ID: 1173392623

View in Genome Browser
Species Human (GRCh38)
Location 20:42648586-42648608
Sequence GCAATTCCATGCCTGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 157}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173392616_1173392623 21 Left 1173392616 20:42648542-42648564 CCCCGAATGTGACTAAAACACAG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 157
1173392615_1173392623 22 Left 1173392615 20:42648541-42648563 CCCCCGAATGTGACTAAAACACA 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 157
1173392620_1173392623 -2 Left 1173392620 20:42648565-42648587 CCCAAGAAGGCCGCTACAGCTGC 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 157
1173392621_1173392623 -3 Left 1173392621 20:42648566-42648588 CCAAGAAGGCCGCTACAGCTGCA 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 157
1173392613_1173392623 29 Left 1173392613 20:42648534-42648556 CCCTAGGCCCCCGAATGTGACTA 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 157
1173392614_1173392623 28 Left 1173392614 20:42648535-42648557 CCTAGGCCCCCGAATGTGACTAA 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 157
1173392617_1173392623 20 Left 1173392617 20:42648543-42648565 CCCGAATGTGACTAAAACACAGC 0: 1
1: 0
2: 2
3: 13
4: 166
Right 1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 157
1173392618_1173392623 19 Left 1173392618 20:42648544-42648566 CCGAATGTGACTAAAACACAGCC 0: 1
1: 0
2: 1
3: 20
4: 250
Right 1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173392623 Original CRISPR GCAATTCCATGCCTGTGCTG AGG Intronic
901179312 1:7330283-7330305 ACTATTACAAGCCTGTGCTGGGG - Intronic
901945609 1:12701226-12701248 AGAATTCCATGCCTCTGGTGTGG - Intergenic
902252998 1:15167840-15167862 TCATTTCCATGCCTGTGATATGG - Intronic
902414833 1:16232434-16232456 TGAATTCCATGCCTGGGCAGAGG + Intronic
903927358 1:26840117-26840139 GCAGTTCCCTCCCTGTCCTGGGG + Intronic
904849414 1:33446188-33446210 GCAATCCCAAGCCTCTGCTATGG + Intergenic
910111716 1:83690532-83690554 GCAATTCCTTCCCAGTGTTGGGG + Intergenic
911475573 1:98368024-98368046 GCACTTCCATTTCTTTGCTGGGG - Intergenic
912258622 1:108086260-108086282 GCAATTGCATGCCTGGATTGGGG + Intergenic
914839792 1:151238963-151238985 GCACTGCCATGCCTGTTCTTGGG + Intronic
914904106 1:151729795-151729817 GCAAGTCCATGCTTCAGCTGTGG + Intronic
916255004 1:162778467-162778489 AGAATTCCTTGCCTGTGGTGGGG + Intronic
917435944 1:175021421-175021443 TCAATTCCATGCCCATGTTGTGG + Intronic
917665757 1:177223817-177223839 CCAGTTCCATGCCAGTCCTGAGG + Intronic
918873995 1:190014600-190014622 GGAATGCCATGCCTGTTCAGTGG + Intergenic
919503351 1:198366610-198366632 GCAATTTCATGACATTGCTGAGG - Intergenic
919581311 1:199377493-199377515 GCATTTACATGACTGTACTGTGG + Intergenic
919775799 1:201193225-201193247 GCAATTCCATTTCTGTTCTCAGG + Exonic
923503986 1:234589940-234589962 GCAATCCCATGCCTTTGCCCTGG + Intergenic
1064012215 10:11743636-11743658 GGAATTCCCTGCCCCTGCTGTGG - Intronic
1064578576 10:16770455-16770477 CAGATTTCATGCCTGTGCTGCGG - Intronic
1065187120 10:23179168-23179190 GCCACTCCATGCCTGGGATGAGG + Intergenic
1067092152 10:43273025-43273047 GCAATTTCATGCATCTGCTGGGG + Intergenic
1070675905 10:78411059-78411081 GCAAATCCATGCCTCTGAAGGGG - Intergenic
1072613223 10:97032784-97032806 GCACATCCATGCCTGTACAGTGG + Intronic
1074968555 10:118516130-118516152 GTAATCCCATGCCTGTGCTAAGG + Intergenic
1080472457 11:32559419-32559441 GCAATTGCAGGGCTGTGCAGTGG + Intergenic
1085421913 11:76370012-76370034 GCTATTCCATCACTGTGTTGAGG - Intronic
1092397796 12:8143830-8143852 GGAATACCATCCCTGAGCTGAGG + Intronic
1097690408 12:62729298-62729320 CCACTTCCCTGCCTTTGCTGTGG - Intronic
1098754969 12:74350931-74350953 GCAATTACATGCATGTGTTCTGG + Intergenic
1099367573 12:81787630-81787652 GCAAATGCCTGCCTGTGCTGGGG - Intergenic
1106814724 13:33394851-33394873 ACAATTCCATGCCTGCTCTCAGG - Intergenic
1107450605 13:40505383-40505405 CCAGTTCCATGACTGAGCTGAGG - Intergenic
1112541855 13:100321534-100321556 GCTATTTCATGCTTGTTCTGTGG - Intronic
1116816221 14:49586141-49586163 GCCATTACAGGCCTGTACTGTGG - Intronic
1118059742 14:62122431-62122453 ACTATTCCATGCCTGTGCTTGGG + Intergenic
1118593549 14:67419267-67419289 GCTACTCCCTTCCTGTGCTGGGG - Intergenic
1120426779 14:84358615-84358637 GCATTTGCCTGCCTTTGCTGAGG + Intergenic
1120883640 14:89434579-89434601 GGAGTTCCAGGCCTGTGCTCTGG - Intronic
1121787985 14:96677108-96677130 GCACTTCCTTGCCTGACCTGAGG - Intergenic
1123022153 14:105404649-105404671 GCAGTAGCATGCCTGTGCTCAGG + Intronic
1124367122 15:29080013-29080035 GCAGTCCCATGGCTGTGCGGGGG + Intronic
1128365337 15:66996012-66996034 GCAAGACCATGCATGGGCTGTGG - Intergenic
1131750290 15:95499127-95499149 GCAATTCCACAGCTGTTCTGTGG - Intergenic
1131827938 15:96334757-96334779 GCACTACCAGGCCTGTCCTGGGG + Intronic
1132286550 15:100667767-100667789 GCATTTCCCAGCCTCTGCTGAGG - Intergenic
1132997121 16:2829209-2829231 GCAGTTCCATGCGTGTCCTCAGG - Intergenic
1133072013 16:3252998-3253020 ACAATTCCATGCTCGTGGTGGGG - Intronic
1135272759 16:21083630-21083652 GCAAGGCCATGGCTGTGCTGGGG - Intronic
1136359850 16:29771982-29772004 GCAATTTCAGACCTGTGGTGGGG - Intergenic
1136782629 16:32917011-32917033 GCATGTCCCTGCCTTTGCTGTGG + Intergenic
1136887165 16:33936839-33936861 GCATGTCCCTGCCTTTGCTGTGG - Intergenic
1137250612 16:46737919-46737941 CCAATTCCAGGCCAGTCCTGAGG + Exonic
1137562604 16:49512524-49512546 GCGATGCCATGCCCATGCTGTGG - Intronic
1139924105 16:70476355-70476377 GCCTTTCCAGGGCTGTGCTGGGG + Intronic
1140411752 16:74745320-74745342 GCAGGGCCAAGCCTGTGCTGGGG - Intronic
1141198708 16:81881092-81881114 GCCATCCCATGCCTGTGGCGTGG + Intronic
1203085287 16_KI270728v1_random:1180999-1181021 GCATGTCCCTGCCTTTGCTGTGG + Intergenic
1143903900 17:10195100-10195122 ACACTTCCCTGCCTGTGCTGAGG + Intronic
1145067953 17:19775957-19775979 GAAATTCCATGTGTTTGCTGAGG - Exonic
1146073942 17:29710644-29710666 GAAATTCCCTGTCTGTGGTGTGG - Intronic
1146483573 17:33225180-33225202 TGAATACCAAGCCTGTGCTGTGG + Intronic
1146544389 17:33725679-33725701 GCAATTGCATCCATATGCTGAGG - Intronic
1147142891 17:38469181-38469203 GCACGTCCCTGCCTCTGCTGTGG + Exonic
1148127433 17:45244077-45244099 GCAACTCCCAGCCTGGGCTGCGG + Intronic
1148923095 17:51057209-51057231 ACAAAACCATGCCTGTGGTGAGG + Intronic
1150499389 17:65635925-65635947 GCAATTTCCAGGCTGTGCTGTGG - Exonic
1152497951 17:80687652-80687674 ACCATTCCGTGGCTGTGCTGTGG - Intronic
1154093637 18:11388893-11388915 GCATATGCATGTCTGTGCTGAGG + Intergenic
1154415749 18:14174393-14174415 GCTATGCCCTGCCCGTGCTGTGG - Intergenic
1154430766 18:14306732-14306754 GCCATGACATGCCTGTGCTCTGG + Intergenic
1157095758 18:44684144-44684166 CCAATTCCATTCCTATCCTGTGG + Intronic
1164755677 19:30687154-30687176 GCAAATGCATGCCTGGGCCGGGG + Intronic
1166046256 19:40232794-40232816 GCACGTCCATGTCAGTGCTGTGG - Exonic
1168201436 19:54818501-54818523 GTAGTTCCCTGCATGTGCTGTGG - Exonic
928894029 2:36240421-36240443 AAAATTCCAGGCCTGAGCTGCGG - Intergenic
929763713 2:44826787-44826809 GCATTAGCATGCCAGTGCTGAGG + Intergenic
930260815 2:49143976-49143998 GCACTCCCATGACTGTTCTGAGG - Intronic
934612910 2:95753959-95753981 GCAGTGCCAAGCCTGGGCTGGGG - Intergenic
936284261 2:111169360-111169382 CAAATTCTATGCCTGTGCTCTGG - Intergenic
937026693 2:118704617-118704639 GCAAATTCATGGTTGTGCTGGGG + Intergenic
939564792 2:143774400-143774422 GCAACACCATGCCCGTGCTTGGG + Intergenic
943918259 2:193666405-193666427 GCTATACCATGACAGTGCTGAGG + Intergenic
944256839 2:197631763-197631785 GCATTTCCATGTCTGTTCTAGGG - Intronic
944916720 2:204368448-204368470 GCAATACCATGCCTTTGTTTTGG - Intergenic
945138630 2:206659002-206659024 GCTGTTCCTTGCCTCTGCTGTGG - Intronic
945230250 2:207580945-207580967 GCTTGTCCTTGCCTGTGCTGTGG - Intronic
945659186 2:212664274-212664296 ACACTTCCGTGCCTGTTCTGTGG + Intergenic
946539735 2:220671095-220671117 GCTATTCCTTGCCTGGGGTGGGG + Intergenic
948107487 2:235427328-235427350 TCCAGTCCATGCCTGAGCTGTGG + Intergenic
1171294725 20:24007291-24007313 CCACTTCTATGCATGTGCTGAGG + Intergenic
1171376906 20:24700015-24700037 GCTATACCATGCCTGTTATGGGG - Intergenic
1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG + Intronic
1173746885 20:45444456-45444478 GCCATTCCATTCATGGGCTGAGG + Intergenic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175934252 20:62507824-62507846 GCAACCCCCTGCCTGTGATGCGG + Intergenic
1176857591 21:13984911-13984933 GCTATGCCCTGCCCGTGCTGTGG + Intergenic
1176867016 21:14059311-14059333 GCTATGCCCTGCCCGTGCTGTGG - Intergenic
1176904380 21:14481817-14481839 GCAAGTCCATGCCTGCATTGTGG + Intergenic
1177888628 21:26777736-26777758 GCAAATCCAAACCTGTGGTGTGG + Intergenic
1178303972 21:31474967-31474989 GCAATTCAAATCCTGTTCTGTGG - Intronic
1179479359 21:41667981-41668003 TCACTTCCATGCCAATGCTGTGG - Intergenic
1181085915 22:20439267-20439289 GCAATGCCCTCCCAGTGCTGGGG + Intronic
1182515323 22:30855427-30855449 GCAACCACACGCCTGTGCTGTGG - Intronic
1184328097 22:43806915-43806937 GTAATTCCATCACTTTGCTGTGG + Intronic
1184677063 22:46049427-46049449 GCAATGCCAGGGCTGTGGTGTGG - Intergenic
949422745 3:3883464-3883486 GCAAAGCCAAGCCTGTGTTGTGG + Intronic
950206084 3:11082241-11082263 GGATTTCCATGTCTGTGCTAGGG - Intergenic
950241134 3:11371099-11371121 TGAATTCCATGCCTGTGTTCAGG - Intronic
950695618 3:14699164-14699186 GCATTTCTATACCTGTCCTGGGG - Intronic
955883172 3:63569632-63569654 GCAAATTCATGCCTGTCTTGGGG - Intronic
956289994 3:67651183-67651205 TTAATTACATGCCTGTGCTTTGG + Intronic
964028374 3:152105633-152105655 ACTATTCCATGCCTGAGCTGTGG - Intergenic
965906747 3:173717568-173717590 ACAATTCATTGCCTGTACTGAGG - Intronic
966945787 3:184776306-184776328 GCAAATCCAGCCCTGTGCAGGGG - Intergenic
969585798 4:8090865-8090887 GCCATTCCATGCAACTGCTGGGG + Intronic
969848310 4:9936993-9937015 GAACTTCCTTCCCTGTGCTGTGG + Intronic
970650283 4:18170203-18170225 ACAATGCCAGGCCTGTGCTGAGG + Intergenic
970882072 4:20944262-20944284 GCAGTTTCATGTCTATGCTGAGG + Intronic
977968605 4:103186503-103186525 GCAATACCATGACTTTACTGTGG + Intronic
978844630 4:113258088-113258110 GCAGTTCCATGACTTTGATGCGG - Exonic
980832442 4:138148585-138148607 GCAACTCCATGTTTGTGCTAAGG + Intergenic
981947400 4:150363830-150363852 GCAATTCAATGTCTATGCTGAGG + Intronic
982141286 4:152321788-152321810 GCTATTACTTGCCTGTTCTGTGG - Exonic
988389442 5:30608587-30608609 GGAATGCCATGCCTTTGTTGTGG + Intergenic
997352852 5:133243529-133243551 GCAATTCCAAATCTTTGCTGTGG - Intronic
998315120 5:141175157-141175179 CCACTTCCCTGCCTGTGCTCTGG - Exonic
999065856 5:148684787-148684809 GCAATTCCCTGCCAGTACTTGGG - Intergenic
1001616175 5:173045306-173045328 GCAATTCCAACCCTGTCTTGTGG - Intergenic
1002650928 5:180693084-180693106 GCATTGCCAGGGCTGTGCTGAGG - Intergenic
1002717404 5:181236180-181236202 ACCATTCCATCCCTGTACTGAGG + Intergenic
1004784974 6:18958099-18958121 GCAATTCCATGGCTGCCTTGGGG + Intergenic
1005954917 6:30656975-30656997 GCGATTCCATGCCTGTGCGGGGG + Exonic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1007622451 6:43223325-43223347 GCAGCTCCATGCCCGTGCTGAGG - Exonic
1008439541 6:51516852-51516874 GCAATACCCTGAATGTGCTGTGG - Intergenic
1017079591 6:150654883-150654905 GCATTTCCATCCCTGTCCTCTGG - Intronic
1018461174 6:164000046-164000068 GCAATACGAAGCCTGTACTGAGG - Intergenic
1020455131 7:8363845-8363867 GCAAGTCCATGCGTGTTATGAGG - Intergenic
1023457472 7:40356446-40356468 GCACTTCCATGCCTGTAATAGGG - Intronic
1027247812 7:76379259-76379281 GCACTCTCATGCCTTTGCTGGGG + Intergenic
1037892186 8:22629245-22629267 GCACTTCCTTGCCTCTTCTGCGG - Intronic
1040918773 8:52592684-52592706 GCAATTCTTCTCCTGTGCTGAGG - Intergenic
1041962609 8:63636222-63636244 GATATTCCATCACTGTGCTGCGG - Intergenic
1042964756 8:74338559-74338581 GCACTTCCACACCTGGGCTGTGG + Intronic
1046035989 8:108842298-108842320 GCAATTCCATGCCTTTCCATTGG + Intergenic
1047953289 8:129953434-129953456 GCAAATGCATGGCTGTGATGAGG - Intronic
1049317906 8:141979379-141979401 GCCTTTCCTTGCCTCTGCTGAGG - Intergenic
1050242039 9:3646868-3646890 GCAGCTCCATGACTGTCCTGAGG + Intergenic
1052478207 9:28989166-28989188 TCAATTCCATTCCTGTCCAGTGG + Intergenic
1054841591 9:69747409-69747431 TTACTTCCATGCCTTTGCTGAGG - Intronic
1058138512 9:101334194-101334216 GCATTTCCAGGCCTTTGCTCTGG - Intergenic
1059041414 9:110819206-110819228 CCAATCTCATGCCTGTGCTTTGG - Intergenic
1060405875 9:123372912-123372934 GCAGTTCCCGGCCAGTGCTGGGG - Intronic
1062166723 9:135111529-135111551 GAACTTTCCTGCCTGTGCTGAGG + Intronic
1062167517 9:135115346-135115368 GCAATCTCGTCCCTGTGCTGGGG - Intronic
1203770158 EBV:45811-45833 AAAAGTCCATGCCTGTGATGAGG + Intergenic
1187457788 X:19458133-19458155 GAAATGCCATGCCTGTCCTGTGG + Intronic
1189734454 X:44055538-44055560 GCAAATATATGCCTGTGATGTGG - Intergenic
1192434117 X:71132185-71132207 GCAAGACCAAGCCTGTGCTCAGG + Exonic
1195291177 X:103433089-103433111 GCAATTCCTTGCCTCCACTGTGG - Intergenic
1196611788 X:117723529-117723551 GAAATTCCATGGCTGATCTGTGG + Intergenic
1199747426 X:150782408-150782430 GCATTCCCATCCCTGTGGTGGGG - Intronic
1200138927 X:153887836-153887858 GCAGGTCCATGGCTGTGCTCAGG - Intronic
1201540651 Y:15101799-15101821 GCAATTACTTGCCTCTGCTTTGG - Intergenic