ID: 1173383659

View in Genome Browser
Species Human (GRCh38)
Location 20:42568690-42568712
Sequence CAGCTCAGACAGCTCTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173383659_1173383665 17 Left 1173383659 20:42568690-42568712 CCTACAGAGAGCTGTCTGAGCTG 0: 1
1: 0
2: 1
3: 24
4: 201
Right 1173383665 20:42568730-42568752 CAACTGTCCTGGATTCATCTGGG 0: 1
1: 0
2: 0
3: 12
4: 115
1173383659_1173383664 16 Left 1173383659 20:42568690-42568712 CCTACAGAGAGCTGTCTGAGCTG 0: 1
1: 0
2: 1
3: 24
4: 201
Right 1173383664 20:42568729-42568751 TCAACTGTCCTGGATTCATCTGG 0: 1
1: 0
2: 0
3: 11
4: 102
1173383659_1173383663 6 Left 1173383659 20:42568690-42568712 CCTACAGAGAGCTGTCTGAGCTG 0: 1
1: 0
2: 1
3: 24
4: 201
Right 1173383663 20:42568719-42568741 CCAGGATGCTTCAACTGTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173383659 Original CRISPR CAGCTCAGACAGCTCTCTGT AGG (reversed) Intronic
900972794 1:6000765-6000787 CAGCACAGACAGCCCTCTCCAGG + Intronic
901323201 1:8351680-8351702 CAGCCCAGAAAGCTGACTGTTGG - Intergenic
901469712 1:9447888-9447910 TACCTCTGACAGCTCTCTGAAGG - Intergenic
902115720 1:14119374-14119396 CTGCTCAGACAGTTCGCTGTTGG + Intergenic
902429922 1:16354885-16354907 TGGCTCATACAGCTCTCTATGGG - Intronic
904360148 1:29965904-29965926 CTGCTCAGACAGCTATCAGGAGG - Intergenic
904425382 1:30419416-30419438 CAGCCCATAGAGCTCTCTGAAGG + Intergenic
906669568 1:47644814-47644836 CAGCTCACTCATGTCTCTGTCGG - Intergenic
908519453 1:64927081-64927103 CAGCCCTGACTGCTCTCTGCAGG + Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
913145564 1:115986515-115986537 AAGCTCAGATATCTCTCTGACGG - Intronic
915634360 1:157176003-157176025 AAGCTCAGGCAGATCTCTGAGGG - Intergenic
917345983 1:174028647-174028669 AAGTTCAGACAGCTCAATGTTGG - Intergenic
922226871 1:223653035-223653057 CGCCTCAGACAGCTCCTTGTTGG - Intronic
922555625 1:226530039-226530061 CACCACAGACTGGTCTCTGTTGG - Intergenic
922975781 1:229782314-229782336 CAGCCCAGTCATCTCTCTGTGGG - Intergenic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1067422896 10:46173010-46173032 CAACTCAGTCTGCTCTCAGTAGG - Intergenic
1068941805 10:62688041-62688063 CAGCTCATGCTGCTCTCTGAGGG + Intergenic
1070436037 10:76394591-76394613 CAGCTCACTCAGCTTTCTGGAGG + Intronic
1071152393 10:82650853-82650875 CAACTCTGTCAGATCTCTGTAGG - Intronic
1073726857 10:106242548-106242570 CAGAACAGAGAGCTCTCTGGAGG + Intergenic
1075631858 10:124005254-124005276 CAGCTCAGGCAGGTCTGAGTGGG - Intergenic
1075786602 10:125054096-125054118 CAGCTTGGAAAGCTCTCAGTGGG - Intronic
1076666240 10:132094586-132094608 CTGCCCAGAGAGCTGTCTGTGGG + Intergenic
1076944782 10:133638266-133638288 CAGCTCAGCCCCCTCTCTGACGG + Intergenic
1078752595 11:14179120-14179142 CAACTCAGTCAGCTCTGTATTGG + Intronic
1079857728 11:25627772-25627794 CAGTTCGGACAGCCCTCTTTGGG + Intergenic
1081747027 11:45480629-45480651 CAGCTCCAACTGCTGTCTGTGGG + Intergenic
1084232795 11:67765388-67765410 CAGCCCAGAGTGCTCTCTGGAGG + Intergenic
1085843314 11:80038579-80038601 CTGCTGAAACTGCTCTCTGTGGG + Intergenic
1086033850 11:82393077-82393099 CAGCTAAGACAGCTTCCTTTTGG - Intergenic
1086104248 11:83132160-83132182 CAGCTCAGGTAGCTCTTAGTAGG - Intergenic
1088645690 11:111914350-111914372 CAGCTCAGACAGTGCCCTCTGGG - Intronic
1088695903 11:112365724-112365746 CAGCTCAGAGATATGTCTGTAGG + Intergenic
1088699165 11:112396719-112396741 CAGCTCAGACTGCTCTGTGGTGG + Intergenic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1090489630 11:127147191-127147213 CAGGTAAGACAGACCTCTGTGGG + Intergenic
1091782173 12:3220774-3220796 CAGCACAGAGGGCTCTCGGTGGG + Intronic
1092048961 12:5454532-5454554 CAGCTCACCCTGCACTCTGTGGG - Intronic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1101788614 12:107908703-107908725 GAGCTCAGAGAGCTCTGTGGAGG + Intergenic
1102185563 12:110945586-110945608 CAGCTGACACAGCTCAATGTGGG + Intergenic
1102939485 12:116926710-116926732 AAGAGCTGACAGCTCTCTGTGGG - Intronic
1103014856 12:117486033-117486055 CCACTCAGACAGCATTCTGTTGG + Intronic
1103633496 12:122282946-122282968 CAGCTCATCCGGCTCACTGTGGG - Intronic
1105281187 13:18963622-18963644 CAGCTCAGAGAGCCTTGTGTGGG - Intergenic
1105290389 13:19049638-19049660 CAGCTCAGAGAGCCTTGTGTGGG - Intergenic
1105743544 13:23354614-23354636 CAGCCCAAGCAGCTCACTGTAGG + Exonic
1106304791 13:28500042-28500064 CTGCTCAGCCAGGTCACTGTTGG - Intergenic
1107599470 13:41998647-41998669 CAGCTCAGAGAGGTCGCTCTTGG - Intergenic
1107741353 13:43453667-43453689 TAGCTCAAAAAGCTCTCTGAGGG - Intronic
1108722447 13:53146023-53146045 CAGCTCATAGAGCTCACTGTGGG - Intergenic
1111145286 13:84170721-84170743 CAGCTGAAAAAGCTCTCTGATGG + Intergenic
1111455857 13:88483331-88483353 GAGCTCAGGCAGCTCACTGGTGG - Intergenic
1113176197 13:107566773-107566795 CTGTTCACACAGCTCTCTTTAGG - Intronic
1113668831 13:112161317-112161339 AAAATCAGACAGTTCTCTGTGGG + Intergenic
1114392040 14:22320151-22320173 AAGCTCACACAGGTCTCTGTTGG - Intergenic
1114752307 14:25218726-25218748 CAGCTTAGATAACTCACTGTAGG + Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116256709 14:42566381-42566403 CAGTTCAGACAGAGCTCAGTGGG - Intergenic
1121225049 14:92315612-92315634 CAGCTCGGGCAGCTGTCTGCAGG - Intergenic
1122928618 14:104923025-104923047 CAGCTCAGGCAGCTCTACCTCGG - Intergenic
1122930447 14:104931001-104931023 CAGCCCAGAGGGCTCCCTGTGGG - Intronic
1124634055 15:31353729-31353751 CAGCCCTGCCAGCTCACTGTTGG - Intronic
1125934782 15:43625764-43625786 CTGCACAGCCAGCTCTGTGTGGG + Intergenic
1125947675 15:43723276-43723298 CTGCACAGCCAGCTCTGTGTGGG + Intergenic
1127665575 15:61143293-61143315 CAGCTTTTACATCTCTCTGTAGG - Intronic
1129207450 15:74045412-74045434 CACCTCAGACTGTTCTGTGTGGG - Exonic
1130677183 15:85963396-85963418 CATCTCAAACATCTCTCAGTAGG + Intergenic
1135539747 16:23320818-23320840 CAGCAGCCACAGCTCTCTGTGGG - Intronic
1137640536 16:50025121-50025143 CAACTAAGACAGCTTTCTATTGG - Exonic
1137935729 16:52633614-52633636 AAGCCCACACAGCTCTCTGAGGG - Intergenic
1139667327 16:68466791-68466813 CAACTCAGCCAGCTCTTTGCTGG + Intergenic
1140569301 16:76084556-76084578 CAGCTCTGAAAGCTCTGTCTTGG + Intergenic
1143498751 17:7326981-7327003 CACCTCAGACAGCTCCATGTTGG + Exonic
1144322813 17:14146773-14146795 GAGCTCAAACAACTCTCTATAGG + Intronic
1151523512 17:74647926-74647948 CAGCTCCAACTGCTGTCTGTGGG + Intergenic
1151764305 17:76124328-76124350 CAGCACAGACTGCCCACTGTGGG - Intergenic
1152132637 17:78486278-78486300 CAGCTCGTACAGCTCCCTGGGGG + Exonic
1152739696 17:82013498-82013520 CAGCCCCGCCAGCTCTCTGACGG - Intronic
1152880174 17:82810070-82810092 CTGCTCCGAGAGCTTTCTGTGGG + Intronic
1153105923 18:1526557-1526579 CAGCTGAGACAGTACTCTGTTGG - Intergenic
1153436729 18:5075778-5075800 AGGCTCAGACAGCACCCTGTAGG - Intergenic
1153975214 18:10263127-10263149 CTGCTCACACCGCCCTCTGTGGG + Intergenic
1154388193 18:13914276-13914298 CTGCTCCCACAGCTCTTTGTGGG + Intronic
1156492817 18:37506368-37506390 CAGACCAGCCAGCTCCCTGTAGG + Intronic
1156521890 18:37728900-37728922 CAGCTCAGACAGGGCACTGGAGG - Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1158560160 18:58506782-58506804 CTGGACAGACAGTTCTCTGTGGG + Intronic
1159413196 18:68108049-68108071 CAACTCAGAGAGCTCCCAGTGGG - Intergenic
1160505167 18:79422890-79422912 CAGAGCCGACAGCTCCCTGTAGG - Intronic
1161362834 19:3860849-3860871 CAGCACAGACAGGGCTCTGCAGG - Intronic
1162779145 19:12997556-12997578 CAGCTCAGACACCGCTGGGTAGG - Intronic
1164286553 19:23822347-23822369 TAGCCCAGGCAGCTCTCTGCTGG - Intronic
1164435231 19:28222995-28223017 CAGCTCAAACAGCTCTGTGCTGG + Intergenic
1164583610 19:29450712-29450734 CAGGTCTGAGAGCGCTCTGTGGG + Intergenic
1164985023 19:32642106-32642128 CAGCTGAGCCAGCTCTCTTTTGG + Exonic
1165227791 19:34366469-34366491 CAGCTCACCCACCACTCTGTCGG - Intronic
1166579685 19:43883847-43883869 TATCTCAGAAAGCTCTCTCTTGG - Intronic
1167114828 19:47483200-47483222 AGGTTCAGGCAGCTCTCTGTAGG + Exonic
926712026 2:15889561-15889583 CAGCTGGGGCAGCTCTCTGATGG + Intergenic
927005390 2:18843183-18843205 CCACTCAGACAGCCATCTGTTGG - Intergenic
928101002 2:28437378-28437400 GAGCTCAGCCAGCTCCCTCTGGG + Intergenic
928321008 2:30282856-30282878 CAGCTCAGGCAGCTCCCAGGGGG + Intronic
930190238 2:48451385-48451407 CATCACAGACAGCTTTCTGAGGG + Intronic
930885977 2:56327373-56327395 CAGTTCAAACAGCTCTAGGTTGG - Intronic
932819096 2:74884526-74884548 CTGGTCAGCCAGCTCTCTGAGGG + Intronic
935685897 2:105682235-105682257 CAGCTCTCAGAGCTCTGTGTAGG - Intergenic
937472057 2:122182666-122182688 CATCTCAGCCTTCTCTCTGTCGG + Intergenic
938577994 2:132621513-132621535 CAGCACTGCCAGCTCTCTGTGGG + Intronic
938968016 2:136405406-136405428 CATCTAAGCCAGCTCTGTGTAGG + Intergenic
939876826 2:147587114-147587136 CAGCTCAGAGAGGTCTTTGAAGG - Intergenic
941438173 2:165497808-165497830 CAGACCACACAGCTCTCTGATGG + Intronic
944420739 2:199527271-199527293 CAGCTCAGACAGGTCGATGTTGG - Intergenic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
946353998 2:219173407-219173429 CAGCACACACAGGTCTGTGTAGG + Exonic
948251338 2:236532277-236532299 CCTCTCAGAAAGCTCTCTGGTGG + Intergenic
948432860 2:237931129-237931151 CAGCTCAAAAATCTCCCTGTGGG - Intergenic
948574542 2:238941223-238941245 GAGCTCAGACAGGTCTCTGTGGG + Intergenic
948752975 2:240143168-240143190 CAGCCCAGAATGCCCTCTGTAGG + Intronic
1169028254 20:2387614-2387636 CAGCCCAGACAGCTCACAGGTGG + Intronic
1169907116 20:10615560-10615582 CAGCTCAGACCTCCCTCTGCCGG + Intronic
1170474448 20:16701050-16701072 CAGCCCAGACTTCTCTCTCTTGG + Intergenic
1171782115 20:29428262-29428284 CAGCTCAGCCCCCTCTCTGACGG + Intergenic
1173383659 20:42568690-42568712 CAGCTCAGACAGCTCTCTGTAGG - Intronic
1173511300 20:43630937-43630959 CAGCACAGTCAGCTCTCTCTGGG + Intronic
1173521503 20:43703520-43703542 CAGCCCAGACACCTCTCTGCAGG - Intronic
1178192435 21:30299960-30299982 CAGCTCAGTCAATTCTATGTTGG - Intergenic
1179158790 21:38874999-38875021 CAGCTCACACAGCTTTCTTGGGG - Intergenic
1184750518 22:46483744-46483766 CAGGACACACAGCTGTCTGTTGG + Intronic
950270048 3:11606676-11606698 CACATCAATCAGCTCTCTGTGGG + Intronic
953260559 3:41334720-41334742 CATCTCAGACATATTTCTGTAGG - Intronic
953607241 3:44419953-44419975 CAGCTCAGAGAACTCTCAGAAGG + Intergenic
954717837 3:52535134-52535156 CAGCTCAGGCTGCTCACTGCGGG + Intronic
955400957 3:58591272-58591294 CAGTTCAGACAGGTCTCAATGGG + Intronic
957083373 3:75658142-75658164 CAGCTCAGCCCCCTCTCTGACGG - Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
961388528 3:126538050-126538072 GAGGTCACACAGCTCTCTTTGGG - Intronic
962183739 3:133236284-133236306 CAACTCAGATAACTGTCTGTAGG + Intronic
968359368 3:198136720-198136742 CAGCACAGACACCTCGGTGTAGG - Intergenic
968630706 4:1649538-1649560 CAGGTCACACAGGGCTCTGTGGG + Intronic
969928630 4:10609285-10609307 CAGCTCTAACAGCTGCCTGTTGG + Intronic
973106636 4:46346890-46346912 CAGCTCTGACAGCTTTTTGATGG - Intronic
974081719 4:57220818-57220840 CTTCACAGACAGCTTTCTGTAGG - Intergenic
974296416 4:60005008-60005030 CAACTCAGACAGACCTCTCTAGG - Intergenic
977418954 4:96773052-96773074 GAGCTCAGCTAGCTATCTGTGGG - Intergenic
979184039 4:117765334-117765356 CACCACAGACAGTTCCCTGTGGG - Intergenic
980165921 4:129226984-129227006 CAGCTCAGAAAGCTCTATAGAGG + Intergenic
982826998 4:160014507-160014529 GAAATCAGACAGCCCTCTGTTGG + Intergenic
983796899 4:171875310-171875332 CAGCCCAGAAAGTTCTCTGTTGG + Intronic
984064175 4:175027687-175027709 CACAACAAACAGCTCTCTGTGGG + Intergenic
984630339 4:182053874-182053896 CAGCTCAACCAACTCTCTCTGGG + Intergenic
985448167 4:190038775-190038797 CAGCTCAGCCCCCTCTCTGACGG + Intergenic
985519619 5:367444-367466 CAGCTCAGACCCGTGTCTGTGGG - Intronic
985695266 5:1336573-1336595 CAGCTCACACAGCTCTGTATGGG + Intronic
986548754 5:8929028-8929050 CAGCTCAGACAGCTGCATGTAGG + Intergenic
986763847 5:10904954-10904976 AAGCACAGAGAGCTCACTGTAGG - Intergenic
987063801 5:14268382-14268404 CAGGTCACACAGCTCTCTATTGG + Intronic
990313460 5:54562140-54562162 AACCTCAGACAGCTCTTTGCGGG + Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
990958614 5:61368768-61368790 CAAGTCAGTCAGCTCTCTGATGG + Intronic
991584955 5:68192544-68192566 CAGTCCAGGCAGCTCTCTGTTGG + Intronic
993913986 5:93718986-93719008 CAACACTGACAGCTCTCTCTTGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995117752 5:108500771-108500793 CAGCTCTGGGAGCTCTGTGTGGG - Intergenic
997293374 5:132753714-132753736 CAGCTCTGAATGCTTTCTGTTGG + Exonic
997759820 5:136434247-136434269 GATCTCAGAAAGCTCACTGTGGG - Intergenic
998249179 5:140538559-140538581 CTGCTCTGACAGCTTTATGTCGG + Intronic
1001071584 5:168589867-168589889 CAGCTCAGAAAGCTCCCAGAGGG + Intergenic
1004302466 6:14470872-14470894 CAGGCCTGACAGCTCTCTCTGGG - Intergenic
1006393026 6:33769997-33770019 CAGCCCAGGGAGCTCTCTGAAGG + Intergenic
1007065529 6:38987179-38987201 CGGCTCAGACATCTCCCTGGAGG - Intronic
1010279979 6:74012791-74012813 CAGCTCAGGGAGGCCTCTGTAGG - Intergenic
1010565911 6:77413279-77413301 GAGCTCAAACATATCTCTGTTGG + Intergenic
1012429198 6:99146687-99146709 CAGCTCAGACAGACATCTGCAGG - Intergenic
1015146671 6:129995105-129995127 CAGATCTGGTAGCTCTCTGTGGG - Intergenic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018823521 6:167392720-167392742 AAGCTGAGGCAGCTTTCTGTAGG + Intergenic
1019260627 7:79956-79978 CAGCACAGACACCTCGGTGTAGG + Intergenic
1019314446 7:377929-377951 CAGCTCACACCCCTCTCGGTGGG + Intergenic
1019684621 7:2374205-2374227 CGTCTCTGACATCTCTCTGTTGG + Intronic
1019898285 7:4000018-4000040 CCTCACAGACAGCTCCCTGTAGG - Intronic
1020084503 7:5303228-5303250 CAGCCCAGCCAGCACTCTGCAGG + Exonic
1022189116 7:27999798-27999820 CAGCTCAGACAGCTCTGCCTTGG + Intronic
1024350277 7:48356322-48356344 GAACTCAGACAGCTCTCAATGGG + Intronic
1025096719 7:56101500-56101522 CAGATCTGACAGCTCCCTGAGGG - Intergenic
1025209796 7:57013971-57013993 CAGCCCAGCCAGCACTCTGCAGG - Intergenic
1025662157 7:63562880-63562902 CAGCCCAGCCAGCACTCTGCAGG + Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1030866156 7:114704068-114704090 CAGCACAGACAGCTATGAGTGGG - Intergenic
1032268226 7:130383107-130383129 CTGCTCGGACAGTTCTCTGGGGG - Intronic
1034203039 7:149294373-149294395 CGGCCCAGACAGGTCTCTGCAGG - Intronic
1036108032 8:5863148-5863170 CAGATGAAACAGCTTTCTGTTGG - Intergenic
1037784884 8:21896622-21896644 GAGCTCAGCCAGCTCCCTTTAGG - Intergenic
1038222518 8:25624241-25624263 AAGCCCAGACATCTCTGTGTAGG - Intergenic
1039266799 8:35833677-35833699 CAGATCAAAAAGCCCTCTGTTGG + Intergenic
1040377524 8:46840893-46840915 CATATCAAACCGCTCTCTGTGGG - Intergenic
1040572865 8:48625221-48625243 CAGCTCAGAGAGCCCTCTGCAGG - Intergenic
1040716921 8:50266909-50266931 TTGCTCAGACATCTCTGTGTAGG + Intronic
1041106740 8:54452405-54452427 CATCTCAGACACATCTGTGTAGG - Intergenic
1041766422 8:61422963-61422985 CTGGTCACTCAGCTCTCTGTAGG - Intronic
1042003347 8:64152198-64152220 AAGCTCAGACATCTTTCTGTGGG + Intergenic
1043182202 8:77099194-77099216 CAGCTCACTCAGCTCACTGCAGG - Intergenic
1044393686 8:91683164-91683186 CAGCTAAGACACCCCACTGTGGG + Intergenic
1045612154 8:103857951-103857973 CAGCTCAGACATTTCTCCTTAGG - Intronic
1048701172 8:137091434-137091456 CAACTCAGACAGGACTCTCTGGG - Intergenic
1049680434 8:143915657-143915679 CAGATCAGACAGCACTGTGGGGG + Exonic
1053149985 9:35737156-35737178 CAGTTCAGACGGCTCACTCTGGG + Exonic
1053189541 9:36050673-36050695 CAGATCATACAGGTCTCTATAGG - Intronic
1053617989 9:39788916-39788938 CAGCTTTGACTGATCTCTGTAGG + Intergenic
1053876166 9:42548281-42548303 CAGCTTTGACTGATCTCTGTAGG + Intergenic
1053896491 9:42746352-42746374 CAGCTTTGACTGATCTCTGTAGG - Intergenic
1054235531 9:62553441-62553463 CAGCTTTGACTGATCTCTGTAGG - Intergenic
1054266169 9:62918513-62918535 CAGCTTTGACTGATCTCTGTAGG - Intergenic
1059658414 9:116377569-116377591 CAGTGCAGACAACTCTCTGTGGG - Exonic
1059953882 9:119495959-119495981 CAACTCAGGCAGTGCTCTGTGGG + Intronic
1060009442 9:120030668-120030690 CAGTTCAGACATTTCTTTGTTGG + Intergenic
1060211225 9:121711788-121711810 CTGGTCAGAGAGCCCTCTGTGGG + Intronic
1061276438 9:129571560-129571582 CATCTCAGAAAGGCCTCTGTCGG + Intergenic
1061398266 9:130355060-130355082 CAGCCCAGGCAGCTCTGAGTGGG - Intronic
1062358314 9:136175484-136175506 CAGCTGGGGCAGCTCTCTGGGGG + Intergenic
1062744055 9:138200434-138200456 CAGCACAGACACCTCGGTGTAGG - Intergenic
1187639936 X:21276775-21276797 GAGCTCAGAGAGTTCTGTGTGGG + Intergenic
1192279627 X:69671307-69671329 CAGCTCAGACACCCCACTGTGGG - Intronic
1192340325 X:70258657-70258679 CAGCTCCGTCAGCTCTGTGGTGG - Exonic
1193298639 X:79862698-79862720 CAGCACAGACATCTTTCTTTAGG + Intergenic