ID: 1173392368

View in Genome Browser
Species Human (GRCh38)
Location 20:42646527-42646549
Sequence AAATATCCACATATGGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 761
Summary {0: 1, 1: 0, 2: 4, 3: 96, 4: 660}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173392368 Original CRISPR AAATATCCACATATGGCCAA TGG (reversed) Intronic
901751939 1:11415446-11415468 AAATAGTCACATATGGCCGGTGG - Intergenic
901900717 1:12359523-12359545 AAATAGCCACATATGGCTACTGG + Intronic
902159724 1:14520258-14520280 AAATGACCACACATGGCCACAGG + Intergenic
902206537 1:14872317-14872339 TAATATCCACATGTGGCCAGTGG - Intronic
903135223 1:21305064-21305086 AAATAGCCACATGTGGCTCATGG - Intronic
903197553 1:21702763-21702785 AAATAGCTACATGTGGCTAATGG - Intronic
903633499 1:24796072-24796094 AAATAGCCACATATGACTAATGG - Intronic
905024705 1:34841762-34841784 AAATAGTCACATGTGGCTAATGG + Intronic
905277387 1:36827309-36827331 AAATATCCACAGAAGCCCCAGGG - Intronic
905400233 1:37696438-37696460 AAATAGCTACATATGCCCAGTGG - Intronic
905499492 1:38425603-38425625 AAAGATCCACCTATGGCCTCAGG + Intergenic
905712788 1:40120878-40120900 AGATAGCCACATGTGGCCAGTGG + Intergenic
905756131 1:40510795-40510817 AAGTAGCCACATATGGCTAGTGG + Intronic
905841963 1:41188442-41188464 AAATAGCCACATGTGGCTAGTGG - Intronic
905944151 1:41887936-41887958 TAATAGCCACATGTGGCCAGTGG + Intronic
906193304 1:43913006-43913028 AAGTGTCCACATCTGGCCCAAGG - Intronic
906267036 1:44440114-44440136 AAATATACCCACATGGCCAGTGG - Intronic
906711537 1:47933974-47933996 AAATAGTCACAGATGGCTAAGGG + Intronic
908430093 1:64048218-64048240 AAATAGCCACATGTGGCTAGTGG - Intronic
909173130 1:72319803-72319825 AAATAGCCACACATGGCGAGTGG + Intergenic
909539374 1:76773586-76773608 AAATAGCCACATGTGGCTAGTGG - Intergenic
909650451 1:77970403-77970425 CAATAACCACATATGGCTAGTGG - Intronic
909866571 1:80680528-80680550 AAATAGCCACATATGACTAGTGG + Intergenic
910339956 1:86174806-86174828 AAATATTAAAATATGGCCACAGG + Intergenic
910666592 1:89731611-89731633 AAATAGCCACATGTAGCCAGTGG + Intronic
911465260 1:98243958-98243980 AAATAGCCACATATGACTAGTGG + Intergenic
912304369 1:108551398-108551420 AAATACCCACATGTGGCTAATGG - Intergenic
913453980 1:119012325-119012347 AAAGATCGAGATATGGCCCAAGG - Intergenic
914912403 1:151798227-151798249 CAATAGCCACATGTGGCCAATGG - Intergenic
916524228 1:165594017-165594039 CACTATCTACATATGGCCATTGG + Intergenic
917394448 1:174577344-174577366 AAATATGTACATATAGTCAATGG + Intronic
917462343 1:175243219-175243241 GATTCTCCACATATGGTCAAAGG - Intergenic
918115566 1:181493747-181493769 AAATAGCCACATATGGCTAGTGG + Intronic
918333895 1:183488309-183488331 AAATAGCCATATGTGGCCAGTGG - Intronic
918333912 1:183488497-183488519 AAATGGCCACATGTGGCCAGTGG - Intronic
918898239 1:190377101-190377123 CAATATCCACCTATAGCTAATGG + Intronic
918941008 1:190996749-190996771 CAATAGCCACATGTGGCTAATGG - Intergenic
919034880 1:192293659-192293681 CAATAGTCACATATGGCAAATGG + Intergenic
919612630 1:199764353-199764375 AAATATCCACATGTGGCTAGTGG - Intergenic
919754054 1:201055528-201055550 AAATAGTCACATGTGGCTAATGG - Intronic
920413593 1:205782354-205782376 AAATAACCACACATGGCTACTGG - Intergenic
920517978 1:206600654-206600676 AAATAGCGACATGTGGCCAGTGG + Intronic
920530850 1:206701226-206701248 TAATAGTCACATATGGCCAGTGG - Intronic
920712408 1:208307745-208307767 GAATAGTCACATGTGGCCAATGG + Intergenic
921129247 1:212205821-212205843 TGATAGCCACATATGGCCAGTGG + Intergenic
921322490 1:213955458-213955480 AAATATCCAAAAAAGGCCGAGGG + Intergenic
921501241 1:215905967-215905989 AAATAGCTACATATGAGCAAGGG + Intronic
922026352 1:221752918-221752940 AAATAGCCACATGTGGCTAGTGG - Intergenic
923332663 1:232939959-232939981 AACTATTCTCATATGCCCAAGGG - Intergenic
923579062 1:235190096-235190118 ATATATCTACACAAGGCCAAAGG - Intronic
923973616 1:239234115-239234137 AAATAGCCACCTATAGCTAATGG - Intergenic
924219928 1:241863757-241863779 AAATAGCCACACATGGCTAGTGG - Intronic
924479718 1:244417637-244417659 AAATATGCTCATATGATCAATGG - Exonic
1064187419 10:13174581-13174603 AAATATCCACAGGTGGCTAGTGG - Intronic
1064259958 10:13777455-13777477 AAATGACCACAAATGACCAAGGG - Intronic
1064518047 10:16171232-16171254 AGTTCTCCACATATGGTCAAAGG + Intergenic
1065198004 10:23285862-23285884 CAATAGCCACATGTGGCCAAGGG + Intronic
1065888156 10:30097237-30097259 AAATAGCCACATGTGGCTAGTGG + Intronic
1066163677 10:32762024-32762046 AAATATCCACATATTGGGTAGGG + Intronic
1066392039 10:34985232-34985254 AAATAACCACATATGGCTAGTGG + Intergenic
1066667650 10:37801463-37801485 AAATATTCTCATAAAGCCAAAGG + Intronic
1067002073 10:42625066-42625088 AAATTTCCATAAATGGTCAAAGG - Intronic
1067019703 10:42784026-42784048 AAGTAACCACATGTGGCTAATGG + Intronic
1067122454 10:43485668-43485690 CAATATCCACATATGGCTAGTGG - Intergenic
1067332751 10:45337230-45337252 ATGTTTCCACATATGGTCAAAGG - Intergenic
1067499373 10:46788056-46788078 AAGTAACCACATGTGGCTAATGG + Intergenic
1067595256 10:47552266-47552288 AAGTAACCACATGTGGCTAATGG - Intergenic
1068728049 10:60325347-60325369 AAATGTCCACTTTTGGCCAATGG + Intronic
1069665996 10:70159190-70159212 AAATATCAAAATATTGACAAGGG - Intronic
1069823866 10:71243503-71243525 AAACAGCCACATATGGCTAGTGG + Intronic
1070139565 10:73728902-73728924 AAGTAACCACATGTGGCTAATGG - Intergenic
1070801286 10:79245766-79245788 AAACAGCCACATGTGGCCAGTGG - Intronic
1071162364 10:82763746-82763768 CAACAGCCACATATGACCAATGG - Intronic
1071357340 10:84811424-84811446 AAATATCCCCACATGGTCACGGG + Intergenic
1071700549 10:87928599-87928621 AAAGATACACAAATGGCAAATGG - Intronic
1071787041 10:88912715-88912737 AAATAACCACATGTGGCTAGTGG + Intronic
1072353642 10:94583959-94583981 AAATAGCCAGAAATGGGCAAAGG - Intronic
1072564379 10:96605390-96605412 AAATAACCACGTGTGGCCAGTGG + Intronic
1072936707 10:99720069-99720091 AAATATCCACATGAGGCTACAGG + Intronic
1073199795 10:101726125-101726147 AAACATTAACATATGGACAAAGG - Intergenic
1073327912 10:102653129-102653151 AAATAGCCACATATGACTAGTGG + Intronic
1073482454 10:103795246-103795268 AAATAGCCACATGTGGCTAGTGG + Intronic
1073523175 10:104154586-104154608 AAACATCAGCATATGGCAAATGG + Intronic
1073731387 10:106292389-106292411 GAATATCCACAGATGGGCAGAGG + Intergenic
1073812746 10:107168420-107168442 AAAAATCCACATGTGGATAAAGG + Intergenic
1074541976 10:114372475-114372497 CAATATCCACAACAGGCCAAGGG + Intronic
1074631638 10:115261558-115261580 AAATGTACACATCTGGCAAAGGG + Intronic
1074644580 10:115432290-115432312 CAATAGCCACATATGGCTAGTGG + Intronic
1075590382 10:123686959-123686981 TAATGTCCAAATATGGCCAAGGG + Intronic
1075928185 10:126270542-126270564 AAATAGCCACATGTGGCTAGTGG + Intronic
1077879306 11:6335685-6335707 AAACAGCCACATGTGGCCAGTGG - Intergenic
1078506698 11:11955536-11955558 CAATAGCCACATGTGGCTAATGG + Intronic
1078518599 11:12045972-12045994 AAATAGCCACATGTGGCTAGTGG + Intergenic
1079147827 11:17869561-17869583 AAATGTCCTCACATGGCAAAAGG + Intronic
1079287283 11:19147700-19147722 AAATAGCCACATATAGCTAGTGG + Intronic
1079464685 11:20718307-20718329 AAGTAGCCACATGTGGCCAGTGG + Intronic
1079498388 11:21072852-21072874 AAATGTACACATATGGCTAATGG - Intronic
1079634695 11:22721668-22721690 CAATAGCCACATGTGGCTAATGG + Intronic
1080083131 11:28245318-28245340 AAATATCCTTTTATGGCCACAGG - Intronic
1080395278 11:31884435-31884457 ACATAGCCACACATGGCCAGTGG + Intronic
1080569013 11:33539129-33539151 AATGATCCACATAAAGCCAAGGG - Intergenic
1080655520 11:34254993-34255015 AAATAGCCACATATGGTTAGTGG + Intronic
1080951289 11:37036138-37036160 AAATATCCATAAATGTCCCATGG + Intergenic
1083080043 11:60082109-60082131 AAAGACATACATATGGCCAATGG - Intergenic
1083194541 11:61077036-61077058 AAATAGCCACATGTGGCTAGTGG - Intergenic
1083523318 11:63336789-63336811 AAGTATCTACATGTGACCAAAGG - Intronic
1085379961 11:76106724-76106746 AAAGATCCAGATTGGGCCAAAGG + Intronic
1085763892 11:79265355-79265377 CCATAGCCACATGTGGCCAATGG - Intronic
1086033129 11:82384160-82384182 CAATATTCACTTAAGGCCAAAGG - Intergenic
1086578354 11:88366621-88366643 AAATAGCTACATATGGCTAGTGG + Intergenic
1087023785 11:93629602-93629624 AAATAACCACATGTGGCTAGTGG + Intergenic
1087864939 11:103213604-103213626 AAAGACACACAAATGGCCAACGG - Intronic
1087972860 11:104507178-104507200 AAATAGTCACATGTGGCTAATGG - Intergenic
1088128783 11:106461923-106461945 AAATAGCCACATGTGGCTAGTGG + Intergenic
1088246653 11:107825014-107825036 AAATAGCCATATATGGAGAATGG + Intronic
1088448963 11:109962342-109962364 GATTCTCCACATATGGTCAAAGG - Intergenic
1088938178 11:114425757-114425779 CAATATTCACATAAGGCCCAAGG + Intronic
1089427301 11:118389276-118389298 TAATAGCCACATATGGCCAGTGG + Intronic
1089437109 11:118478471-118478493 CAATAGCCACATGTGGCTAATGG - Intronic
1089579998 11:119475749-119475771 GAATGTCCACACATGGCTAATGG + Intergenic
1089800059 11:121020527-121020549 AAATAGCCACATGTGGCTAGTGG + Intergenic
1089997992 11:122927396-122927418 CAATAACCACAAATGGCCTAAGG + Intronic
1090331389 11:125935166-125935188 AAATAACCACATGTGGCTAGAGG + Intergenic
1090694387 11:129223208-129223230 CAATAACCACATATGGCTAGTGG + Intronic
1090725872 11:129526809-129526831 TATTATCCAGATTTGGCCAAAGG + Intergenic
1090909088 11:131102932-131102954 AAACATCCAAATATGGCCTATGG - Intergenic
1091561301 12:1615978-1616000 AAATAGCCACATGTGGTCAGTGG + Intronic
1092227920 12:6760649-6760671 AAATAGCCACATGTGGCTAGTGG - Intronic
1092252312 12:6906445-6906467 AAATATCCACATAGCGCAGATGG - Exonic
1092982874 12:13814813-13814835 AAATAGCCACATTTGGCTAGTGG + Intronic
1092992409 12:13915682-13915704 AAATAGCCACATAAGACCAGTGG + Intronic
1093491168 12:19706439-19706461 ATATATACACATATGCACAATGG + Intronic
1093574589 12:20712277-20712299 GAATATTCCCATATTGCCAAGGG - Intronic
1093665045 12:21802636-21802658 TAATAGCCACATGTGGCCAGGGG + Intronic
1093985975 12:25533834-25533856 AAATATCCTCATCTTCCCAAAGG - Intronic
1094021475 12:25918992-25919014 CAACAGCCACATGTGGCCAAGGG - Intergenic
1094284540 12:28778121-28778143 CAATAGCCACATGTGGCTAATGG + Intergenic
1094346583 12:29476519-29476541 ACATATCCACATGTATCCAAAGG + Intronic
1094612553 12:32008316-32008338 GAAGATACACAAATGGCCAACGG + Intergenic
1095406118 12:41869317-41869339 AAATATCTACACATGACCACAGG - Intergenic
1095642770 12:44503409-44503431 TAATAGCCACAAATGGCCAGTGG + Intergenic
1095904045 12:47359002-47359024 AAATAGCCACGTATGGCTAGTGG + Intergenic
1096371845 12:51075433-51075455 CAATAGCCACATATGGCAACTGG + Intronic
1097210760 12:57367382-57367404 AAATATCCACATGTAGCTAGTGG + Intronic
1098807939 12:75044102-75044124 AAATATGCAAATATTTCCAAAGG - Intronic
1099184469 12:79502962-79502984 AAATATCCAGGTATGTGCAATGG + Intergenic
1099782792 12:87220364-87220386 AAATATCCATCTTTGGCCCAGGG + Intergenic
1099834016 12:87883828-87883850 AAATATCCTCATATGGCATATGG - Intergenic
1100071497 12:90725179-90725201 AAATATCCACATGTGGTTAAAGG + Intergenic
1100451903 12:94714940-94714962 AAATATGCACATATGCACATTGG + Intergenic
1100543004 12:95575741-95575763 AAATACCCACATATGGCTAGTGG - Intergenic
1100605831 12:96151244-96151266 CAATAGCCACATGTGGCTAACGG - Intergenic
1101115970 12:101531658-101531680 AAATATCCATATGTGGCTAGTGG + Intergenic
1101520405 12:105477240-105477262 AAATCCCCACAACTGGCCAACGG + Intergenic
1101588093 12:106102497-106102519 AAATATCCACCTGTGGCTAGTGG + Intronic
1101888761 12:108692342-108692364 AAATGTCCACATCTGTACAAAGG + Intronic
1101974862 12:109348381-109348403 AAATAGCCACATGTGGCTAGTGG + Intronic
1102489432 12:113280609-113280631 AAATTGCCACATGTGGCCAGTGG - Intronic
1102802306 12:115746874-115746896 AAACAGCCACATAGGGCTAATGG + Intergenic
1103196774 12:119050799-119050821 AAATAGCCACAGATGGCTAGTGG - Intronic
1103406042 12:120676150-120676172 AAATAGTCACATATGGCTAGTGG - Intergenic
1103428088 12:120856147-120856169 AAATAGCCCCATGTGGCCAGTGG + Intronic
1104389840 12:128382489-128382511 CAATAACCACATGTGGCTAATGG + Intronic
1105686588 13:22789258-22789280 AAATACCCACATTCTGCCAAGGG + Intergenic
1106014417 13:25854746-25854768 CAATAGCCACATGTGGCTAATGG - Intronic
1106374796 13:29175692-29175714 CCACATCCACATAAGGCCAAAGG - Intronic
1106526517 13:30545608-30545630 AAATAGCCACATATGGCTAGTGG - Intronic
1107490078 13:40873343-40873365 GATTCTCCACATATGGTCAAAGG - Intergenic
1108069114 13:46609335-46609357 TGATATCCACATATTGGCAATGG - Intronic
1108723205 13:53153046-53153068 ATATATACACATATACCCAAAGG + Intergenic
1109043449 13:57374021-57374043 AAATTTCCACATAGTGACAAAGG - Intergenic
1109213982 13:59566409-59566431 AAATAGCCACATGTGGACAATGG - Intergenic
1109261316 13:60148338-60148360 AAATAGCCATATGTGGCTAATGG - Intronic
1110134507 13:72048766-72048788 AAACATCCCCATTTAGCCAAAGG + Intergenic
1110306658 13:73995768-73995790 ATATATCCAAATAGGGCAAATGG - Intronic
1110331179 13:74274890-74274912 AAACATCCAAATATGACAAATGG - Intergenic
1110971421 13:81767014-81767036 TAATTTCCACATATGGTGAAAGG - Intergenic
1111215042 13:85130496-85130518 AAATAGCGACATAAGGCTAATGG - Intergenic
1111631978 13:90853730-90853752 AAAGATCCACCTATGGCCTCAGG - Intergenic
1111965356 13:94856463-94856485 AAATAGCCACTTATGGCTGAGGG + Intergenic
1111971402 13:94920846-94920868 AAATAGCCACATGTGGCTAGTGG + Intergenic
1112250326 13:97773230-97773252 GATTCTCCACATATGGTCAAAGG + Intergenic
1112714662 13:102169949-102169971 AAATAGCCACATTTGGCTAGTGG + Intronic
1113188676 13:107718867-107718889 TAATAGCCACATGTGGCCAGGGG + Intronic
1114185001 14:20394406-20394428 AAATAGCCACATGTGGCTAGTGG + Intronic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1114842510 14:26281927-26281949 AAAGCTCCACATTTGGCAAATGG + Intergenic
1114884164 14:26826934-26826956 TAATATCTACGTATGGCTAATGG - Intergenic
1115028847 14:28771074-28771096 AAATATACACAAATGGGGAATGG + Intergenic
1115284441 14:31701924-31701946 AACTATTCACATATTGCAAAGGG - Intronic
1115416400 14:33139675-33139697 AAAGAGCCACATAGGGCTAATGG - Intronic
1115805793 14:37049916-37049938 CAATAGCCACATATAGCTAATGG + Intronic
1116130570 14:40850939-40850961 TAATATCCACATATTGCTAGTGG - Intergenic
1116713974 14:48405400-48405422 CAAGATACACAAATGGCCAATGG - Intergenic
1116920927 14:50573369-50573391 CAATAGCCACATATGACTAATGG - Intronic
1116920933 14:50573450-50573472 AAATAGTCACATATGGCTACTGG + Intronic
1117097131 14:52310397-52310419 AAATAGCCAGATGTGGCTAATGG + Intergenic
1117618438 14:57558951-57558973 CAATAGCCACATGTGGCTAATGG + Intergenic
1117982941 14:61359745-61359767 AAATAGCCACATATGGCTAGTGG - Intronic
1118453203 14:65922899-65922921 AAATATCCACATGTGACTAGTGG - Intergenic
1118747505 14:68784787-68784809 GAATCTCCACAAAAGGCCAAGGG + Intergenic
1119010897 14:70987387-70987409 AAATAGCCACATATGGCTAATGG + Intronic
1119278757 14:73385472-73385494 AAATAGCTACATATGGCTAGTGG + Intronic
1119584411 14:75819344-75819366 TAGTATCCACAAATGGCAAAGGG - Intronic
1120082422 14:80230553-80230575 GATTCTCCACATATGGTCAAAGG + Intronic
1120475749 14:84984743-84984765 AGACATCTACATATGGCCCAGGG + Intergenic
1120627820 14:86850796-86850818 AAATAGCCACATGTGGCTAGTGG - Intergenic
1120783889 14:88512675-88512697 GAATAGCCACATGTGGCTAATGG - Intronic
1120981554 14:90293575-90293597 AAATAGCCACATGTGGCTAGAGG + Intronic
1121672945 14:95726900-95726922 CAATAGCCACATATGGACAATGG - Intergenic
1122144417 14:99681058-99681080 AGAAAGCCACATGTGGCCAATGG + Intergenic
1122897243 14:104765365-104765387 AAAAATCCAAAAATGGGCAAAGG + Intronic
1124811451 15:32943195-32943217 AAATATCCACATAGGGTACACGG + Intronic
1124858609 15:33415028-33415050 CAACAGCCACATATGGCCAGTGG - Intronic
1125300180 15:38246587-38246609 AAACAGCCACATATGGCTAGTGG + Intergenic
1125371932 15:38986964-38986986 AAACAGCCACACATGGCCAATGG + Intergenic
1125474530 15:40038165-40038187 AAATAGCCACACAGGGCAAAAGG + Intronic
1126015479 15:44346493-44346515 AAATAGCCACATGTGACCAATGG - Intronic
1126057592 15:44745501-44745523 AAATAAGAACATATGGCCCATGG + Intronic
1126302438 15:47213091-47213113 AAATAGCCATACATGGCTAATGG - Intronic
1126487410 15:49197207-49197229 AAATATCAAGAAATGGGCAAAGG - Intronic
1126791063 15:52221709-52221731 AAATATACAGATAGGGACAAAGG - Intronic
1127159836 15:56170629-56170651 AAATAGCCACATGTGGCTAGTGG - Intronic
1127488628 15:59441466-59441488 AAGTAGTCACATAGGGCCAATGG + Intronic
1127640991 15:60915663-60915685 AAATAGCCACATGTGGCTATTGG + Intronic
1127675794 15:61237504-61237526 AAATAGCCACACGTGGCCACTGG + Intergenic
1128077163 15:64834668-64834690 AAATAGCCACATGTGGCTAGTGG - Intergenic
1128140774 15:65299347-65299369 CAATAGCCACATGTGGCCAGTGG - Intronic
1129222883 15:74143409-74143431 AAATAACCACATGTGGCTAGTGG - Intergenic
1129813550 15:78531188-78531210 AAATAGCCACATATGTCTAGTGG + Intronic
1130167280 15:81474530-81474552 AAATAACTACATGTGGCAAATGG + Intergenic
1130393774 15:83483468-83483490 AAATGACCACATGTGGCCAGTGG + Intronic
1131863326 15:96678108-96678130 AAATAACCACACGTGGCTAAGGG - Intergenic
1132166088 15:99592405-99592427 CAAGAGCCACATATGGCTAATGG - Intronic
1133313043 16:4863449-4863471 AAATATCCACATGTGGCTTTTGG - Intronic
1133492644 16:6285463-6285485 ACATCTCTACATATGGCAAAAGG + Intronic
1133712716 16:8416929-8416951 CAAAAGCCACATGTGGCCAATGG + Intergenic
1133894172 16:9909546-9909568 AAATAGCCACATATGGCTAGTGG + Intronic
1133993430 16:10728469-10728491 AAATCGCCACATGTGGCCACTGG + Intergenic
1135216356 16:20574949-20574971 AGTTCTCCACATATGGTCAAAGG + Intronic
1135667824 16:24350888-24350910 AAATGTACACATATGACCTATGG - Intronic
1137763386 16:50958780-50958802 ATGTGTCCTCATATGGCCAAAGG - Intergenic
1138602056 16:58061747-58061769 AAATGACTACATCTGGCCAATGG + Intergenic
1138851753 16:60637547-60637569 AAGTAGTCACATATGGCAAATGG + Intergenic
1138909122 16:61375142-61375164 AAATACGCACATATGGGCAGGGG - Intergenic
1139271407 16:65686949-65686971 AAATATGCAACTAAGGCCAAAGG + Intergenic
1139661895 16:68426654-68426676 AAATATCCTCAAGAGGCCAAGGG + Intronic
1139679555 16:68550705-68550727 GAATAGCCACATGTGGCCAGTGG + Intronic
1140152116 16:72378138-72378160 AAATAGCCACATGTGACCAATGG - Intergenic
1140678186 16:77354982-77355004 ATCTAACCACATATGCCCAAAGG - Intronic
1140837384 16:78807785-78807807 AAATAGCCACATGTGGCTAATGG - Intronic
1140860325 16:79012574-79012596 GAAGATCCACATATGGCTGAGGG + Intronic
1140902509 16:79382428-79382450 CAATAGCCACATATGTCCAGTGG - Intergenic
1142776194 17:2141064-2141086 AAATATCCACATGTGGCTAGTGG - Intronic
1142965717 17:3579881-3579903 ACATTTCCAGATATGGCCAAAGG - Intronic
1143518669 17:7432975-7432997 TAATAGCCACATTTGGCTAATGG - Intergenic
1144102293 17:11952498-11952520 AAATAGCCACATGTGGCTAGTGG + Intronic
1144859293 17:18290242-18290264 ACAAATCCTCATGTGGCCAATGG + Intronic
1145739115 17:27257424-27257446 AAATAGCCACATGTGACTAATGG + Intergenic
1145955281 17:28850283-28850305 AAAGAAACTCATATGGCCAAGGG - Intronic
1145977264 17:28991517-28991539 AAATAGCCACATGTGGTCAGTGG + Intronic
1148904288 17:50901947-50901969 AAATAGCCACATCTGGCTAGTGG + Intergenic
1149497655 17:57130037-57130059 CAATAGCCCCAGATGGCCAATGG - Intergenic
1149544906 17:57496291-57496313 ACATAGCCACAGATGGCCAAAGG - Intronic
1149676370 17:58466649-58466671 AAATAGCCACATGTGGCTAGTGG + Intronic
1151062655 17:71113937-71113959 GAATAGCCACATACAGCCAAGGG + Intergenic
1151376110 17:73690227-73690249 AAATACCCCCATATGGCCAGCGG + Intergenic
1151381549 17:73729178-73729200 TAATAGCCACACATGGCCCATGG - Intergenic
1152331484 17:79675710-79675732 GAAGATCCACAGAGGGCCAACGG + Intergenic
1153371220 18:4318187-4318209 TAATACCCAAATATGGCAAATGG + Intronic
1153404200 18:4717587-4717609 AAATTACCACATATGGCTAATGG - Intergenic
1153545335 18:6199306-6199328 AAATAGCCACATATGGGCAGTGG - Intronic
1153763151 18:8351039-8351061 AAATGTCCACATGTGACTAATGG + Intronic
1154955338 18:21248730-21248752 AAATAGCCACATGTGGCTAGAGG - Intronic
1155455375 18:26006511-26006533 CGATAGCCACATATGGCCAGTGG - Intergenic
1155895160 18:31316105-31316127 AAATAACCACATGTGGCTAGTGG - Intergenic
1157120192 18:44902025-44902047 AAATAGCCACATGTGGCTACTGG - Intronic
1157321839 18:46640723-46640745 TAATAGCCACATATGGTCAGGGG + Intronic
1158287723 18:55903360-55903382 AAATAGCCTCATATGGCTAATGG + Intergenic
1158385736 18:56989230-56989252 TATTAGCCACATATGGCTAATGG - Intronic
1158481837 18:57828760-57828782 TAATGTACACATATTGCCAATGG - Intergenic
1159016906 18:63108372-63108394 AAATAGCCACATGTGGCTAGTGG - Intergenic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1162963432 19:14142854-14142876 AAATAGCCACATGTGGCTAGTGG - Intergenic
1163812593 19:19443091-19443113 AAATAGCCACATGTGGCTAATGG + Intronic
1166049991 19:40253068-40253090 AAAGAGCCACATATGGCTAGTGG - Intronic
1166549082 19:43653152-43653174 AAACAACCACATGTGGCCAGTGG - Intronic
1167218766 19:48183454-48183476 AAATAGCCACCTATGGCTATTGG + Intronic
1167277565 19:48548025-48548047 AAATAGCCACCTATGGCCAGTGG + Intergenic
1167438582 19:49494879-49494901 AAATAGCCACATGTGGCTAAAGG - Intergenic
1168016376 19:53576793-53576815 ACATATCCAGTTACGGCCAAGGG - Exonic
1168375016 19:55869686-55869708 AACGAACCACATATGGCCTACGG - Intronic
925440146 2:3878677-3878699 AAATAGCCACATATGGCTGGTGG + Intergenic
925847462 2:8046614-8046636 TAATAGCCACATGTGGCCAGGGG - Intergenic
926278869 2:11428447-11428469 AAATAGCCACATGTGGCTAGTGG + Intergenic
926390210 2:12382439-12382461 TAATAGCCACATGTGGCTAATGG + Intergenic
926657814 2:15428319-15428341 AAATAGCCACATGTGGCCAGTGG + Intronic
926680169 2:15657068-15657090 AAATAGCCACATATGTCTAGTGG - Intergenic
927018128 2:18989100-18989122 CAATAGCCACATATGACCCATGG - Intergenic
927095499 2:19744996-19745018 AAATAGTCACATATGCCTAATGG - Intergenic
927119967 2:19949602-19949624 CAATAGCCACATACGGCTAATGG + Intronic
927220263 2:20700898-20700920 AAATAACCACATGTGGCTAGTGG + Intronic
927290840 2:21403351-21403373 ATATGTCCTCACATGGCCAAAGG - Intergenic
928038748 2:27852322-27852344 AAATATCCACATGTGGCTAGTGG + Intronic
928376935 2:30782864-30782886 AAGTATCCACATATGGCTTGTGG - Intronic
929058269 2:37897775-37897797 AAATTTCCTTATATGGCAAAAGG - Intergenic
929270220 2:39963791-39963813 AGTTCTCCACATATGGTCAAAGG + Intergenic
930141435 2:47954878-47954900 AAATAACCACATGTGGCTAGTGG - Intergenic
932149681 2:69358683-69358705 AAATAGCCACATACAGCTAATGG - Intronic
932754419 2:74396633-74396655 TAATGGCCACATGTGGCCAAGGG + Intergenic
932817035 2:74870333-74870355 ACATAGCCACAGATGGCCAGTGG + Intronic
933094416 2:78160438-78160460 AAATCCCCACATATGTCTAATGG - Intergenic
934059504 2:88281099-88281121 AAATAGCCACATGTGGCTAGTGG - Intergenic
935239350 2:101164943-101164965 AAATAGCCACACATGGCTAGTGG - Intronic
935856855 2:107283833-107283855 CAATAACCACATATGGCTAGTGG - Intergenic
937697366 2:124822900-124822922 AAATATTCACATGTTCCCAAAGG - Intronic
937969520 2:127538430-127538452 AAATAGCCACATGTGGCTAGTGG + Intronic
938324101 2:130386118-130386140 AAATAGCCACACATGGCTAGTGG - Intergenic
938656091 2:133435722-133435744 AGATATCCACATGTGGCTAGTGG + Intronic
938704392 2:133909773-133909795 GAATATCCACATATAGCCAGTGG + Intergenic
939147178 2:138429832-138429854 AAATATCCAGAGATTACCAAGGG + Intergenic
939444743 2:142294014-142294036 AAATTTCAACATATGTCCTATGG - Intergenic
940046902 2:149419441-149419463 AAATAGTCACATGTGGCCAGTGG - Intronic
940112368 2:150169026-150169048 AAATATCTCCATATGGGGAAGGG - Intergenic
940406638 2:153311346-153311368 AAATATCCAAATATGAAGAAAGG + Intergenic
940493808 2:154399475-154399497 ATATATCCTCACATGGACAAAGG + Intronic
940858006 2:158744857-158744879 AAATAGCCACATATGGCCAGTGG + Intergenic
940941100 2:159561622-159561644 AAATAGCCACATGTGGCTTATGG + Intronic
941055587 2:160784300-160784322 GAATATCCACATGTGGCTAGTGG - Intergenic
941554677 2:166962179-166962201 AAATATCCACACATATCCAAAGG + Intronic
941564371 2:167088023-167088045 AAATATTTTCATATGACCAATGG - Intronic
941664837 2:168234385-168234407 AAATAGCCACATATGGTTAGTGG + Intronic
941903677 2:170701178-170701200 AAATAGCCACATGTGGCTACTGG + Intergenic
942090086 2:172481320-172481342 AAATAGCCACATAAGGACTAGGG + Intronic
942874195 2:180773616-180773638 AAATATCCACATGTGGCTAGTGG + Intergenic
943517980 2:188910244-188910266 GGTTCTCCACATATGGCCAAAGG + Intergenic
943601632 2:189927789-189927811 AAATAGCCACATATGGCTAGTGG - Intronic
943655411 2:190503369-190503391 TAATAGCCACATATGGCTTATGG - Intronic
944396883 2:199278320-199278342 AAATACCCACATGTGGCTAGTGG - Intronic
944431387 2:199637429-199637451 AATTTTCCACATGTGTCCAAAGG + Intergenic
944457757 2:199912429-199912451 AGATAGCCATATATGGCTAATGG - Intronic
944479971 2:200146565-200146587 AAAGATACACAAACGGCCAATGG + Intergenic
944655630 2:201874137-201874159 AAATAGCCACATGTGGCTAATGG - Intronic
944682954 2:202093396-202093418 CAATAGCCACATGTGGCTAATGG - Intronic
944876897 2:203971665-203971687 AAATAATCGTATATGGCCAAAGG - Intergenic
944958260 2:204837790-204837812 AGAAAACAACATATGGCCAAGGG - Intronic
945056085 2:205870255-205870277 AAATAGCCACATGAGGCCAGTGG + Intergenic
945505535 2:210635592-210635614 AAATAACCACATGTGGCTAGGGG + Intronic
945960058 2:216123998-216124020 AAATAGCCACATGTAGCTAATGG - Intronic
946079000 2:217100497-217100519 AGATAGCCACATATGGCTATTGG - Intergenic
946272044 2:218602536-218602558 AAAAATAAAAATATGGCCAAGGG - Intergenic
947655317 2:231821570-231821592 AAGTCTCCAAATATTGCCAAAGG - Intergenic
948146388 2:235711243-235711265 AAATAGCCACACAGGGCCAGCGG + Intronic
1168765139 20:377065-377087 CAATAACCACATGTGGCAAATGG - Intronic
1169055629 20:2618363-2618385 AAATAACCACACATGGCTAATGG + Intronic
1169495248 20:6109058-6109080 AGATATCCACATGTGGCTAGGGG + Intronic
1169513908 20:6295918-6295940 AAATAGCCACATGTGGCTAGTGG - Intergenic
1169566986 20:6865457-6865479 AAATAGCCACATGTTGCCAGTGG - Intergenic
1169591036 20:7142672-7142694 CAATATTCACATGTGGCTAATGG - Intergenic
1169610008 20:7368060-7368082 CAATAGCCACATGTGGCCATTGG + Intergenic
1169698110 20:8414798-8414820 AAATAGCCACATGTGGCTAGTGG + Intronic
1169833462 20:9851855-9851877 AAATAGCCACATGTAGCTAATGG + Intergenic
1169911019 20:10647503-10647525 AAATAGCCACATGTGGCCGGTGG - Intronic
1170538017 20:17361002-17361024 AAATAGGCACATATGGCTAGTGG - Intronic
1170785655 20:19465091-19465113 AGATAGCCACATGTGGCCAGTGG + Intronic
1170789014 20:19492358-19492380 AAATCTCCACATCTGTGCAATGG + Intronic
1171009304 20:21499561-21499583 AAATAGCCACATGTGGCCAGTGG - Intergenic
1171120292 20:22562691-22562713 AAATATCCACCTATGTCACAGGG + Intergenic
1172238022 20:33391425-33391447 AAATAGCCACATGTGGCTAGTGG + Intronic
1172395348 20:34599884-34599906 GAATAGCCACATATGGCTAGGGG - Intronic
1172742170 20:37177834-37177856 AAATATCCACATAAGGCTAGTGG + Intronic
1172757431 20:37296079-37296101 AAAAAGCCACATGTGGCCAAAGG - Intronic
1173178099 20:40780345-40780367 AAATAATCACATGTGGCCAGTGG - Intergenic
1173248290 20:41350929-41350951 AAATAGCCACATATAGCCAGTGG - Intronic
1173342623 20:42166425-42166447 AAATAGCCACAGGTGGCCAGTGG + Intronic
1173392368 20:42646527-42646549 AAATATCCACATATGGCCAATGG - Intronic
1174620538 20:51871152-51871174 AAATAGCCACATATGGCTAGTGG - Intergenic
1174725482 20:52857225-52857247 CATTATCCACATGTGGCCAGTGG + Intergenic
1175526110 20:59634895-59634917 AAATAGCCACCTGTGGCTAATGG + Intronic
1175867254 20:62185777-62185799 AAATGGCCACATTTGGCCAGTGG + Intronic
1175982916 20:62749658-62749680 GAAGAGCTACATATGGCCAATGG + Intronic
1176948921 21:15020247-15020269 AAAGATACACATATAGACAATGG + Intronic
1177003023 21:15636556-15636578 GGTTCTCCACATATGGCCAAAGG + Intergenic
1177119271 21:17121970-17121992 AAAGATCCACCTATGACCACGGG + Intergenic
1177828304 21:26108428-26108450 AAACAACCACATAGGGCCAGTGG + Intronic
1178289138 21:31351675-31351697 AAAGATCCACATGTGCCCAAGGG + Intronic
1178570921 21:33736484-33736506 AAAAATCCATATATGAGCAAAGG + Intronic
1178783773 21:35633159-35633181 AAATAGCTACATATGGCTATTGG - Intronic
1181961344 22:26624035-26624057 AATTAGCTACATATGGCCAGTGG + Intronic
1182407522 22:30149561-30149583 AAACATCCAGATTTGGTCAAAGG - Intronic
1182538691 22:31026026-31026048 AATTATCCAAATATGGCCGGAGG - Intergenic
1183920241 22:41160827-41160849 AAATAGCAACATGTGGCTAATGG - Intronic
1183993250 22:41613073-41613095 AAATAGCCACATGTGGTCAGTGG - Intronic
949444988 3:4125175-4125197 AAATATCCACATGTGGCTAGTGG - Intronic
949938370 3:9135065-9135087 AAATAGCCACATGTGGCTAGTGG - Intronic
950788065 3:15452008-15452030 CAATAGCCACATCTGGCCAGTGG - Intronic
950888792 3:16384723-16384745 AAATAGCCACATGTGGCTAGTGG - Intronic
951126704 3:18993338-18993360 CAATAGCCACATGTGGCTAATGG - Intergenic
951188573 3:19742787-19742809 CAATAGCCACATGTGGCCAGCGG - Intergenic
951188578 3:19742883-19742905 AAATATCCACAAATGTCTAGTGG + Intergenic
951221289 3:20071246-20071268 CAATAGCCACATGTGGCCAGAGG + Intronic
951415942 3:22421285-22421307 CAATAGCCACATATGCCCAATGG + Intergenic
951482953 3:23181047-23181069 AAATATCCGCATGTGGCCAGTGG - Intergenic
951648012 3:24915461-24915483 CAATAGCCACATGTGGCTAATGG + Intergenic
951705846 3:25543590-25543612 AAATGGCCACAGATGGCCAATGG - Intronic
951900848 3:27656295-27656317 AAATAATAACATATGGCCAAGGG - Intergenic
952521568 3:34163952-34163974 AAATAGCCACATGTGGCTAGTGG - Intergenic
952709155 3:36411937-36411959 AAAAATCTACATATGCCCATGGG + Intronic
952793807 3:37221260-37221282 AAATAGCTACATGTGGCTAATGG - Intergenic
953082830 3:39636714-39636736 AAATAGCCCCATATGACCAGTGG - Intergenic
953168298 3:40484741-40484763 AAATAGCCACATGTGGCTAGTGG + Intronic
953239731 3:41138044-41138066 CAATCTCCACATGTGGGCAAAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953496605 3:43393007-43393029 AAATAGGCACAGATGGCCACAGG + Intronic
953648412 3:44776464-44776486 AAATAGCCACATATAACTAATGG - Intronic
953789968 3:45939810-45939832 ATATAGCCACATATGGCTAGTGG - Intronic
953967418 3:47320352-47320374 AAATAGTCACATGTGGCTAATGG + Intronic
954186367 3:48919704-48919726 AAATAACCACATGTGGCTAGTGG + Intronic
954727820 3:52630381-52630403 AAATAGCCACACATGGCTAGTGG - Intronic
955102454 3:55863895-55863917 CAATAGCCACATATGGCTCATGG + Intronic
955293955 3:57718431-57718453 AAATAGCCAAATGTGGCTAATGG - Intergenic
955710800 3:61777337-61777359 AAATAGCCACATGTGGCTAGTGG + Intronic
955779210 3:62465397-62465419 AATTATCCAGATATGACGAAGGG - Exonic
955846603 3:63169673-63169695 AAATAACCACATTTGGCAAGTGG - Intergenic
956109472 3:65856159-65856181 AAATAGTCACATATGGCTAATGG + Intronic
956347319 3:68294932-68294954 CAGTAGCCACAAATGGCCAATGG + Intronic
956366847 3:68513374-68513396 AAACAGCCACATATGGCTAGTGG - Intronic
956608100 3:71093382-71093404 AAATAGCCATATGTGGCCAGTGG - Intronic
957002625 3:74903856-74903878 AATGATCCAGATTTGGCCAAGGG - Intergenic
957369037 3:79267063-79267085 AAATATCCACATATGGATAGTGG - Intronic
958053388 3:88378588-88378610 AAATAGACACGTATGGCTAATGG + Intergenic
958879245 3:99650789-99650811 AAATAACCACATGTGGCTAATGG + Intronic
959319562 3:104853958-104853980 CAATAGCCACATATGGCTATTGG - Intergenic
959707139 3:109348590-109348612 AAATAGCCACATATGTTCAGTGG + Intergenic
959716359 3:109437700-109437722 AAAGAACCACATATGGCAAGTGG + Intergenic
959746393 3:109780261-109780283 AGTTCTCCACATATGGTCAAAGG + Intergenic
960135669 3:114102466-114102488 GAATAACCATATGTGGCCAATGG + Intergenic
960686803 3:120302992-120303014 GAAGATCCACATATGGTCAAAGG - Intergenic
961027761 3:123575059-123575081 AAATAGGCACATATGGCTAGTGG - Intronic
961073082 3:123954880-123954902 GAATAGCCACATGTGGCCAGTGG + Intronic
961161779 3:124732622-124732644 AAATAGTCATATATGGCCAGTGG + Intronic
961663456 3:128482553-128482575 CAATATTCACATGTGGCCAGGGG + Intronic
961919284 3:130409009-130409031 TAATAGCCACATATGGCTAATGG + Intronic
962033883 3:131630559-131630581 AAATAGCCACATATGTCTAGTGG - Intronic
962144970 3:132831099-132831121 AAATAGTCATATGTGGCCAATGG - Intergenic
962211177 3:133479900-133479922 CAATAGCCACATGTGGCCAGTGG + Intergenic
962599581 3:136981340-136981362 CAATAGCCACATGTGGCCAGTGG + Intronic
962773203 3:138632393-138632415 CAATAGCCACATGTGGCCAGTGG + Intronic
962894634 3:139703031-139703053 AAAGATATACAAATGGCCAAAGG + Intergenic
962925113 3:139985943-139985965 AAATAGCCACATGTGGCTAGTGG + Intronic
963096684 3:141549598-141549620 CAATATCCACACATGGCTAGTGG - Intronic
963153589 3:142072698-142072720 ACATTTCCAGATATGGCCATTGG - Intronic
963239063 3:142984755-142984777 CAATAGCCACATGTGGCCAGTGG - Intronic
963547251 3:146675570-146675592 CAATAGCCACATGTGGCTAAGGG + Intergenic
963677618 3:148332671-148332693 AAATATTTACATATGGTCAATGG + Intergenic
963707798 3:148709960-148709982 AAATAGCCACATATAGTAAATGG - Intronic
964082839 3:152781114-152781136 AAATATCCACTAAAGGCCTAGGG + Intergenic
965477913 3:169180397-169180419 AAACATACACACATGGCTAAAGG - Intronic
965611119 3:170545068-170545090 AAATAGTCACATGTGGCCAGTGG + Intronic
966030085 3:175335178-175335200 AAATAGCCATATATGGCTAGTGG - Intronic
966042884 3:175513277-175513299 TAAAATCCACATATGGCTCATGG - Intronic
966618351 3:181936714-181936736 AAAAATCAAAATATGGCAAAAGG + Intergenic
967266672 3:187697887-187697909 AAATATCCACATATGGCTAGTGG + Intergenic
969147984 4:5141063-5141085 AAATATCCACATGTGGTTAGTGG - Intronic
969313704 4:6369141-6369163 AAATAGCCACATGTGGCCAGTGG - Intronic
970001649 4:11371012-11371034 TAGTAGCCACATGTGGCCAATGG - Intergenic
970570418 4:17376000-17376022 AAATATTCACATGTGGCTAGTGG + Intergenic
970689606 4:18607340-18607362 ATATATCCACATATTCCCCATGG - Intergenic
970755493 4:19420731-19420753 AACTAACCACATGTGGCTAATGG - Intergenic
971101383 4:23469411-23469433 GGTTCTCCACATATGGCCAAAGG + Intergenic
972201671 4:36720165-36720187 AGTTCTCCACATATGGTCAAAGG + Intergenic
972805572 4:42527016-42527038 GGTTCTCCACATATGGCCAAAGG - Intronic
973232104 4:47852462-47852484 AAATATCCACATGTGACTAGTGG + Intronic
973325215 4:48853634-48853656 AAATAGCCACATATGGCTAGCGG - Intronic
973594723 4:52475712-52475734 AAATAGACATATATGGCCAATGG + Intergenic
973644345 4:52935064-52935086 AAATAGCCACATGTGGCTAGTGG + Intronic
975480359 4:74872273-74872295 AAATAGCCACATGTAGCTAATGG - Intergenic
976055731 4:81063554-81063576 AAATAGCCACCTATGGCTAGTGG - Intergenic
976959636 4:90953657-90953679 AAATATACACATATATCCAAAGG - Intronic
977141923 4:93384120-93384142 CAGTATCCTCACATGGCCAAAGG + Intronic
977309681 4:95370092-95370114 CAATAGCCACATATGGCTACTGG - Intronic
977481368 4:97581095-97581117 AAATAGCCACAAATGGCTAGTGG - Intronic
977650758 4:99466386-99466408 TAATAGCCACATATGGCTAGTGG + Intergenic
978460702 4:108948910-108948932 AACTATTCATATAGGGCCAAAGG + Intronic
979400750 4:120246711-120246733 ACATCTCCACATAGTGCCAATGG + Intergenic
979658143 4:123221064-123221086 CAATAGCCACATGTGGCCAGTGG - Intronic
979697562 4:123630855-123630877 AAAAATCCACTTTTGGCCAGTGG - Intergenic
980040648 4:127935831-127935853 AAATAGCCACATGTGGCTAATGG + Intronic
980048924 4:128019354-128019376 CAATAGGCACACATGGCCAATGG - Intronic
980520741 4:133930342-133930364 AAATAGCCACATATGGCTAGTGG - Intergenic
980628286 4:135404645-135404667 CATTCTCCACATATGGTCAAAGG - Intergenic
981244480 4:142517903-142517925 AAATATCAAGATATGGTAAAAGG - Intronic
981759682 4:148180435-148180457 AAAGACACACAGATGGCCAAAGG - Intronic
982038454 4:151370700-151370722 ATATCTCCAGATATTGCCAAAGG - Intergenic
982360614 4:154515286-154515308 TAATAGCCACATGTGGCTAATGG - Intergenic
982944873 4:161608083-161608105 CAATTTCCAAATATGCCCAATGG + Intronic
983106175 4:163689560-163689582 AAATAGTCACCTATGGCTAATGG + Intronic
983282988 4:165704839-165704861 CAATAGCCATATATGGCCAATGG - Intergenic
984099323 4:175466582-175466604 AAAGATCCACCTATGACCACAGG - Intergenic
984156012 4:176196880-176196902 AAATAGCCACATGTGGCTAGTGG - Intergenic
984575009 4:181438028-181438050 AAATCTCTACATCTGGCGAAAGG - Intergenic
986361096 5:6978896-6978918 AAATAGCTACATATGGTCAGGGG - Intergenic
986970730 5:13332929-13332951 CAGTAGCCACATATGGCCAGTGG - Intergenic
987916262 5:24218620-24218642 AAAAAGCCACATGTGACCAATGG - Intergenic
988341019 5:29972070-29972092 AAATAGCCACATGTGGCTAGTGG + Intergenic
988341215 5:29974487-29974509 AAATACATACAAATGGCCAATGG + Intergenic
988578813 5:32451338-32451360 CAATAGCCACATGTGGCCAGTGG - Intergenic
988751983 5:34196981-34197003 AAATAACCACATGTGGCTAGTGG + Intergenic
988916278 5:35896593-35896615 AAATAGCCACATGTGGCTAGTGG - Intergenic
988919019 5:35923498-35923520 AAATGTCCACCTATGGATAAAGG + Intronic
989066323 5:37466381-37466403 AAATAACCACATGTGGCTAGTGG - Intronic
989245416 5:39248931-39248953 AAATAGCTACATGTGGCTAATGG - Intronic
989404559 5:41045537-41045559 AAATTTACTCATATGGCCACAGG - Intronic
989564420 5:42887593-42887615 AAATAGCCACATATGGCTAGGGG - Intergenic
990120031 5:52439949-52439971 AAATATCTTGATATGGCCAAAGG + Intergenic
990294698 5:54389146-54389168 AAATAGCCAGATGTGGCTAATGG + Intergenic
990549322 5:56857679-56857701 CAGTAACCACATGTGGCCAATGG + Intronic
990963508 5:61419513-61419535 AAATAGCCACATGTGGCTAGTGG - Intronic
991349022 5:65701600-65701622 AAATAGCCACATATGGCTTATGG - Intronic
991605802 5:68399589-68399611 CAGTAGCCACATATGGCTAAGGG + Intergenic
991737314 5:69639765-69639787 AAATAACCACATGTGGCTAGTGG + Intergenic
991739750 5:69657797-69657819 AAATAACCACATGTGGCTAGTGG + Intergenic
991757750 5:69895381-69895403 AAATAACCACATGTGGCTAGTGG - Intergenic
991788889 5:70219491-70219513 AAATAACCACATGTGGCTAGTGG + Intergenic
991791325 5:70237538-70237560 AAATAACCACATGTGGCTAGTGG + Intergenic
991813639 5:70494597-70494619 AAATAACCACATGTGGCTAGTGG + Intergenic
991816769 5:70515881-70515903 AAATAACCACATGTGGCTAGTGG + Intergenic
991819212 5:70533922-70533944 AAATAACCACATGTGGCTAGTGG + Intergenic
991837153 5:70771263-70771285 AAATAACCACATGTGGCTAGTGG - Intergenic
991881334 5:71219855-71219877 AAATAACCACATGTGGCTAGTGG + Intergenic
991883772 5:71237880-71237902 AAATAACCACATGTGGCTAGTGG + Intergenic
991943375 5:71876492-71876514 TAATAGCCACATGTGGCAAATGG - Intergenic
992407464 5:76473301-76473323 ATATAGCCATATATAGCCAATGG - Intronic
992557087 5:77914541-77914563 GAATCTCCATATATGGCTAATGG + Intergenic
993084751 5:83349645-83349667 AAAAATCAGCATATGACCAAAGG - Intronic
993232276 5:85250560-85250582 GGTTCTCCACATATGGCCAAAGG + Intergenic
993559674 5:89390343-89390365 AAATCTTCACATATTGACAATGG + Intergenic
993669990 5:90748536-90748558 CAATAGCCACATGTGGCCAGTGG + Intronic
993799335 5:92312283-92312305 AAATATCCACATGCCGCCACTGG + Intergenic
993894043 5:93509339-93509361 TAATATCCACATATCGCTAGAGG - Intergenic
994366704 5:98925898-98925920 AAATAGCCACATGTGGCTAGTGG + Intronic
994384563 5:99114662-99114684 AAATAGCCACATGTGGCTAATGG + Intergenic
994419863 5:99518920-99518942 AAATAACCCCATGTGGCCAGTGG - Intergenic
994487346 5:100396217-100396239 AAATAACCCCATGTGGCCAGTGG + Intergenic
995158643 5:108947309-108947331 AAATATTCATATATTGCTAATGG - Intronic
996031693 5:118712197-118712219 AAATATCAACAAATGCCCATAGG + Intergenic
996345071 5:122478633-122478655 AAACATCCACCTATGGCCTCAGG - Intergenic
996373114 5:122774452-122774474 AATTAGCCACATGTGGCCAGTGG - Intergenic
996444940 5:123536801-123536823 GAAGATACACACATGGCCAATGG + Intronic
997167799 5:131680150-131680172 AAATAGCCACATGTGGCTGACGG + Intronic
997216098 5:132112114-132112136 AAATAGCCATATATGGCTAATGG + Intergenic
997330909 5:133060957-133060979 AAATAGCCACATGTGGCTAGTGG + Intronic
998013376 5:138713190-138713212 AGATAGCCACACATGGCCAGTGG - Intronic
999451339 5:151680556-151680578 AAATAGCCACATGTGGCTAGTGG + Intronic
999985614 5:157002257-157002279 AAATAGCCATATATGGCTACTGG + Intergenic
1000018310 5:157297712-157297734 AAGTACCCACATGTGGCTAATGG - Intronic
1000141982 5:158414198-158414220 AAATAGCCACATATGGCTAGGGG - Intergenic
1000223685 5:159237620-159237642 GATTCTCCACATATGGTCAAAGG + Intergenic
1000841201 5:166220658-166220680 CTGTATCCTCATATGGCCAAAGG + Intergenic
1001224275 5:169930302-169930324 AAATAACCACATATGGGTGATGG + Intronic
1001375182 5:171249339-171249361 AGATATCAACATAAGGCCACAGG + Intronic
1001780262 5:174362238-174362260 AAATAACCAAAAATGGTCAAAGG + Intergenic
1002670587 5:180863025-180863047 AAATAGCCACATGTGGCTAATGG + Intergenic
1003292303 6:4789727-4789749 AAAGAGCCAGATAGGGCCAAAGG - Intronic
1003626212 6:7744017-7744039 AAATTTCAACATATGGAAAAAGG + Intronic
1003825369 6:9946036-9946058 ATATCTCCACACATTGCCAAAGG - Intronic
1003898480 6:10630836-10630858 AAATAGCCACATATGACTAGTGG + Intergenic
1003924957 6:10869097-10869119 ATATTACCACATATGGCCAGTGG + Intronic
1004141216 6:13019703-13019725 AAATATCCTCATTTGTCTAAAGG + Intronic
1004306551 6:14506553-14506575 AAATGGCCACATATGGCTAGTGG + Intergenic
1004738249 6:18430134-18430156 AAATAGCCACATGTGGCTAGTGG - Intronic
1005100057 6:22161983-22162005 AAATAGCCACATGTGGCTAGTGG + Intergenic
1005376341 6:25186384-25186406 AAAGATATACATATGGCCAGTGG + Intergenic
1005550145 6:26903694-26903716 AAATAACCACATGTGGCTAGTGG + Intergenic
1005817865 6:29571114-29571136 TAATGTCCACATATCGTCAATGG + Intronic
1006600886 6:35225050-35225072 AAATAACCACATGTGGCTAGTGG + Intronic
1006706065 6:36022372-36022394 AAATAGCCACATGTAGCCAGTGG - Intronic
1007617141 6:43186801-43186823 AAAAACCCCCATATGGCAAAAGG - Intronic
1007672440 6:43566974-43566996 AAATCTCCACATTCTGCCAAAGG + Intronic
1007897308 6:45376394-45376416 AAATACCCACATGTGGCTAGTGG - Intronic
1008064146 6:47029733-47029755 AGATAGCCACACATGGCTAATGG - Intronic
1008077413 6:47159545-47159567 AAATAACCTCATATGGGAAAGGG + Intergenic
1009020412 6:57942585-57942607 AAATAACCACATGTGGCTAGTGG + Intergenic
1009611272 6:65944522-65944544 AAATAGCCATATATGGCTAGTGG - Intergenic
1010068743 6:71717843-71717865 GCATATCAACATATGGCCTATGG + Intergenic
1011284738 6:85711009-85711031 AGATGCCCACCTATGGCCAAGGG + Intergenic
1011772561 6:90691192-90691214 AAATAGCCACATGTGGTTAATGG - Intergenic
1011820380 6:91246224-91246246 CAATAGCCACATGTGGCTAATGG + Intergenic
1012293245 6:97485243-97485265 GAAAATACACAAATGGCCAAGGG - Intergenic
1012747950 6:103118429-103118451 AAATATTAACATATTGCCAAAGG - Intergenic
1013818686 6:114130123-114130145 AAATAGCCAAATATGGCTAGTGG - Intronic
1014234667 6:118940611-118940633 CAATGTTCACCTATGGCCAAAGG - Intergenic
1014395705 6:120925313-120925335 AAAGATCCACATATGACCTCAGG + Intergenic
1016085855 6:139913457-139913479 AAATAGCCACATGTGGCTATTGG + Intergenic
1016219815 6:141654549-141654571 GGATCTCCACATATGGTCAAAGG - Intergenic
1016518241 6:144921299-144921321 AAATAGCCACATGTGGCTAGTGG + Intergenic
1016895484 6:149047546-149047568 AAGTATCCCAAAATGGCCAAGGG - Intronic
1016968714 6:149742880-149742902 AAATATACATATCTGGCCCACGG + Intronic
1017033409 6:150244693-150244715 AAATAGCCACATATGGTTAGTGG + Intronic
1017180633 6:151548673-151548695 AAATGTACATATATAGCCAATGG - Intronic
1017191277 6:151655398-151655420 AAATATCCACAGAGTGACAAAGG + Intergenic
1018217297 6:161541273-161541295 AAATAGCCATATGTGGCTAAAGG + Intronic
1018376078 6:163214255-163214277 AAATAGCCACATGTGGCTAGTGG + Intronic
1018566105 6:165155368-165155390 AAATATCCACATGTGGCTAGTGG + Intergenic
1018679043 6:166248541-166248563 AAATATTCACAAAAGGACAATGG - Intergenic
1019143286 6:169961732-169961754 AAGTAGCCACATGTGGCTAAGGG + Intergenic
1019183300 6:170206482-170206504 ACATATCCACCCATGGTCAAAGG - Intergenic
1019861345 7:3660913-3660935 AAGTATACACATATCACCAAAGG - Intronic
1019955516 7:4411245-4411267 AAATAGCCATACATGGCCAATGG + Intergenic
1020042984 7:5018144-5018166 AAAGCTCCACAAATGGCCATAGG - Intronic
1020334883 7:7055633-7055655 AAATAGCCACATGTGGCTAGTGG + Intergenic
1020783509 7:12545146-12545168 CAATAACCACATATAGTCAATGG + Intergenic
1021377102 7:19921696-19921718 AAATCTCCAGATATTGCCAAGGG - Intergenic
1022180189 7:27911579-27911601 AAGTAGCCACATATGGCTAAGGG + Intronic
1022311622 7:29201606-29201628 AAATAGCCACATGTGACTAATGG - Intronic
1022394712 7:29976616-29976638 AAAGAGCCACATGTGGCCAGAGG + Intronic
1022536082 7:31099445-31099467 AAATAGCCACATATGGGTAGTGG + Intronic
1022711524 7:32855268-32855290 AAATAGCCACATGTGGCTAGTGG + Intergenic
1022838357 7:34138158-34138180 AAATAACCACATGTGTCTAATGG + Intronic
1022913133 7:34919691-34919713 AAATAGCCACATGTGGCTAGTGG - Intergenic
1023390152 7:39702007-39702029 AAATATTAACAGATGTCCAAAGG + Intronic
1023414524 7:39919585-39919607 AAATAGCCACACATGGCTAGTGG + Intergenic
1023642723 7:42276671-42276693 ACATAGCCACATTTGGGCAAGGG - Intergenic
1024113517 7:46171084-46171106 AAATAACCACATGTAGCCAGTGG - Intergenic
1024236087 7:47400279-47400301 AAATCTCCAAATATGCACAAAGG + Intronic
1026869796 7:73843316-73843338 AAATAGCCACATGTGGCTAGTGG + Intergenic
1027357121 7:77368405-77368427 AAATAGCCACATGTGGCTATTGG + Intronic
1028295284 7:89122158-89122180 AAGTAGCTACATGTGGCCAATGG - Intronic
1028725646 7:94084610-94084632 AAATATCAAAATGTGGCCATAGG - Intergenic
1028887837 7:95954281-95954303 AAATAGCCTCATGTGGCCAGTGG - Intronic
1029043249 7:97599604-97599626 CAATAGCCACATATGGCTAGTGG - Intergenic
1029093716 7:98068623-98068645 AAATAGCCACATGTGGCTAGTGG - Intergenic
1029304446 7:99608317-99608339 CAATAACCACATATGTCCAGTGG + Intergenic
1030041204 7:105451864-105451886 CAATAGCCACTTGTGGCCAATGG - Intronic
1030307418 7:108033102-108033124 AAACTCCCACATATGCCCAAGGG - Intronic
1030458480 7:109802230-109802252 GGTTCTCCACATATGGCCAAAGG + Intergenic
1030689570 7:112518570-112518592 AAATAGCCACATATAGTCAGGGG + Intergenic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1030858482 7:114591887-114591909 CAATAGCCACATATGGCTAGTGG - Intronic
1031268127 7:119608181-119608203 CAACATCCACATATGCCCAGTGG - Intergenic
1031268129 7:119608269-119608291 AAATAGCCATATATAGCTAATGG + Intergenic
1032237368 7:130137106-130137128 AAATAACCACACATGGCTAGTGG + Intergenic
1032261856 7:130344619-130344641 AAATAGCCACATGTGGCTAATGG - Intergenic
1032568374 7:132972066-132972088 AAATATATACATATGGGGAAGGG + Intronic
1033113264 7:138602221-138602243 AAATACTCACATGTGGACAAAGG + Intronic
1033160672 7:138993528-138993550 AAATATCCACATGTGGGTAGTGG + Intergenic
1034000815 7:147410643-147410665 AAATAGCCACATATGGCTAGTGG - Intronic
1034368567 7:150573182-150573204 AAACATCTACCAATGGCCAATGG - Exonic
1035866579 8:3089579-3089601 AAATATTAACATGTGGCCAAGGG - Intronic
1036915932 8:12803640-12803662 CAATAGCCACATGTGGCCAGTGG - Intergenic
1036944816 8:13085171-13085193 AAATACCCATAAATGGACAAGGG + Exonic
1037577025 8:20216201-20216223 AGATAGCCACATTTGGCTAATGG + Intronic
1038008266 8:23452471-23452493 AAATAACCACACATGGCAAGTGG - Intronic
1038387301 8:27160703-27160725 TAATTTGGACATATGGCCAAAGG - Intergenic
1038401569 8:27288171-27288193 AGATATCCACGTGTGGCCTAAGG - Intronic
1038471862 8:27830733-27830755 AAATAGCCACATGTAGCTAATGG + Intronic
1038632336 8:29257910-29257932 ATATATGCACATAGGGCCAGAGG - Intronic
1039133704 8:34296741-34296763 AAATAGCCACATGTGGCTAATGG - Intergenic
1039373053 8:37005987-37006009 AAATAACCACGTATGGCTAGTGG + Intergenic
1039757758 8:40541453-40541475 AAATAGCCACACATGGCTACTGG - Intronic
1041528830 8:58839310-58839332 AAATAGCTACATATGACTAATGG + Intronic
1041847575 8:62349084-62349106 AAATAACTCCATATGGACAAAGG + Intronic
1042144839 8:65716922-65716944 CAATATCCACATGTGGCTAGTGG - Intronic
1042235195 8:66605257-66605279 CAATAGCCACATGTGGCTAATGG + Intronic
1042881484 8:73496853-73496875 CAATAGCCACATGTGGCTAATGG + Intronic
1043270953 8:78332318-78332340 CAATAGCCACATATAGTCAATGG - Intergenic
1043515007 8:80987990-80988012 CAATAGCCACATGTGGCCAGTGG + Intronic
1043733616 8:83717211-83717233 GGATCTCCACATATGGACAAAGG - Intergenic
1043772081 8:84216802-84216824 AAACAGCTACATATGGCCAGTGG + Intronic
1044522830 8:93219225-93219247 AAACAGCCACATGTGGCTAATGG - Intergenic
1044570101 8:93708494-93708516 AAATAGCCCCATATGGCTAGTGG + Intronic
1044890651 8:96831949-96831971 CAATAGCCACATGTGGCTAATGG + Intronic
1044966930 8:97582824-97582846 AAATAGCCACATGTGGTTAATGG - Intergenic
1045127646 8:99110618-99110640 AAATAGCCACATATGGCTGGTGG + Intronic
1045395093 8:101753015-101753037 CAGTAGCCACATGTGGCCAATGG + Intronic
1045601105 8:103717957-103717979 AAATAACCACATGTGGCTAATGG + Intronic
1047868524 8:129056491-129056513 AAATATCCACATTTGGCTTTTGG - Intergenic
1048084279 8:131160172-131160194 GGTTCTCCACATATGGCCAAAGG + Intergenic
1048310651 8:133320101-133320123 TTATATCCACATTTTGCCAATGG + Intergenic
1048569638 8:135640849-135640871 AAACCTCAACATATGGCAAAGGG - Intronic
1048892472 8:138960066-138960088 AAATATCCACAGGTGGCTACCGG + Intergenic
1049928793 9:435692-435714 AATTACCCACATTTGGCAAAGGG + Intronic
1050171088 9:2817618-2817640 AAATGTCCACATATAGTGAAAGG + Intronic
1050297326 9:4218728-4218750 AAATAGCCACATGTGGCTAATGG + Intronic
1050447446 9:5740144-5740166 GATTCTCCACATATGGTCAAAGG + Intronic
1051004132 9:12321379-12321401 AAATAGCCATATATGGATAATGG - Intergenic
1051062688 9:13063034-13063056 AAATAGCCACATGTGGCTAGTGG + Intergenic
1051339011 9:16093955-16093977 ACAAAGCCACACATGGCCAACGG - Intergenic
1052041140 9:23740466-23740488 TAATTTCCACACATGGCCAAAGG - Intronic
1053569231 9:39286909-39286931 AAATTTCCAAACATGGCCACTGG + Intronic
1054090860 9:60845890-60845912 AAATTTCCAAACATGGCCACTGG + Intergenic
1054112271 9:61121447-61121469 AAATTTCCAAACATGGCCACTGG + Intergenic
1054127912 9:61332098-61332120 AAATTTCCAAACATGGCCACTGG - Intergenic
1054724118 9:68633513-68633535 AAATAGCCAAATGTGGCCAGTGG + Intergenic
1054841094 9:69741025-69741047 CAATAGCCACATGTGGCTAATGG + Intronic
1055041758 9:71881975-71881997 AAAGATATACAAATGGCCAATGG + Intronic
1055234085 9:74098807-74098829 AAATAGCCACATGTGGCTAGTGG + Intergenic
1055305665 9:74926655-74926677 AAATATGCTCAGATAGCCAAAGG + Intergenic
1055385302 9:75755610-75755632 TAATAGCCACATGTGGCCAATGG + Intergenic
1055489885 9:76794224-76794246 AAATATGCTGATATGGCAAATGG + Intronic
1055771967 9:79727187-79727209 AAGTAGCCACATGTGGCTAATGG + Intergenic
1055982610 9:82019475-82019497 AATTATCAAAATAGGGCCAATGG - Intergenic
1055990893 9:82104447-82104469 AAATATAAACATATGGCTAGTGG - Intergenic
1056055095 9:82813615-82813637 AAATAACCACATGTGGCTAGTGG - Intergenic
1056081071 9:83094210-83094232 CAAGATCCACATATGGCTAATGG - Intergenic
1056279514 9:85027687-85027709 AAATAGCCACATATGGCTAGTGG + Intergenic
1056650343 9:88454367-88454389 AATGATCCAGATATGACCAAAGG + Intronic
1056906355 9:90652382-90652404 AAATATTCACTTCTGGCCTAAGG + Intergenic
1057583702 9:96310569-96310591 AAATAACCACATATGGCCAGTGG - Intergenic
1057917183 9:99065782-99065804 AAATATCCAGAGATGTGCAAGGG + Intronic
1057978913 9:99638126-99638148 CAATAGCCACATGTGGCCAGTGG - Intergenic
1058084645 9:100735435-100735457 AAATAGACACATAAGACCAATGG - Intergenic
1058613679 9:106802773-106802795 AAATAGACACATGTGGCCAGTGG + Intergenic
1059245898 9:112849306-112849328 AAATAGCCACATATGGCTAGTGG - Intronic
1059536860 9:115088757-115088779 TAATAACCACATGTGGCCAAGGG - Intronic
1059751183 9:117248955-117248977 CAATTTCCACATATGTACAATGG + Intronic
1059767146 9:117394400-117394422 CAATAGCCACATATGGCTAGTGG + Intronic
1061300557 9:129702474-129702496 CAATATCCACACATGGCCAGTGG - Intronic
1061526850 9:131172696-131172718 AAATAACCACATATGGCTACTGG + Intronic
1062571353 9:137186959-137186981 AAACCACCACAAATGGCCAAGGG + Intronic
1186305344 X:8250841-8250863 AAATATCCAACTATGACCAGAGG + Intergenic
1186996898 X:15133098-15133120 AAATAGTCATATATGGCCAGTGG - Intergenic
1187007132 X:15243509-15243531 AAATATGCACAAATGGCTAGTGG - Intronic
1187174514 X:16883971-16883993 AAATAGCCACACATGGCTACTGG + Intergenic
1187411600 X:19055416-19055438 AAATAGCCACATGTAGCTAATGG - Intronic
1187556370 X:20356256-20356278 AAATAGACACATGTGGCCAGTGG + Intergenic
1187995605 X:24923066-24923088 AAATATCCAAATATTGGCCATGG - Intronic
1188741991 X:33795676-33795698 AAATAGTCACATGTGGCTAATGG - Intergenic
1188914945 X:35898882-35898904 AAATAGCCACATGTGGCTAGTGG + Intergenic
1189264951 X:39707549-39707571 AAATATCAACTGATAGCCAAGGG + Intergenic
1189532929 X:41905580-41905602 AAATAGCCACATCTGGCTAGTGG + Intronic
1189540362 X:41981175-41981197 AATTATCCAGTTCTGGCCAATGG - Intergenic
1189579032 X:42386301-42386323 AAATAGCCACATGTGGCTAGCGG + Intergenic
1189999050 X:46667456-46667478 ATATAGCCACATGTGGCTAATGG - Intronic
1190113822 X:47612707-47612729 ATATATCCACTTATGGGCAGTGG + Intronic
1190585773 X:51939778-51939800 AACTAGCCACATGTGGCCAGTGG + Intergenic
1192724376 X:73732510-73732532 AAGTGGCCACATTTGGCCAAAGG - Intergenic
1192995850 X:76512558-76512580 GGATCTCCACATATGGTCAAAGG - Intergenic
1193535107 X:82705238-82705260 GAATATTCCCATATGGCTAAAGG + Intergenic
1193648306 X:84095480-84095502 TAATAGCCACATGTGGCCAGTGG - Intronic
1193667643 X:84341974-84341996 AAATATCCAGATTTGGGCATTGG - Intronic
1193737691 X:85179164-85179186 AAATAGCCACATGTGGCTAGTGG + Intergenic
1194431623 X:93814343-93814365 AAATAGCCTCAAATGGGCAAAGG + Intergenic
1194809327 X:98371576-98371598 AAATAATCACATGTGGCTAATGG + Intergenic
1195044116 X:101040679-101040701 AAATTGCCACATATGGCTACTGG + Intronic
1195317155 X:103690381-103690403 AAATAGTCACATATGACTAATGG - Intergenic
1195597486 X:106709254-106709276 CAATATCCACAAATGAGCAATGG - Intronic
1196011543 X:110893156-110893178 AAATAGCCACACATGGCTAGTGG - Intergenic
1196017159 X:110952174-110952196 CAGTATCCAGATATGGTCAAGGG + Intronic
1197085521 X:122469422-122469444 AAATATCCATATGTGGCTAGTGG + Intergenic
1197250783 X:124214506-124214528 AAATATCCATCTAGGGTCAATGG + Intronic
1197282827 X:124557250-124557272 AAATACTCACATGTGGCCAGTGG + Intronic
1197459083 X:126716672-126716694 AAATAGCCACAACTGGCTAATGG - Intergenic
1198933614 X:141884782-141884804 GATTCTCCACATATGGTCAAAGG - Intronic
1199309374 X:146305246-146305268 AAATAGCTACATATGGCTAGTGG - Intergenic
1199584340 X:149397874-149397896 AAATATCAACATATGACTAGTGG + Intergenic
1199975368 X:152892070-152892092 AAATAGCCACATGTGGCCAGTGG + Intergenic
1200836384 Y:7736125-7736147 AAATAGCCACATGTGGCTAGTGG - Intergenic
1200837556 Y:7748150-7748172 TGATAGCCACATATGGCTAATGG - Intergenic
1201540269 Y:15098744-15098766 AATTACTCACATATTGCCAATGG - Intergenic
1201921720 Y:19240838-19240860 AAACATACAATTATGGCCAATGG - Intergenic