ID: 1173391727

View in Genome Browser
Species Human (GRCh38)
Location 20:42641280-42641302
Sequence ATGTGTGAGAGGCCTTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173391723_1173391727 18 Left 1173391723 20:42641239-42641261 CCTATTCCTTCCAAAAGGACTGT 0: 1
1: 0
2: 0
3: 18
4: 239
Right 1173391727 20:42641280-42641302 ATGTGTGAGAGGCCTTCCTAAGG 0: 1
1: 0
2: 0
3: 13
4: 128
1173391725_1173391727 8 Left 1173391725 20:42641249-42641271 CCAAAAGGACTGTGCTAATCTGT 0: 1
1: 0
2: 1
3: 15
4: 4435
Right 1173391727 20:42641280-42641302 ATGTGTGAGAGGCCTTCCTAAGG 0: 1
1: 0
2: 0
3: 13
4: 128
1173391724_1173391727 12 Left 1173391724 20:42641245-42641267 CCTTCCAAAAGGACTGTGCTAAT 0: 1
1: 2
2: 3
3: 24
4: 188
Right 1173391727 20:42641280-42641302 ATGTGTGAGAGGCCTTCCTAAGG 0: 1
1: 0
2: 0
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173391727 Original CRISPR ATGTGTGAGAGGCCTTCCTA AGG Intronic
900177833 1:1298548-1298570 ACCGGTGAGAGGCCTTCCTCAGG - Exonic
901154715 1:7127843-7127865 AGTTGCAAGAGGCCTTCCTAAGG - Intronic
901793161 1:11664827-11664849 CGGTGTGAGAGGGCTTCCTAGGG + Intronic
902157561 1:14501353-14501375 ATGTGTGTGAGTCATTCCTTAGG - Intergenic
905500908 1:38435542-38435564 ATGTGAGAGAAGGCTTCCCAGGG + Intergenic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
912537677 1:110387765-110387787 AAGTCTGAGAGCCCTTCCTGGGG - Intronic
922014460 1:221631023-221631045 ATCTGTTAGAGTCCTTCATAGGG - Intergenic
1063006792 10:1979463-1979485 ATGTGAGAAAATCCTTCCTAAGG + Intergenic
1069424142 10:68274880-68274902 ATGTGGGAGGGGACTGCCTAAGG + Intergenic
1071326896 10:84526920-84526942 ATGTGTGATAGGTGTTCCTTTGG + Intergenic
1071521221 10:86332457-86332479 AGGGGTGAGAGGCCATCCCAGGG - Intronic
1072615331 10:97045776-97045798 ATGTGTGACAGGACTCCCTGTGG - Intronic
1073553231 10:104422838-104422860 ATGTGGGAGAGGACTATCTAGGG + Intronic
1074699253 10:116078973-116078995 ATGTGTGAGAAGCCTGACCATGG + Intronic
1074983385 10:118637367-118637389 ATGCCTGAGAGGATTTCCTATGG - Intergenic
1077430917 11:2515627-2515649 CTCTGTGAGAGGCCTGCCTAGGG - Intronic
1079105325 11:17568373-17568395 AGGTAGGAAAGGCCTTCCTAGGG - Intronic
1079234250 11:18676375-18676397 ATATCTGAGAAGGCTTCCTAGGG - Intergenic
1082922334 11:58509076-58509098 ATGTGTGAGGGGCCATGGTAAGG - Intergenic
1084356302 11:68641076-68641098 TTGAGTCAGAGGCCTTCATATGG + Intergenic
1085467944 11:76736934-76736956 AGGTGTGACAGGCCTGCCTGTGG - Intergenic
1085542447 11:77284930-77284952 TTGGGTGAGAGGCCTGCCTCTGG - Intronic
1086139339 11:83477490-83477512 ATGTGTGTGTGGCCTACCTCAGG + Intronic
1091022583 11:132114306-132114328 ACCTGTGAGAGGCTTTCATAGGG - Intronic
1091241062 11:134052870-134052892 GTGTGTGAGAGGCATTGCTGAGG - Intergenic
1096670027 12:53193090-53193112 GGGTCTGAGAGGCCTTCCCAAGG - Exonic
1097516575 12:60615847-60615869 ATGAGTCTGAGGCCTTCCTCAGG + Intergenic
1097961066 12:65532507-65532529 ATTTGTGAGTGGCTTCCCTAAGG - Intergenic
1100850017 12:98699840-98699862 TTGTGTAAGAGGACTTCCTGGGG - Intronic
1101120098 12:101570420-101570442 CTGGTTGAGAGGCCCTCCTATGG - Intronic
1101432399 12:104637552-104637574 ATCTGTGTGAGACCTTTCTATGG + Intronic
1106604575 13:31215824-31215846 ATGTGTGAGAGGGCATGCTGGGG + Intronic
1106884170 13:34165456-34165478 TTGTGTGAGAGGCTTTTCTCTGG + Intergenic
1107235140 13:38159459-38159481 AAGTGAGAGAGGACTTGCTAGGG - Intergenic
1107801781 13:44115216-44115238 ATGTCTGGGAGTCCTTCCTGTGG + Intergenic
1113283078 13:108811974-108811996 ATGTGTCAGAGGCCCTGCTTAGG + Intronic
1116738039 14:48719395-48719417 ATATTTGAGAGGTCTTCATATGG + Intergenic
1120084698 14:80257550-80257572 ATTTCTGAGAGGCCTTCCATAGG + Intronic
1121208003 14:92185618-92185640 TTGTGAGAAAGGCCTTCATAAGG + Intergenic
1121610442 14:95275075-95275097 ATCTGTGAGATGCCTTTCTTGGG - Intronic
1124171549 15:27378085-27378107 ATGTATGATATCCCTTCCTACGG + Intronic
1124370629 15:29103098-29103120 ATGTGTGAGAGACCTGGCTTGGG + Intronic
1125753010 15:42043227-42043249 ATGTGGGAGAGGCCTTCCGGAGG + Intronic
1128985798 15:72220317-72220339 ATGTGTGAGATGCCTTGATTTGG - Intronic
1130756929 15:86773876-86773898 ATCTGTCAGAGGCTTTCCTGTGG - Intronic
1131823321 15:96294977-96294999 ATGTGTGAGAGCTTTTCCTTTGG - Intergenic
1133853255 16:9525871-9525893 ATGTGTTGGAGGCCATCCTAGGG + Intergenic
1134842725 16:17414607-17414629 ATGTGTGTCAGGGCTTCCTGTGG - Intronic
1143663037 17:8339027-8339049 GTATGTGAGAGGCCCTCCTGTGG - Intergenic
1145081828 17:19900640-19900662 ATGTGGGAGAGGCCAGCCTGGGG + Intergenic
1146378963 17:32314571-32314593 AGGGGTGAGAGCCCTTCCCAGGG + Intronic
1148290190 17:46440042-46440064 AAGTGTGACAGACCTTCCAAAGG - Intergenic
1148312358 17:46657616-46657638 AAGTGTGACAGACCTTCCAAAGG - Intronic
1148720903 17:49752467-49752489 ATGTGGGTGATGCGTTCCTATGG - Intronic
1149757127 17:59196753-59196775 ATGTGTAAGAATCCATCCTAGGG - Intronic
1149797350 17:59533016-59533038 ATTTGAGAGGGGCCTTCCTAGGG - Intergenic
1151775460 17:76198214-76198236 ATGTGTGGGAGGGGTTCCTGAGG + Intronic
1153214076 18:2801142-2801164 ATGTGGAAGAGGATTTCCTAGGG + Intronic
1156510713 18:37634391-37634413 ATATGGGAGAGACCTTCCTATGG - Intergenic
1158037840 18:53055640-53055662 ATGTGTGAGAGACACTCGTATGG + Intronic
1160379432 18:78440205-78440227 ATGTGTGAGACACATACCTATGG - Intergenic
1161340776 19:3740786-3740808 CTGTGTGTGAGGCCTCCCCAGGG - Intronic
1167840526 19:52114049-52114071 ATGTGTCAGAGGCTTTCCCCAGG - Exonic
926634615 2:15166167-15166189 TTGTGTGGGAGGTTTTCCTAAGG + Intergenic
927283137 2:21328339-21328361 ATGTGGGAGAAGAATTCCTATGG + Intergenic
927920009 2:26965118-26965140 TTGAGTGTGAGGCCCTCCTATGG + Intergenic
928335731 2:30396412-30396434 ATGTGAGAGAGGGCTTCCCCAGG - Intergenic
936475419 2:112835518-112835540 CTGTGTTAGAGCCCTTCCTTGGG + Intronic
937626110 2:124045822-124045844 CTCTGTGAGAGGCCTGCCAAGGG - Intronic
938084154 2:128387247-128387269 CAGTGTGAGAGGCCTGCCTGGGG - Intergenic
939986433 2:148833742-148833764 GTGTGTGAGAGGCCTCCTGAGGG - Intergenic
943033348 2:182711967-182711989 ATGTCTGAGAGGCTTTTCTATGG - Intergenic
947225991 2:227840661-227840683 AGGTGTGAGAGAACTTTCTAGGG - Intergenic
1172976250 20:38908084-38908106 ATGAGGGAGAGGCCATCCTGTGG + Exonic
1173391727 20:42641280-42641302 ATGTGTGAGAGGCCTTCCTAAGG + Intronic
1174047380 20:47743081-47743103 ACTAGTGAGATGCCTTCCTATGG + Intronic
1177803446 21:25850439-25850461 ATATGTGTGAGGCCTGCCTTGGG + Intergenic
1179465336 21:41568017-41568039 ATGTATGAGAGGTCCTCCTGGGG + Intergenic
1180096680 21:45558584-45558606 ATGTGTGAGAGGACTGCGTTTGG + Intergenic
1182489942 22:30664866-30664888 AGGTGTGGCAGGTCTTCCTAAGG - Intronic
1183948752 22:41341023-41341045 AGGCGTGAGGGGCCTTCCTAGGG - Intronic
952322028 3:32286610-32286632 ATGTGTGTTACGCCTTCCTATGG - Intronic
952960785 3:38587922-38587944 ATGGGTGAAAGCCCTTCCTGTGG - Intronic
953760766 3:45685103-45685125 ATCTGCCAGAGGCCTTCCAATGG - Exonic
957348406 3:78991759-78991781 ATGTCTGATAATCCTTCCTATGG - Intronic
961116782 3:124336558-124336580 GTGTGTGAAAGGCCTCCCCAAGG + Intronic
961196416 3:125005664-125005686 TTGTGCGGGAGGCCATCCTAGGG - Intronic
962463094 3:135632409-135632431 CACTGTGAGAGGCCTTCCCAAGG + Intergenic
962947005 3:140181008-140181030 ATGTGGGAGAGGCTTTGCCAAGG - Intronic
964084388 3:152798651-152798673 ATGTGTGAGACACTCTCCTAGGG + Intergenic
964296829 3:155242351-155242373 ATGTGTCAGAGCCCTTCATTGGG + Intergenic
971228827 4:24780886-24780908 ATGTGTCACAGGCATCCCTAGGG - Intergenic
976788108 4:88845613-88845635 ATGTGTGAGATACATTCCTGGGG + Intronic
977307151 4:95339241-95339263 ATGTGTCTGTGGCCTTCCTTTGG + Intronic
978667915 4:111208736-111208758 ATGTGTGATAGGGGTTTCTATGG - Intergenic
978758119 4:112326032-112326054 ATGAGTGCCTGGCCTTCCTAGGG + Intronic
981749660 4:148081852-148081874 ATTGGTGAGGGGCCTTCCCAGGG + Intronic
985962651 5:3314397-3314419 GTGAGTGAGAGGCATTCCTGTGG - Intergenic
989400598 5:41004076-41004098 TTGTTTGAGGGTCCTTCCTAGGG + Intronic
990696149 5:58419757-58419779 ATGTGGGAGGGGACTTCCCAGGG - Intergenic
993822281 5:92633284-92633306 ATGTGTGACTGGCCTGCCAAGGG + Intergenic
997603113 5:135153995-135154017 AGATTTGAGAGCCCTTCCTAAGG + Intronic
998257427 5:140599040-140599062 CTATGTGTGAGGCCTTCCAACGG + Intergenic
1003157622 6:3609607-3609629 CAGTGTGAGAGGCCTGCCTAGGG - Intergenic
1006207867 6:32365405-32365427 ATGTGTGAAAGGCATGCCTGTGG + Intronic
1012277863 6:97295483-97295505 ATGTTTGATAGGCTTACCTATGG - Intergenic
1017844472 6:158244505-158244527 ATGAGTGTGGGGCCTTCATATGG + Intronic
1019878298 7:3835540-3835562 GGGGGTGAGAGGACTTCCTAGGG - Intronic
1022789769 7:33675304-33675326 ATGTGTGTGCGACCTTCTTAAGG + Intergenic
1022982485 7:35617592-35617614 ATCTATGAGAGCCCTTTCTAGGG + Intergenic
1024060734 7:45696669-45696691 ATGTGAGGGAGGCCATCCTACGG - Intronic
1026842009 7:73674698-73674720 GTGTGTGGGAGGCCTTCTGAAGG - Intergenic
1028085994 7:86638575-86638597 ATGGCTGAAAGGCCTTTCTAGGG - Intergenic
1029160937 7:98551431-98551453 ATGTATGAGAACCCCTCCTATGG - Intergenic
1031315190 7:120248159-120248181 ATGTGTGTGTGCCCTGCCTAGGG - Intergenic
1034339712 7:150343902-150343924 ATGTGTGAAAGGACTACTTAGGG + Intergenic
1035632963 8:1122009-1122031 ATGGGAGACAGACCTTCCTAGGG + Intergenic
1037365536 8:18117937-18117959 ATGTGTGAGAGACGATTCTAAGG + Intergenic
1037475726 8:19255515-19255537 AAGTGTGAGAAGCCTTCCCATGG - Intergenic
1037878960 8:22563667-22563689 ATGTGTGTGAGGCCTTCTCCCGG + Intronic
1038770508 8:30474790-30474812 ATTTGTCAGTGGCCTTCCTCTGG + Exonic
1039117620 8:34110012-34110034 ATGGGTGAGAGACTTGCCTACGG + Intergenic
1042283786 8:67084236-67084258 ATGTGTAAGAGGTGTCCCTAAGG + Intronic
1042678388 8:71349167-71349189 GTGTGTGAGAGTCCTTCCTGTGG - Intronic
1043154518 8:76761043-76761065 ATGTGTGAGAGTCCATCACAAGG + Intronic
1047029143 8:120857675-120857697 ATGCGTGAGAGGGCTCCCTTAGG - Intergenic
1048382126 8:133874475-133874497 ATTTGTGAAAGCCCTTGCTATGG - Intergenic
1049164897 8:141119515-141119537 AGGGGAGAGAGGCCTTCCTGGGG + Intronic
1049208845 8:141376117-141376139 GTCTATGAGAGGCCTTCTTAAGG - Intergenic
1049391667 8:142374870-142374892 ATGTGTGTGGGGTCTTCCCAGGG - Intronic
1056422820 9:86446315-86446337 TTGTGTGATAGCACTTCCTATGG + Intergenic
1056501788 9:87216917-87216939 CTTTCTGAGAGGCCTTCCTTAGG - Intergenic
1061081510 9:128373521-128373543 AGGTGTTAGAGGCCTTCCAGAGG - Intronic
1061748091 9:132754680-132754702 ATGTGTGATAGGCATGGCTAGGG - Intronic
1062508572 9:136891562-136891584 ATGTCTGACAGGCATGCCTAGGG + Intronic
1185878305 X:3717713-3717735 AAGTGTAAGAGGTCTTCCCAGGG + Intergenic
1187126814 X:16462025-16462047 ATGCGGGAGAGGCCTCCCCAAGG + Intergenic
1188972594 X:36636104-36636126 TTGGGTGAGAGGTTTTCCTATGG - Intergenic
1198343068 X:135733565-135733587 ATGTGTGAGAGTAGTTCTTAAGG - Intergenic
1198344921 X:135749730-135749752 ATGTGTGAGAGTAGTTCTTAAGG + Intergenic
1199315231 X:146369074-146369096 TTGTGTTAGAGGTCTTCATATGG + Intergenic