ID: 1173386134

View in Genome Browser
Species Human (GRCh38)
Location 20:42589739-42589761
Sequence GATCAAAACAGATCAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173386134 Original CRISPR GATCAAAACAGATCAGGAGC TGG (reversed) Intronic
901724399 1:11229459-11229481 GAACTAAACAGATGAAGAGCTGG + Intronic
903599918 1:24529880-24529902 TATCAAAACTGTTCAGGTGCTGG + Intronic
906572526 1:46856137-46856159 GATAAAATCAGATCAGTTGCAGG - Intergenic
906599243 1:47109755-47109777 GATAAAATCAGATCAGTTGCAGG + Intronic
910108210 1:83654098-83654120 GATCAAAAAAGTTCAGGTGGGGG - Intergenic
913342528 1:117772984-117773006 GATCAAAACTGATTAGCAGTGGG - Intergenic
914654371 1:149725767-149725789 GATCAAAACACATTATGGGCCGG + Intergenic
914867874 1:151447784-151447806 GATCAAAACACATCAAAAGCTGG - Intronic
916759936 1:167806780-167806802 GATCACTCCAGGTCAGGAGCTGG + Intergenic
917459378 1:175216367-175216389 GGTAAACACAGATCAGGAGATGG + Intergenic
920061465 1:203229680-203229702 GATAAAAGCAGAGCAGGACCTGG - Intronic
920795486 1:209132621-209132643 GAACAAAACAGAACAGGACAGGG - Intergenic
924624390 1:245687402-245687424 GACCAGAGCAGAGCAGGAGCAGG + Exonic
1063075389 10:2711394-2711416 GCTCACAGCAGGTCAGGAGCAGG - Intergenic
1063683110 10:8209398-8209420 GAAAAAGAGAGATCAGGAGCAGG + Intergenic
1064945155 10:20778866-20778888 GCTCAAAACAGAAAAGGAACTGG + Intergenic
1066192859 10:33071738-33071760 GGTCAGAACACATCTGGAGCAGG + Intergenic
1067928598 10:50537173-50537195 GATCAAACAAGATCAGTAGAGGG - Intronic
1069542857 10:69308509-69308531 GAACAAAACAGAACAGGACAGGG + Intronic
1070144960 10:73767149-73767171 GATCAATACAGACAAGGAGAAGG + Exonic
1070353008 10:75611451-75611473 GATGAAAACAGTTCTGGAGATGG - Intronic
1070600575 10:77863801-77863823 GAAGACACCAGATCAGGAGCAGG + Intronic
1072540549 10:96395003-96395025 GTTCCCAACTGATCAGGAGCAGG - Intronic
1072622643 10:97090205-97090227 GAAGGAAACAGAACAGGAGCAGG + Intronic
1074730761 10:116372479-116372501 TAGGAAAACAGATCAGGGGCTGG - Intronic
1075220041 10:120576741-120576763 GATAAAAACAGAACAAGGGCAGG - Intronic
1076759885 10:132598338-132598360 GATTAAAAGAGATCTGGAGATGG - Intronic
1077440139 11:2564674-2564696 GATGAAAAAAGCTCTGGAGCTGG - Intronic
1078298490 11:10100680-10100702 GATCCAAACTGATCAGGAGAAGG - Intronic
1078985291 11:16588502-16588524 GATAAAATCAGAGCAGAAGCTGG - Intronic
1079871977 11:25809050-25809072 GATGAAAACAGTTCTGGAGATGG + Intergenic
1079884114 11:25964548-25964570 GATCAACAGAGATCAGGAGCTGG + Intergenic
1080469335 11:32529877-32529899 GATCATTTGAGATCAGGAGCTGG + Intergenic
1080787044 11:35484830-35484852 CATCAAAAAAGATGAGCAGCAGG - Intronic
1080895328 11:36444445-36444467 GATTAAAACAGATCAGAAAAAGG - Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082075624 11:47973918-47973940 GATCCTAACAGCTCAGGAGGTGG + Intergenic
1082095961 11:48129578-48129600 GCTCATAACAGTTGAGGAGCAGG + Intronic
1083081799 11:60101613-60101635 GATCAAAACAAAACAGGATACGG + Intergenic
1083980624 11:66165492-66165514 GATCAAAACTCATAAGCAGCTGG + Intronic
1084386379 11:68845164-68845186 GATCACCAGAGATCAGGAGTTGG - Intergenic
1085587602 11:77725130-77725152 GATCAAAAAAGTTCTGGAGATGG + Intronic
1087455422 11:98379679-98379701 CATCAAAACACTTCAGAAGCTGG + Intergenic
1087497912 11:98914210-98914232 AATGAAAACAGATAAAGAGCAGG - Intergenic
1087802239 11:102516970-102516992 GAATAAAACAGAGCAGGAGGAGG - Intergenic
1089931484 11:122317797-122317819 GAACAAAACAAATTAGGGGCCGG + Intergenic
1092390476 12:8073203-8073225 GATCAGAACAGAACAGGACAGGG - Intergenic
1092963168 12:13615642-13615664 GAATAAAACAGACGAGGAGCCGG - Exonic
1094717301 12:33025407-33025429 GACCAAAACAAATTAGTAGCAGG + Intergenic
1095726194 12:45455601-45455623 GATCAAAACAAAGGAGGAGCTGG - Intergenic
1096207357 12:49734198-49734220 GATCAGAACAGAACAGGACAGGG - Intronic
1096518735 12:52172376-52172398 CATCAAGACAGCTGAGGAGCAGG - Exonic
1097840124 12:64313458-64313480 GATCAAAAGAGTCCAGGAGTTGG + Intronic
1097998110 12:65912466-65912488 GTTCTAGACAGAGCAGGAGCAGG - Intronic
1099963217 12:89416809-89416831 AAGCAAAACAGCTCAGCAGCTGG + Intergenic
1103266879 12:119638236-119638258 GATCACTAGAGCTCAGGAGCTGG + Intronic
1106454225 13:29912547-29912569 ACCAAAAACAGATCAGGAGCTGG + Intergenic
1107971916 13:45651395-45651417 GATAAAAAGAGATCAGTAGTTGG + Intergenic
1108218463 13:48208613-48208635 GATCACATGAGGTCAGGAGCTGG + Intergenic
1108317315 13:49249431-49249453 GATCAAAACAGATTAGAAATGGG + Intronic
1111404660 13:87787746-87787768 GATTACAACAAATCAGCAGCTGG - Intergenic
1111512193 13:89280761-89280783 GAACAAATCACATCAGGAGAGGG - Intergenic
1112042627 13:95562292-95562314 GATCATTGAAGATCAGGAGCTGG - Intronic
1112341976 13:98560098-98560120 GATCTAAACTGATCTGAAGCCGG + Intronic
1112720192 13:102235592-102235614 GGTCAAAAAGGATCAGGATCAGG + Intronic
1114805611 14:25832944-25832966 GAGCAAAACAGTTCATGAGTCGG + Intergenic
1115324713 14:32126844-32126866 GATGAAAACAGCTCTGGAGATGG + Intronic
1117225423 14:53653634-53653656 GATCAGAAAGGATCAGGATCAGG + Intergenic
1119350990 14:73965499-73965521 GATCAATTGAGATCAGGAGTTGG + Exonic
1120457056 14:84744990-84745012 GATCTAAACAGATCAATTGCAGG + Intergenic
1120597165 14:86454902-86454924 GAAGAAAAAAGATCAAGAGCTGG + Intergenic
1121261646 14:92570439-92570461 GATCACTTGAGATCAGGAGCTGG + Intronic
1123141662 14:106085963-106085985 CATCAGAACAGATCTGGAGAAGG + Intergenic
1123200128 14:106655604-106655626 CATCAGAACAGATCTGGAGAAGG + Intergenic
1124473147 15:30006816-30006838 AAACAAAAAAGACCAGGAGCTGG + Intergenic
1125639595 15:41219038-41219060 GAGGAGTACAGATCAGGAGCTGG - Intronic
1126186284 15:45833529-45833551 CATGTAAACAGATCAGGAGAAGG + Intergenic
1126533106 15:49732279-49732301 GAACAAAACAGAACAGGACAGGG + Intergenic
1127835757 15:62789604-62789626 GTTCAAGACAGCTCAAGAGCGGG + Intronic
1128020804 15:64388528-64388550 GATCACTTGAGATCAGGAGCTGG - Intronic
1128630674 15:69263219-69263241 GCTCAGAACAGAGCAGGAGAAGG + Intronic
1129123788 15:73420680-73420702 GATCAAAATAGATCAAGAGAGGG - Intergenic
1129954646 15:79624613-79624635 GACCAAAAGAGATCAGGTGTGGG + Intergenic
1131399083 15:92110252-92110274 GATCAACAGAGATCAAGGGCAGG - Intronic
1132938134 16:2492459-2492481 TTTCTAAACAGAACAGGAGCTGG - Intronic
1133999432 16:10771120-10771142 GATGAAAGCAGTTCTGGAGCTGG + Intronic
1134024468 16:10943379-10943401 GAGCAAAAAAGAACAGGATCTGG - Intergenic
1134172735 16:11981323-11981345 GATCAATTGAGGTCAGGAGCTGG - Intronic
1138118225 16:54377334-54377356 GATAAGGACAGATAAGGAGCAGG + Intergenic
1138586478 16:57973590-57973612 GATGCAAAAAGAGCAGGAGCTGG + Intergenic
1139447453 16:67006614-67006636 GAGCATAACAGATTAGGAACTGG - Intronic
1142578538 17:925683-925705 AACCACCACAGATCAGGAGCTGG - Intronic
1142910712 17:3088661-3088683 GAACAAAACAGAACAGGACAGGG + Intergenic
1142972057 17:3619288-3619310 GATCAAAAGAGATGTGAAGCTGG - Intronic
1143349256 17:6275464-6275486 GCTAAAAACAGCTCAGGAGAAGG + Intergenic
1143412354 17:6717929-6717951 GAACAAAACAGAACAGGACAGGG - Intergenic
1143414827 17:6738673-6738695 GAACAAAACAGAACAGGACAGGG + Intergenic
1143595779 17:7912680-7912702 GATCAGGACAGACCAGGAGTGGG - Exonic
1144004415 17:11087304-11087326 GATGAAAACACATCTGGACCAGG + Intergenic
1145832746 17:27930258-27930280 GATCAACAAAGATAAGGAGATGG - Intergenic
1146025717 17:29319156-29319178 GAACAAAACAGATGGGGGGCTGG + Intergenic
1146781356 17:35676001-35676023 GAACAAAACAGAGGAGGAGGAGG - Intronic
1146781361 17:35676038-35676060 GAACAAAACAGAGAAGGAGGAGG - Intronic
1147215574 17:38897167-38897189 GATCAGAACAGAGAAGGAGAGGG + Intronic
1148512862 17:48187924-48187946 GATCTAAACAGAACAGCAGTAGG + Exonic
1148878832 17:50709421-50709443 GATCACATGAGGTCAGGAGCTGG - Intergenic
1149419394 17:56494448-56494470 AATAACAACAGATCAGAAGCTGG + Intronic
1149534569 17:57422668-57422690 CATCAAAGCAGACCACGAGCAGG - Intronic
1151179706 17:72318266-72318288 GATCCAAATAGCACAGGAGCCGG + Intergenic
1151240247 17:72751871-72751893 GATAAAAAGAGCTCTGGAGCCGG - Intronic
1153761422 18:8335798-8335820 GATCATTTCAGGTCAGGAGCTGG + Intronic
1154264555 18:12868797-12868819 TGTTAAAACAAATCAGGAGCTGG - Intronic
1155213534 18:23622379-23622401 GAACAAAACAGACCCAGAGCAGG - Intronic
1155938005 18:31774356-31774378 AGTCAAATCAGATCAGGAGAGGG + Intergenic
1156213151 18:34969010-34969032 GATGAAAACCGATGAGGACCTGG - Intergenic
1157564848 18:48672916-48672938 GATCAGAACAGATCAGGGGAGGG - Intronic
1158345780 18:56515550-56515572 GAACAAAAAAGAACAGCAGCAGG - Intergenic
1158927447 18:62282877-62282899 GATCACCTGAGATCAGGAGCTGG - Intronic
1159353574 18:67306203-67306225 GATCACCTGAGATCAGGAGCTGG + Intergenic
1159991961 18:74919438-74919460 GAACAAAAAAGATCAGGAAACGG - Intronic
1160591058 18:79944939-79944961 TATCAACACAGAGCAGAAGCAGG + Intronic
1161622331 19:5304867-5304889 GAACAAAACAGAAAAGGAGAGGG + Intronic
1161877103 19:6920181-6920203 GATCCAATCAGATCAAGACCTGG - Intronic
1162004201 19:7766786-7766808 AATCAAAACTGCTGAGGAGCAGG + Exonic
1162060588 19:8092489-8092511 GATCACTTGAGATCAGGAGCTGG + Intronic
1163179264 19:15587377-15587399 GATCACTTCAGATCAGGAGTTGG + Intergenic
1163837494 19:19583846-19583868 GATCACCTCAGATCAGGAGTTGG + Intronic
1164547568 19:29181746-29181768 GATCACGACAGTGCAGGAGCAGG + Intergenic
1164879935 19:31724254-31724276 GATGAAAACAGTTCTGGAGATGG - Intergenic
1166091937 19:40514881-40514903 GATCATATAAGATCAGGAGTTGG + Intronic
1166979637 19:46624952-46624974 CAGCAACACAGAGCAGGAGCAGG - Intronic
1167008899 19:46793394-46793416 GAGAAAAACAGATGAGGAGCCGG + Intergenic
1167091682 19:47348765-47348787 GATCACTTGAGATCAGGAGCTGG + Intergenic
926312897 2:11687271-11687293 TTTAAAAACAGATCAGGATCAGG - Intronic
928116820 2:28551067-28551089 CATCAAAACAGATTGGGAACAGG - Intronic
929244778 2:39689619-39689641 GATGAAAAGAGCTCTGGAGCTGG + Intronic
935266721 2:101401252-101401274 AAACAAAACAAAACAGGAGCCGG - Intronic
939355880 2:141101202-141101224 GATCAAGACAGAGCAGGACCAGG + Intronic
940424673 2:153516801-153516823 TATCAAAAAAGATCAGGTTCAGG + Intergenic
941712635 2:168730156-168730178 GATCAAAACAATTCAGTGGCTGG - Intronic
941971932 2:171359884-171359906 TATCAAAAAAACTCAGGAGCCGG - Intronic
942812393 2:180014353-180014375 GAGCAAAAGAGAGCAGGAGGGGG - Intergenic
943272450 2:185824132-185824154 GATGAAAAAAGTTCTGGAGCTGG + Intronic
943515223 2:188877205-188877227 GGTCAAATCAGTTCAAGAGCCGG - Intergenic
943554855 2:189390129-189390151 GATCAAAATAGAGCAGAAGTAGG + Intergenic
945738385 2:213630160-213630182 GATCACATCAGGTCAGGAGTTGG + Intronic
946970119 2:225081846-225081868 GTTCAAAACAGGGCAAGAGCAGG + Intergenic
947347459 2:229208039-229208061 GAGAAAAACAAATCAGGAACTGG - Intronic
1169605618 20:7315580-7315602 GATCAAAAATGTTCAGTAGCAGG - Intergenic
1170097110 20:12657824-12657846 GATAAAAACATATCAGAGGCTGG - Intergenic
1171302241 20:24073667-24073689 TATCAAAGCACATCAGGAGGAGG + Intergenic
1173154279 20:40594666-40594688 GGTCAAAACATAGCAGAAGCTGG + Intergenic
1173386134 20:42589739-42589761 GATCAAAACAGATCAGGAGCTGG - Intronic
1173997249 20:47347889-47347911 AATAAAAACAGAACAGGAGGTGG - Exonic
1175141090 20:56860621-56860643 GATGAAAACAGTTCTGGAGATGG - Intergenic
1175644256 20:60657889-60657911 GTTAAAAACAGGTCCGGAGCTGG - Intergenic
1176677892 21:9797967-9797989 GATCAAATTAAATCAGCAGCAGG - Intergenic
1177324678 21:19568980-19569002 AACCATAACAGATAAGGAGCGGG + Intergenic
1177824413 21:26066401-26066423 GATGAAAACAGTTCTGGAGATGG - Intronic
1179525300 21:41972148-41972170 GATCAAAACCAGTCAGGAGCAGG - Intergenic
1180683061 22:17642378-17642400 GATCACCTGAGATCAGGAGCTGG - Intronic
1181821014 22:25475737-25475759 GATCAAAAAAGACAGGGAGCTGG + Intergenic
1182527011 22:30926841-30926863 CATCAACACAGATGATGAGCTGG - Exonic
1182724925 22:32437107-32437129 GAACTAAACACATCAGTAGCTGG - Intronic
1183101738 22:35588433-35588455 GCTCAAAAATGAACAGGAGCAGG - Intergenic
949948613 3:9210601-9210623 GATCACATGAGGTCAGGAGCTGG + Intronic
950892194 3:16414033-16414055 GATAATAACAGATCAGTAGCAGG - Intronic
952008633 3:28873310-28873332 AAACAAAAAAGATCAGGAGTAGG - Intergenic
954239544 3:49282927-49282949 GATCACTTGAGATCAGGAGCCGG - Intronic
956835143 3:73090320-73090342 CATCACCACAGACCAGGAGCTGG + Intergenic
958524457 3:95237440-95237462 ACTCAGAACAGATCAGGAGATGG + Intergenic
959019447 3:101172255-101172277 CAACAAAACAGATCAGCAGTGGG + Intergenic
961188476 3:124936799-124936821 GATCACCTGAGATCAGGAGCTGG + Intronic
963805583 3:149718571-149718593 GATGAAAAGAGATCTGGAGATGG - Intronic
965389794 3:168091410-168091432 GATCATATCAGATTAGGAGAGGG - Intronic
967578635 3:191125558-191125580 GATCATTCCAGGTCAGGAGCTGG + Intergenic
968069934 3:195778518-195778540 GATTCAAAGAAATCAGGAGCTGG + Intronic
969950775 4:10832826-10832848 GATGAAAACAGCTAAGGATCTGG - Intergenic
971166489 4:24189201-24189223 GATGAAAACAGTTCCGGAGATGG + Intergenic
972578408 4:40373235-40373257 GATGAAAACAGTTCTGGAGATGG + Intergenic
974176608 4:58333336-58333358 GCTCAAAACAGATCAAGAAGGGG + Intergenic
975205289 4:71638506-71638528 GAACAAAACAGAACAGGACAGGG - Intergenic
976262072 4:83155272-83155294 GATAAGAAGTGATCAGGAGCAGG - Intergenic
978442179 4:108744944-108744966 GATCAGGATAGCTCAGGAGCTGG - Intronic
979199139 4:117955936-117955958 AACCAAAACAGATCAAGAGTAGG + Intergenic
979761509 4:124411070-124411092 GATCACAACAGATCCTGAGTAGG + Intergenic
980381169 4:132019391-132019413 GATGAAAACAGCTCTGGAGATGG + Intergenic
981733374 4:147922811-147922833 GATTAAAACAAATCAGGAGAAGG - Intronic
981926478 4:150145790-150145812 CAGCCAAAAAGATCAGGAGCTGG - Intronic
982222111 4:153133976-153133998 AGTCAAAACAGATCAGGATGTGG - Intergenic
982759518 4:159264687-159264709 GATCAAAAAAGTTCTGGAGATGG - Intronic
983976255 4:173937830-173937852 GAGAAAAATAGGTCAGGAGCTGG + Intergenic
984096764 4:175444462-175444484 GATAAAAAAAGATCATGAGGAGG + Intergenic
984658722 4:182349938-182349960 GATGAAAACACATCAGCATCTGG - Intronic
985397631 4:189560822-189560844 GATCAAATTAAATCAGCAGCAGG + Intergenic
986413939 5:7509387-7509409 GTTCAGAACAGATGAAGAGCTGG + Intronic
987867556 5:23565095-23565117 GATTAAAACCAATCAAGAGCTGG + Intergenic
988443387 5:31257643-31257665 GAACAAAACAAGTCAGGGGCTGG - Intronic
988450302 5:31335676-31335698 AAACAAAACAGATAAGCAGCAGG - Intergenic
992097709 5:73378579-73378601 GAGAAAACCAGATGAGGAGCTGG - Intergenic
992106586 5:73453156-73453178 GATCAGGACAGATAAGGAGGGGG - Intergenic
992540636 5:77760642-77760664 GATCACTAGAGGTCAGGAGCTGG - Intronic
993069570 5:83143177-83143199 TATCAAAACAGCACTGGAGCAGG - Intronic
993880397 5:93353833-93353855 GATATAAAAAGATCTGGAGCGGG + Intergenic
993934564 5:93985644-93985666 GATCACCAGAGGTCAGGAGCAGG - Intronic
994517094 5:100785389-100785411 GATCACTCCAGGTCAGGAGCTGG - Intergenic
994997515 5:107082984-107083006 GATCACCAGAGGTCAGGAGCTGG + Intergenic
995349431 5:111157915-111157937 AATTAAAATAAATCAGGAGCGGG + Intergenic
996377101 5:122822568-122822590 GATCAAAAAACATCAGGAATTGG + Intronic
997215954 5:132110826-132110848 AGTCAAAACAGAATAGGAGCTGG + Intergenic
998451363 5:142236767-142236789 GAACAAAACAGAACAGGACAGGG + Intergenic
999564601 5:152843449-152843471 GGTCAAATCAGATGAGGACCAGG + Intergenic
1000148670 5:158478411-158478433 GACCAAGACAGTTCAGTAGCTGG + Intergenic
1005438584 6:25840467-25840489 AATGAAAACTCATCAGGAGCTGG + Intronic
1006020059 6:31112495-31112517 GATGAAGACAGACCAGGAGCAGG + Exonic
1006500380 6:34455128-34455150 GACCAAAACAGACAAGGAGGCGG + Intergenic
1007667701 6:43525271-43525293 GATTATTACACATCAGGAGCCGG + Intronic
1008929472 6:56923526-56923548 AAACAAAACAGATAAGGAACTGG + Intronic
1012691021 6:102311151-102311173 GATCAAGATTAATCAGGAGCTGG - Intergenic
1012997509 6:105988080-105988102 GATCAAAGAAGAGCAGGATCAGG - Intergenic
1013016955 6:106168567-106168589 GAACAAAACAGACCTGGCGCTGG + Intergenic
1014326078 6:119995602-119995624 GATCACTTGAGATCAGGAGCTGG - Intergenic
1016397729 6:143643929-143643951 TATCAAAAAAGATTAGAAGCAGG + Intronic
1016941111 6:149483428-149483450 GCTGAAAAGAGATCTGGAGCTGG - Intronic
1018553781 6:165029123-165029145 GAGCAAGACAGAGCAGGAGGAGG - Intergenic
1020086627 7:5313869-5313891 AAACAAAACAGATGAGAAGCTGG + Intronic
1020420930 7:8004092-8004114 GATCAAAACAGAAGAAGTGCAGG - Intronic
1020656768 7:10937502-10937524 GATCACTTGAGATCAGGAGCTGG - Intronic
1021364204 7:19756065-19756087 GATCAAAAGAAATGAGTAGCTGG - Intronic
1021535898 7:21704165-21704187 GATCAAAACAGATCATTGGCAGG + Intronic
1024134426 7:46392136-46392158 GATCACAAGAGCCCAGGAGCTGG - Intergenic
1024367722 7:48541033-48541055 GATCAACACAGTTGAGAAGCAGG + Intronic
1024464466 7:49697152-49697174 GAGCTAAACAGCTCAGTAGCAGG - Intergenic
1024949531 7:54844979-54845001 GAACAAAACAGATCAGCATCTGG + Intergenic
1027818795 7:83016019-83016041 CATGAAAACAATTCAGGAGCTGG - Intronic
1028162161 7:87498315-87498337 GATCATCACAGTTCAGGATCTGG + Intergenic
1029585637 7:101469028-101469050 GATCATAGAAGATCAGGAGATGG - Intronic
1030030545 7:105365261-105365283 GATCACCTGAGATCAGGAGCTGG + Intronic
1031017534 7:116592153-116592175 AATCAGAAGAGATCAGAAGCAGG - Intergenic
1031083888 7:117283354-117283376 GATAAATACAGATCAGTAGAAGG - Intronic
1031523408 7:122794374-122794396 TATCAAAACAGACCAGGTGGAGG - Intronic
1031541141 7:122995872-122995894 AATCAAATCACCTCAGGAGCAGG - Intergenic
1032124552 7:129183556-129183578 GATCACTTGAGATCAGGAGCTGG - Intergenic
1032694845 7:134326157-134326179 GATGAAAAGAGTTCTGGAGCTGG - Intergenic
1036605185 8:10298521-10298543 GATGAAAAGAGTTCTGGAGCCGG + Intronic
1036637026 8:10558197-10558219 GACCAAGAAAGAGCAGGAGCGGG + Intergenic
1039471880 8:37818581-37818603 GACCAGCACAGAGCAGGAGCTGG - Intronic
1040001381 8:42579373-42579395 GAGCAAAACAGAGCAAGAGCTGG - Intergenic
1040460646 8:47644499-47644521 GAACAAAACAGACAAGGGGCCGG + Intronic
1040992459 8:53367372-53367394 GAACAAAACAGATCAGGACAGGG + Intergenic
1041515047 8:58691066-58691088 GATCAAAACAAAACAGGATAGGG - Intergenic
1041515914 8:58698619-58698641 GATCAAAACAAAACAGGATAGGG - Intergenic
1042489324 8:69380486-69380508 GAACAAAACAGAACAGGACAGGG + Intergenic
1047321964 8:123795251-123795273 GATCAAAACATATTAGCATCTGG - Intronic
1047766287 8:127992654-127992676 GAGCTAGACAGGTCAGGAGCTGG - Intergenic
1047956656 8:129981729-129981751 GATCACAGCAGAGCAGGACCAGG + Intronic
1049942995 9:566511-566533 AATCAAAACATAACAGGTGCTGG - Intronic
1050412971 9:5385518-5385540 GATCAAAACAGAACAAGACAGGG - Intronic
1051206295 9:14693058-14693080 GTTCCAAACAGAGCAGGTGCAGG + Intronic
1055702128 9:78956470-78956492 GAAAAAAGCAGATAAGGAGCAGG + Intergenic
1056094159 9:83233668-83233690 AAACAAAACAGATCAGAAGCTGG - Intergenic
1058565864 9:106284447-106284469 GGTCAAAACCCATCAGGAGGGGG + Intergenic
1059494096 9:114695212-114695234 GAACAAAACACATCAGAAGTAGG + Intergenic
1060057939 9:120431882-120431904 GATCAAAATAGATCAGGAACTGG - Intronic
1061161144 9:128894940-128894962 GATGAAAACAGTTCTGGAGATGG - Intronic
1061704814 9:132444864-132444886 GATGAAAAGAGTTCTGGAGCTGG - Intronic
1062284471 9:135766885-135766907 GCTCAAAATAGAACAGGGGCGGG + Intronic
1062531377 9:137002177-137002199 ACTCAAAACACATCAGGAGCTGG + Intergenic
1203663040 Un_KI270754v1:459-481 GATCAAATTAAATCAGCAGCAGG - Intergenic
1188625002 X:32273293-32273315 AAACAAAACAAAACAGGAGCCGG + Intronic
1190397164 X:49996954-49996976 GACAAACACAGATCAGGAGGAGG - Intronic
1192612017 X:72576197-72576219 GAACAAAACAAAACAGGAGGTGG + Intergenic
1199848062 X:151706014-151706036 GCCCAAAACAGTCCAGGAGCAGG + Intergenic
1201287907 Y:12394685-12394707 GTTCAAAATAGCTCATGAGCTGG + Intergenic
1201430265 Y:13895670-13895692 GATCAAAAGAGAAAAGTAGCAGG + Intergenic
1201440357 Y:14001337-14001359 GATCACTCCAGGTCAGGAGCTGG + Intergenic
1201444214 Y:14041371-14041393 GATCACTCCAGGTCAGGAGCTGG - Intergenic