTCTCAACAGGCCAGGAGG + Intronic
1086399013 11:86445862-86445884 ACAGCTTTCTGTAAGGGAGGGGG - Intronic
1088560430 11:111110073-111110095 ACTGTTCTTTGTAGGCCAGTGGG - Intergenic
1088921175 11:114260692-114260714 GCAGCTCTCTGAAGACCAGATGG + Intronic
1090943467 11:131409337-131409359 ACACCTCTTTGTAGCCCAGATGG - Intronic
1091854544 12:3728792-3728814 GCAGCTCTCTGGAGGCCACTCGG - Intronic
1094675518 12:32616286-32616308 ACAGCTCTTTGGAGTCCAGGTGG + Intronic
1098164235 12:67677223-67677245 GCAGCTGTCTGAAAGCCAGGAGG - Intergenic
1098581821 12:72108876-72108898 ACAGCTTTGTGTAGGCCACTGGG + Intronic
1099758797 12:86892508-86892530 GCAGCTCTCTGGAGGTCTGGGGG - Intergenic
1100112569 12:91263149-91263171 ACAGCTTTCAGTAGGACAGCCGG - Intergenic
1101568552 12:105932507-105932529 ACAGCTCTGAGTAGGCGGGGTGG + Intergenic
1102839297 12:116100822-116100844 ACAGATCACTGGAGCCCAGGAGG + Intronic
1103741229 12:123092918-123092940 ACAGTTCTCAGTTGGCGAGGGGG - Intronic
1105616169 13:22014837-22014859 AAAGCACTCTGTAGGCCTGCTGG - Intergenic
1105926938 13:25017429-25017451 GCAGCTCTATGGAGGCCTGGCGG - Intergenic
1110058592 13:71011469-71011491 ACATCTGAATGTAGGCCAGGTGG - Intergenic
1111250439 13:85594565-85594587 ACAGCTCACTGAAAGTCAGGAGG - Intergenic
1112035922 13:95496614-95496636 GCAGCCATCTGCAGGCCAGGAGG - Intronic
1114478826 14:23018168-23018190 GCAGCTCTCTGCAAGCCAAGGGG + Intronic
1118074050 14:62279439-62279461 GCAGCTGTCTGCAAGCCAGGAGG - Intergenic
1119144234 14:72295432-72295454 GCAGCTCTCTCTGGGCCAGCCGG - Intronic
1121009471 14:90511588-90511610 GGAGTTCTCTGAAGGCCAGGTGG - Intergenic
1121038911 14:90729073-90729095 ACAGCCTTTTGTAGGCCATGTGG + Intronic
1121862155 14:97328752-97328774 ACAGTTCAATGTAGGTCAGGTGG + Intergenic
1121931928 14:97979993-97980015 ACTGCTCTCTGTATTCCAAGTGG - Intergenic
1122205148 14:100144643-100144665 ACAGCCCATTGCAGGCCAGGTGG - Exonic
1122289064 14:100669866-100669888 ACAGCTCTGTGCATGGCAGGAGG - Intergenic
1127674582 15:61227981-61228003 ACAGCTCACTTTAGGAAAGGAGG + Intronic
1128331207 15:66756898-66756920 AAAGCTCCCTGTAGGGGAGGAGG - Intronic
1131545763 15:93314464-93314486 ACCCCACTCTGTAGGCCAGCTGG - Intergenic
1132261944 15:100433568-100433590 AGAGCTCTCTGTAGGGTTGGTGG + Intronic
1132291902 15:100709802-100709824 ACAGCTGTGTCTAGGCCAGATGG + Intergenic
1133245957 16:4448930-4448952 ACTGCTCCCTGTAAGTCAGGTGG + Intronic
1133496891 16:6327024-6327046 ACAGCTCTCTGAAGACATGGAGG + Intronic
1133678804 16:8100903-8100925 GCAGCTCACTGAAGGCAAGGGGG + Intergenic
1134572573 16:15303892-15303914 GCAGCTTTCTGCAAGCCAGGAGG + Intergenic
1134729809 16:16452130-16452152 GCAGCTTTCTGCAAGCCAGGAGG - Intergenic
1134937622 16:18259766-18259788 GCAGCTTTCTGCAAGCCAGGAGG + Intergenic
1136298805 16:29319632-29319654 AGAGCTCTCCGTAGCGCAGGTGG + Intergenic
1138263532 16:55643296-55643318 CCAGCTCAGTGTAGCCCAGGAGG - Intergenic
1138422836 16:56910972-56910994 ACAGCTGTCTCTCGGACAGGTGG + Intronic
1138659714 16:58509848-58509870 TCAGCTCTCTGAATGCCAGGCGG - Intronic
1139231683 16:65289184-65289206 CCAGCTGTCTATATGCCAGGAGG + Intergenic
1140243859 16:73230873-73230895 ACAGCTCTTTTCAGGACAGGAGG + Intergenic
1141173145 16:81703831-81703853 ACAGCTCTCTGTAGGGCGAGGGG + Intronic
1141430850 16:83969519-83969541 CCAGCTCTCTGTAGGGTAGAGGG - Intronic
1142060474 16:88026130-88026152 AGAGCTCTCCGTAGCGCAGGTGG + Intronic
1142765480 17:2061793-2061815 GCAGCCCTCTCTAGGCCAGCAGG - Intronic
1143214465 17:5214096-5214118 GCAGCTGTCTGCAAGCCAGGAGG + Intronic
1143265759 17:5636045-5636067 GCAGCTGTCCCTAGGCCAGGTGG - Intergenic
1143266058 17:5638950-5638972 GCAGCTGTCTCTAGGCCTGGTGG + Intergenic
1144762348 17:17714454-17714476 AAACCTCTCCATAGGCCAGGAGG + Intronic
1147262912 17:39219073-39219095 ACAGCTGTATGGAGGACAGGTGG - Intronic
1147587069 17:41658864-41658886 ACAGGTCTCTGTAACTCAGGTGG + Intergenic
1148090583 17:45020513-45020535 ACAGCCCGCTGTGGGCCACGGGG - Intergenic
1149443713 17:56697537-56697559 GCAGCTGTCTGCAGGCCAGGTGG - Intergenic
1151647817 17:75445521-75445543 AGAGATCTCTGTAGGACAGTTGG + Intronic
1152118172 17:78401514-78401536 GCAGCTCTCTAAAGGCCATGGGG - Intronic
1153961905 18:10147354-10147376 GCAGCTCTCTGCAGCCCAGGTGG + Intergenic
1155054575 18:22172073-22172095 ACAGCTCGCTGTCGGCCGCGCGG + Exonic
1159198036 18:65143729-65143751 ACAGGGTTCTGTAGGCCAGAAGG - Intergenic
1159434407 18:68397422-68397444 GCAGCTGTCTGTAAGCCAAGGGG - Intergenic
1159833071 18:73302171-73302193 ACAGCTCTCTGTATGTCAATCGG + Intergenic
1160673167 19:375864-375886 ACAGAGCTCTGGAGGCCACGGGG + Exonic
1161232211 19:3180001-3180023 ACAGCTTCCTGTACCCCAGGAGG - Exonic
1161572857 19:5039991-5040013 ACTTCTCGCTGTTGGCCAGGCGG - Exonic
1162797758 19:13095482-13095504 CCCTCTCTCTGCAGGCCAGGAGG + Exonic
1168724237 19:58572061-58572083 ACAGCTCTCTCTTTACCAGGTGG + Intronic
927222648 2:20728309-20728331 ACAGGTCTGTGGGGGCCAGGGGG + Intronic
927882283 2:26697278-26697300 ACAGATCGCTTGAGGCCAGGAGG + Intronic
928206479 2:29288175-29288197 ACAGGTCTGAGTAGGGCAGGGGG + Intronic
928224658 2:29438045-29438067 GCAGCCCTCTGAAGGTCAGGTGG - Intronic
928224701 2:29438653-29438675 GCAGCCCTCTGAAGGTCAGGTGG - Intronic
929646466 2:43633404-43633426 ACAGCTCTCTCTAGCTGAGGAGG - Intergenic
931296495 2:60931922-60931944 GCAGCCCTCTGCAAGCCAGGAGG - Intergenic
931976255 2:67647027-67647049 ACAGCTCTCAATAGGAGAGGGGG + Intergenic
934175979 2:89581092-89581114 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
934286289 2:91655454-91655476 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
934545995 2:95217083-95217105 GCAGCTATCTGTAAGCCAGGAGG - Intronic
939256554 2:139751088-139751110 ACAGCCATCTGTAAGCCAGGAGG - Intergenic
941158881 2:162012640-162012662 ACAGCTCTGTGTAGGGTAGATGG - Intronic
941989666 2:171542789-171542811 ACAGCTCCCTTGAGACCAGGAGG + Intronic
942413520 2:175735405-175735427 CCAGCTCTCTCTAGCCCTGGTGG - Intergenic
947595454 2:231408878-231408900 ACAGTTCTCTCTTGGCCAGCCGG + Intergenic
948088858 2:235273941-235273963 ACTGCTCTCTGTAATGCAGGTGG + Intergenic
1169688488 20:8304052-8304074 ACAGCTCTCTGTCTGTAAGGGGG + Intronic
1173383657 20:42568682-42568704 ACAGCTCTCTGTAGGCCAGGAGG - Intronic
1174292695 20:49520096-49520118 ACAGGTCCCTGTAGGCCATGGGG - Intronic
1175111230 20:56649502-56649524 AAAGCACAGTGTAGGCCAGGCGG - Intergenic
1175543239 20:59761373-59761395 GCAGCTGGCTGTGGGCCAGGTGG - Intronic
1176247736 20:64105390-64105412 ACGGCTGTCTGTAGGTCTGGTGG + Intergenic
1176277214 20:64279196-64279218 ACAGATCTCTGTGGACCAGGAGG - Intronic
1176307635 21:5132466-5132488 ACAGAGCTCTGTAGGGGAGGAGG - Intronic
1178027743 21:28487362-28487384 AAAACTTTCTGTAGGCCAGGTGG - Intergenic
1178878238 21:36428963-36428985 AGAGCTCTCTGGATGCCATGTGG + Intergenic
1178922720 21:36748909-36748931 ACAGATCTGTGTGGGCCAGAGGG - Exonic
1179849425 21:44129564-44129586 ACAGAGCTCTGTAGGGGAGGAGG + Intronic
1180490376 22:15840377-15840399 ACTGCTCTGTGTAGTCCATGCGG - Intergenic
1184348273 22:43926053-43926075 ACAGCCCTCTGTGAGACAGGGGG - Intronic
1184730141 22:46367273-46367295 GCTGCTATCTGGAGGCCAGGTGG + Intronic
1184946011 22:47804712-47804734 ACAGATCTCTCCAGGGCAGGGGG - Intergenic
1185130830 22:49037667-49037689 GCAGCTCTCTGAAGGCCAAAGGG + Intergenic
949361608 3:3238051-3238073 GTAGCTCTCTGTGGCCCAGGGGG - Intergenic
951940262 3:28069885-28069907 ACATCACTTTGTAGGCAAGGTGG - Intergenic
952644123 3:35635702-35635724 ACAGTGCTCTGTGGGCCAGGAGG + Intergenic
956487569 3:69739304-69739326 ACAGCTCCCAGAAGGCCAGGCGG - Intergenic
956745427 3:72307249-72307271 ACAGTCCTCTGGAGGCCAGAAGG - Intergenic
957048606 3:75395214-75395236 GCAGCTCTATGGAGGCCTGGTGG - Intergenic
957459970 3:80503681-80503703 ACAGCTCTCTGCCTGCAAGGCGG - Intergenic
958108927 3:89114506-89114528 TCAGCCCTCTGGAGGCCAGTGGG + Intronic
960617541 3:119609542-119609564 ACAGCTCTTCGGAGGCCAGCTGG + Exonic
961422459 3:126817144-126817166 ACTGCTCTCTCTGGGCTAGGTGG + Intronic
967354698 3:188555374-188555396 GCAGCTTTCTGTAGGCTATGTGG + Intronic
968441057 4:624803-624825 CCAGCTCCCTGCAGGCCAGCAGG - Intergenic
969526198 4:7705320-7705342 TCAGCGCTCTGGAGGCCAGAAGG - Intronic
972639006 4:40908889-40908911 ACAGATCACTGGAGGCAAGGAGG + Intronic
973594620 4:52474150-52474172 ACAGCACTCTGTAGTGGAGGCGG - Intergenic
974905073 4:68045246-68045268 ACTGCTCTCTGGGGGCTAGGGGG - Intergenic
980234216 4:130083651-130083673 ATTACTCTCTGTAGCCCAGGTGG + Intergenic
981082494 4:140649180-140649202 AAAGCTCAATGTAGGCCAGAGGG + Intronic
983677653 4:170314907-170314929 ACATCTCTCTGGTGGTCAGGTGG + Intergenic
983967288 4:173828517-173828539 ATAGATCTCTGTAGGGCAGAGGG + Intergenic
985919677 5:2960449-2960471 ACAGGTCCCTGGAGGCCAGCTGG + Intergenic
986383866 5:7211916-7211938 ACACCTCTCTGCAGGCCACCTGG + Intergenic
986570853 5:9163815-9163837 GCAGCCATCTGTAAGCCAGGAGG + Intronic
988263888 5:28926842-28926864 GCAGCTCTATGGAGGCCTGGCGG - Intergenic
992127257 5:73654485-73654507 CCAGCTCTCTCCAGGCCATGAGG - Intronic
992617500 5:78558954-78558976 GCAGCTCTCTGTGGCACAGGAGG - Intronic
993879102 5:93342231-93342253 ACAGCACTCTGTACACAAGGTGG + Intergenic
994197604 5:96936589-96936611 GCAGCTCACTGAAGGGCAGGGGG - Intronic
994225483 5:97247686-97247708 ACAGCTCTCTTTAGAACATGAGG - Intergenic
996921462 5:128772435-128772457 ACAGCTCCATGTAGGTCAGTGGG - Intronic
997149418 5:131476754-131476776 ACAGATCACTTGAGGCCAGGAGG - Intronic
997515657 5:134487526-134487548 GCAGCTCTCTGCAGCTCAGGTGG + Intergenic
997954034 5:138264493-138264515 ACAGCTGTCTCCAGGCCAGGAGG - Exonic
1001445621 5:171780390-171780412 CCAGTTCTCTGAGGGCCAGGTGG + Intergenic
1002635515 5:180606043-180606065 ACAGCATTCTGTATGCCAAGCGG + Intronic
1002639462 5:180623834-180623856 CCAGCACTCTGGAAGCCAGGTGG + Intronic
1003401402 6:5794105-5794127 ACAGTCCTCTGCAGACCAGGGGG - Intergenic
1004460243 6:15828497-15828519 CCTGCCCTCTGTAGTCCAGGTGG - Intergenic
1004553743 6:16675095-16675117 AGAGCTCTCTGAAGTCTAGGGGG + Intronic
1005699119 6:28382298-28382320 ACAGCTCTGTGAAGTCCAAGTGG + Exonic
1017749688 6:157479805-157479827 CCAGCTCTCTCTGGGCCAGGAGG - Intronic
1018847819 6:167567331-167567353 GCAGCTCTCTGCAGCCCAGGCGG + Intergenic
1018926620 6:168211243-168211265 GCAGCCCTCTGCAAGCCAGGAGG + Intergenic
1019564345 7:1672022-1672044 ACAGCTGGCTGTAGGACAGGGGG - Intergenic
1021862263 7:24917722-24917744 AAGGCTCTCTGTGGGCTAGGGGG + Intronic
1025063050 7:55827525-55827547 ACAGGTCTCTGTAGGGAGGGAGG - Intronic
1025731898 7:64114858-64114880 AAAGCTGCCTGTGGGCCAGGAGG - Intronic
1025908655 7:65809904-65809926 AAAGATCTCTTTAGCCCAGGAGG + Intergenic
1029188646 7:98756529-98756551 ACAGATCTCTTGAGCCCAGGAGG - Intergenic
1030995568 7:116354896-116354918 AGAGGTCTCTGTTGCCCAGGAGG - Intronic
1032852054 7:135803533-135803555 TCACCTCTCTGTAGGCTAGTAGG + Intergenic
1034513149 7:151552704-151552726 ACTGCTCTCCGCTGGCCAGGAGG + Intergenic
1035094899 7:156346141-156346163 ACATCTCTCTGCAAGCCGGGTGG - Intergenic
1035597310 8:868801-868823 ACCGCGCTCTCTAGGCCCGGAGG - Intergenic
1035648009 8:1243206-1243228 CAGGCTCTCTGAAGGCCAGGCGG - Intergenic
1038817478 8:30919908-30919930 GTAGCTGTCTGTAAGCCAGGAGG + Intergenic
1048806095 8:138242661-138242683 ATGGTTCTCTGTAGGTCAGGAGG - Intronic
1048972079 8:139650808-139650830 TCAGCTCCCTGAAGGCCATGGGG - Intronic
1049731223 8:144179553-144179575 TCATCTCGCTGGAGGCCAGGAGG - Exonic
1051499254 9:17759130-17759152 TCACCTCCCTGTGGGCCAGGTGG + Intronic
1051649509 9:19307303-19307325 AAAGATCACTGTAGTCCAGGAGG + Intronic
1053175273 9:35917877-35917899 AGAGCTCTCTGGCGGCCGGGTGG - Intergenic
1053715380 9:40883646-40883668 GCAGCTCTATGGAGGCCTGGTGG - Intergenic
1054077167 9:60547088-60547110 GCAGCTCTATGGAGGCCTGGTGG + Intergenic
1055624955 9:78166885-78166907 ACAGCTATCTTGAGGCCATGAGG + Intergenic
1056479217 9:86984093-86984115 ACAGCCCTCTGTAGGCGTGATGG + Intergenic
1057317516 9:93979328-93979350 ACAGCACTCTGGAGGCCATCTGG + Intergenic
1057707032 9:97402245-97402267 ACAGCTATCTGTGAACCAGGGGG - Intergenic
1058339531 9:103877741-103877763 GCAGCTGTCTGTAAGCCAGGAGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061059943 9:128245216-128245238 AAAGCCCTCTTTATGCCAGGCGG - Intronic
1061227415 9:129288769-129288791 GCAGGTCTCAGGAGGCCAGGAGG - Intergenic
1061456103 9:130699016-130699038 ACAGCCCTCTGTGGTCCAGCAGG - Intronic
1062491378 9:136806742-136806764 ACTTCTCTCTGTAGGCCGGGAGG - Exonic
1187861297 X:23686027-23686049 ACAGCTCTCTCTTGGCCACCAGG - Intronic
1188002059 X:24992175-24992197 GCAGCTCTCTGTAGGTCGGATGG + Intronic
1188515910 X:30985721-30985743 ACAGCTCTCTCTAGGGGACGAGG + Intergenic
1189061073 X:37754268-37754290 TTAGCTGTCTGTAGGCCATGGGG - Intronic
1189287358 X:39861110-39861132 AGACCTTTCTGGAGGCCAGGCGG - Intergenic
1197766645 X:130063647-130063669 ACCCCTACCTGTAGGCCAGGAGG + Intergenic
1198032161 X:132763770-132763792 ACACCTCTCTGTCTGCCAGCTGG - Intronic
1199814250 X:151383753-151383775 ACAGCTGTCTGTAAACTAGGAGG + Intergenic