ID: 1173391104

View in Genome Browser
Species Human (GRCh38)
Location 20:42634260-42634282
Sequence TCATTAACGTTCACAGTCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 27}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173391104_1173391108 1 Left 1173391104 20:42634260-42634282 CCACCGACTGTGAACGTTAATGA 0: 1
1: 0
2: 2
3: 1
4: 27
Right 1173391108 20:42634284-42634306 GTGTGTTCATTGCTGGGTTGAGG 0: 1
1: 0
2: 2
3: 15
4: 188
1173391104_1173391107 -5 Left 1173391104 20:42634260-42634282 CCACCGACTGTGAACGTTAATGA 0: 1
1: 0
2: 2
3: 1
4: 27
Right 1173391107 20:42634278-42634300 AATGATGTGTGTTCATTGCTGGG 0: 1
1: 0
2: 2
3: 31
4: 195
1173391104_1173391109 15 Left 1173391104 20:42634260-42634282 CCACCGACTGTGAACGTTAATGA 0: 1
1: 0
2: 2
3: 1
4: 27
Right 1173391109 20:42634298-42634320 GGGTTGAGGTAAGTATGAGTTGG 0: 1
1: 0
2: 1
3: 9
4: 128
1173391104_1173391106 -6 Left 1173391104 20:42634260-42634282 CCACCGACTGTGAACGTTAATGA 0: 1
1: 0
2: 2
3: 1
4: 27
Right 1173391106 20:42634277-42634299 TAATGATGTGTGTTCATTGCTGG 0: 1
1: 0
2: 0
3: 21
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173391104 Original CRISPR TCATTAACGTTCACAGTCGG TGG (reversed) Intronic
915574202 1:156764636-156764658 TCATTAATTTTCACAGTAAGGGG + Intronic
917959879 1:180133606-180133628 TCTTTGCAGTTCACAGTCGGGGG + Intergenic
919323239 1:196070331-196070353 TCATTATCGTTCAAAGTCGGTGG + Intergenic
1064301761 10:14129190-14129212 TCACTATCGTTCACAGTGGAGGG - Intronic
1068006181 10:51394155-51394177 TTATTATCTTTCACAGTCTGTGG + Intronic
1076025417 10:127107974-127107996 TCATTGACGCTCACAGTTTGTGG + Intronic
1081590769 11:44421531-44421553 TCATTAAAGCTCCCAGCCGGTGG - Intergenic
1090584198 11:128192605-128192627 TCATTAATTTTCACAGTCTGAGG - Intergenic
1105828559 13:24144055-24144077 TCATGAACATTCACAGTCGGGGG - Intronic
1120254077 14:82096078-82096100 TCACTTACGTTCACAGTCTTTGG - Intergenic
1132473397 16:119595-119617 TCTTTAAAGTTCACAGGCAGAGG + Intronic
1137851285 16:51747490-51747512 TGATTAACGTTCACTGTCAAAGG - Intergenic
1149954617 17:61034965-61034987 TCATTAACGTTCATACTGAGAGG - Intronic
1162194846 19:8976629-8976651 TCATGAACTTTCAAAGTCAGAGG - Exonic
929899345 2:45987659-45987681 TCATTATCACTCACAGTCTGTGG + Intronic
1168956077 20:1835426-1835448 TCCATAACGTCCACAGTCAGGGG + Intergenic
1173391104 20:42634260-42634282 TCATTAACGTTCACAGTCGGTGG - Intronic
957959591 3:87232111-87232133 GCACTAAAGTTCACAGTGGGTGG - Intronic
960937188 3:122911483-122911505 TCTTTTACCTGCACAGTCGGTGG + Exonic
985104706 4:186489225-186489247 TCATTGACTTCCCCAGTCGGGGG - Intronic
993735705 5:91474914-91474936 ACATGAACCTTTACAGTCGGAGG - Intergenic
994703102 5:103162311-103162333 TCATTAAGGCTCAGAGTAGGTGG - Intronic
995044280 5:107626836-107626858 TCTTTGACTTTCACAGTTGGTGG + Intronic
995085647 5:108106214-108106236 TCATTAATGTTCACATTTAGAGG - Intronic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1012852196 6:104460230-104460252 TCCTTTACTTTCACAGTCTGAGG + Intergenic
1018543290 6:164907481-164907503 TCATTAAAGGTCACAGTGGCAGG + Intergenic
1021393678 7:20123121-20123143 TAAGTAACGTTCACAGTGGAAGG + Intergenic
1037873319 8:22521038-22521060 ACATTAGGGTTCACAGTCAGTGG + Intronic
1047447256 8:124930480-124930502 GCACTAACGTTCACAGTGGCTGG - Intergenic
1187478259 X:19630919-19630941 TCAGTAATGGCCACAGTCGGCGG + Intronic