ID: 1173398370

View in Genome Browser
Species Human (GRCh38)
Location 20:42702056-42702078
Sequence AAGTGTGACAAGTGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173398370 Original CRISPR AAGTGTGACAAGTGGGAAGT GGG (reversed) Intronic
900802764 1:4747535-4747557 AAGAGGGACAAGTGGGAGGATGG - Intronic
902230307 1:15023405-15023427 AAGTGAGACACGTGGGTAGGAGG + Intronic
902654537 1:17858484-17858506 AATGGAGACCAGTGGGAAGTTGG + Intergenic
903370143 1:22830045-22830067 AAGTTTGACTGGTGGGAAGGGGG + Intronic
905935484 1:41820957-41820979 ACCTGTGACAGGTGGGAACTTGG + Intronic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
907245995 1:53109589-53109611 AAGTGGGACAAATGGAAAGTGGG - Intronic
907585464 1:55613059-55613081 AAGTGTGACATATTAGAAGTTGG - Intergenic
908074367 1:60497863-60497885 AAGTTTCACAAGTGTGAAGGAGG + Intergenic
910149186 1:84121570-84121592 AAGTGTGAAGAAGGGGAAGTTGG + Intronic
910328278 1:86037225-86037247 AAGTGTGAACACTGGGAAATGGG - Intronic
912109418 1:106322493-106322515 AAGTCAAACAAGTGGGAAGCAGG + Intergenic
912382475 1:109254902-109254924 ACTTGAGACAAGTGGGAAGGAGG + Intronic
915178943 1:154041684-154041706 AAGAGAGGCAAGTGGGAAGATGG - Intronic
915748018 1:158180211-158180233 CAGTGTGAGAAGTGGCGAGTTGG + Intronic
915806497 1:158858984-158859006 ACGTGTGCCAAATGGGAAGAGGG - Intergenic
916187250 1:162145393-162145415 AAGCCTCACAAGTGGGGAGTGGG + Intronic
916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG + Intronic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
918535438 1:185569250-185569272 AACTATGACCAGTGGGCAGTAGG + Intergenic
918685207 1:187406558-187406580 AAGAATGACAAGTGGGAACTTGG - Intergenic
918835845 1:189464683-189464705 ATTTGTGACAAGTGTGAACTTGG - Intergenic
920451257 1:206062731-206062753 AGGAGTGCCAAGCGGGAAGTGGG + Intronic
921014406 1:211175299-211175321 AAGTATGCCAAATGGGAAGGTGG - Intergenic
921283856 1:213591620-213591642 AAGTTTAAGAAGTGAGAAGTTGG - Intergenic
922869211 1:228886715-228886737 AAGTGTGATATGTGGGTGGTGGG - Intergenic
923538166 1:234869105-234869127 AAGTGCCAGAAGTGGGAAGATGG - Intergenic
923647427 1:235838177-235838199 GAGAGTGAGAAGTGGGAAGGAGG + Intronic
924536161 1:244937487-244937509 TAGGGTGACCAGTGGGAAGCTGG - Intergenic
1063904070 10:10765177-10765199 AAATGGGACCAGTGGGAAATGGG - Intergenic
1064469605 10:15622276-15622298 GAGAGTGAGAAGTGGGAAGAAGG - Intronic
1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG + Intronic
1066096569 10:32077876-32077898 TAGTATGAAAAGTGGGAAGAGGG + Intergenic
1067436378 10:46282184-46282206 AAGTCTGATGAGGGGGAAGTTGG - Intergenic
1068055693 10:52010692-52010714 CAATGTCACAAGTGGGGAGTGGG - Intronic
1068219980 10:54031503-54031525 ATGTATGAGAAGTGGAAAGTTGG + Intronic
1068461177 10:57331015-57331037 AATTGTGGCAAGTGGAAAGATGG - Intergenic
1069168323 10:65192343-65192365 AATTTTGACTAATGGGAAGTAGG + Intergenic
1069190414 10:65480211-65480233 AAGGGGGAAAAGAGGGAAGTAGG + Intergenic
1069827048 10:71260792-71260814 AATTGTGATGAGTGGGCAGTGGG + Intronic
1070698538 10:78581595-78581617 GAGTGAGACTAGTGGGAAGAAGG - Intergenic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071735542 10:88294957-88294979 AAGTGTGACAAAAGAGAAGGTGG - Intronic
1073769406 10:106719180-106719202 AAGAATGAAAAGTGGAAAGTGGG + Intronic
1074075397 10:110119067-110119089 AAGTGAATAAAGTGGGAAGTGGG + Intronic
1075187850 10:120278864-120278886 AGGTATGACAGGTGGGAAGCTGG + Intergenic
1075356393 10:121780863-121780885 AAGTGTGACAAGTAGCATGTGGG - Intronic
1076150767 10:128160238-128160260 GAGTTTAACAAGTGGGAAGCAGG + Intergenic
1076168510 10:128301482-128301504 GTTTGTGACAAGAGGGAAGTAGG - Intergenic
1078453407 11:11456936-11456958 CATGGAGACAAGTGGGAAGTGGG + Intronic
1078875398 11:15389779-15389801 AAGTGGTAAAAGTGGGAAGTGGG + Intergenic
1080394297 11:31875713-31875735 AAATGTGGCAAGTGGGATGGAGG + Intronic
1081199356 11:40198020-40198042 AAGTAGGATAAGTGGGAAGATGG + Intronic
1082110965 11:48273486-48273508 AATTGTGATAAGTGTGAACTAGG + Intergenic
1082781081 11:57287906-57287928 ATGTGTGACACTTAGGAAGTGGG - Intergenic
1083081291 11:60096259-60096281 CAGATTGACAAGTAGGAAGTGGG + Intronic
1083310847 11:61782975-61782997 AAGTGTGACAAGTCAGATGGGGG - Intronic
1085347112 11:75775337-75775359 AGGTGTGCCAGGTGGGAAGTGGG - Intronic
1085552503 11:77387498-77387520 AGGTCTCACAAGTGGAAAGTGGG - Intronic
1085623015 11:78051297-78051319 GGGTGTGACAGGGGGGAAGTTGG + Intronic
1085688435 11:78646777-78646799 AAGTGTGACAGGTGGCCACTAGG + Intergenic
1085814773 11:79726265-79726287 AAGAGTGGAAAGTGGGAAGAGGG - Intergenic
1087938698 11:104066445-104066467 AAATCTGAAAAGTGGGAACTCGG + Intronic
1088703413 11:112435493-112435515 AAAGGTGAGAAGTGGGAAGCGGG + Intergenic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1090430656 11:126643502-126643524 AAAGGTGACTAGTGGGAAATAGG + Intronic
1090827334 11:130397026-130397048 AATTGAGTCAGGTGGGAAGTTGG + Intergenic
1091787832 12:3253675-3253697 CAGGGTGACAGGTGGGAATTGGG + Intronic
1094161271 12:27393505-27393527 GAGTGTGAGAAATGGTAAGTAGG + Intronic
1094496236 12:30991055-30991077 AAGTGGGAGAAGTGAGAAGGCGG + Intronic
1095238793 12:39832541-39832563 AAGCAGGAAAAGTGGGAAGTTGG - Intronic
1098793649 12:74860788-74860810 AAAGGTGAGAAATGGGAAGTGGG - Intergenic
1100394739 12:94174785-94174807 AAGTGTCAAAACTTGGAAGTGGG + Intronic
1102306320 12:111807379-111807401 AAGTGTACCCACTGGGAAGTGGG - Intronic
1102634276 12:114309199-114309221 AAGTGTGACAAGTGTGATCAAGG - Intergenic
1104081208 12:125431777-125431799 AGGTGGGACAAGTGGGTGGTTGG + Intronic
1104463020 12:128970331-128970353 AAGTGGGACAGATGGGAAGTGGG - Intronic
1104593032 12:130099785-130099807 AAGTGTTCCCAGTGGGTAGTGGG + Intergenic
1104623363 12:130334802-130334824 GAGTGTGACAATTGGGAACGTGG - Intergenic
1104948744 12:132429279-132429301 ATGTGTGAAAATGGGGAAGTGGG - Intergenic
1105213615 13:18272159-18272181 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1107305119 13:39010373-39010395 AACTGCCACATGTGGGAAGTAGG - Exonic
1108420546 13:50244768-50244790 GAATGTGACAAGAGGGAAGGTGG - Intronic
1109494010 13:63144879-63144901 AAGTGTTGAAATTGGGAAGTGGG - Intergenic
1109516815 13:63454048-63454070 AAATGTGGGAAGTGGGAGGTGGG + Intergenic
1110980427 13:81890168-81890190 AATTGTGACAAGCGGGGTGTGGG - Intergenic
1112721060 13:102245952-102245974 AAGTTTTTCAAGTGGTAAGTAGG - Intronic
1113205040 13:107907426-107907448 AAGTGGGAAAAGTGGAAAATGGG - Intergenic
1114398529 14:22388390-22388412 AAGTGTGAGAAGTGGGGAAGTGG - Intergenic
1115145558 14:30222232-30222254 AAGTGGGAAAAGTTGGAGGTGGG - Intergenic
1116695533 14:48170953-48170975 AACTGTTAATAGTGGGAAGTTGG - Intergenic
1116815654 14:49581258-49581280 AAGTGTGACAGAAGGGAAGCTGG - Intronic
1117608945 14:57462956-57462978 AAGTGTGACAGAGGGGAAATTGG + Intergenic
1118630316 14:67696376-67696398 AAGTCTGACAGTTGGGAAGGTGG + Intergenic
1118909981 14:70053537-70053559 AAGTATGACATGGGGGAATTGGG - Intronic
1120186356 14:81397490-81397512 AAATGTGACAAGTCTGAATTGGG - Intronic
1120203426 14:81562866-81562888 ATGTGTGACATCTGGGCAGTAGG + Intergenic
1120286332 14:82506486-82506508 AAGTTTAACCAGTGGAAAGTTGG - Intergenic
1120942151 14:89958673-89958695 AAGTGTGCCAAGTGGGAAGAGGG + Intronic
1122568959 14:102680909-102680931 AAGTGTGAAAAGTATGAATTAGG - Intronic
1122587287 14:102817625-102817647 AAGGGTGACAAGGGGGAAAGAGG + Intronic
1125187480 15:36948124-36948146 AAGTGTGAAAATTAGGAAGATGG + Intronic
1125431593 15:39600447-39600469 ACATGAGACAAGTGGGAAGAAGG + Exonic
1129295079 15:74595785-74595807 GAGAGTGGCAAGTGGGAAGCTGG - Exonic
1129751459 15:78067717-78067739 CAGTGTGAGAAGTGGGGATTTGG - Intronic
1129881712 15:79011055-79011077 AGGGGTGATAGGTGGGAAGTGGG - Intronic
1131067778 15:89444926-89444948 ATGTGAGAAGAGTGGGAAGTGGG - Intergenic
1134861327 16:17562918-17562940 AAGTGTGATAAGTGAGAGGAAGG - Intergenic
1135652461 16:24218234-24218256 AAGTGTGACTTGTGGGGATTGGG + Exonic
1137829538 16:51530512-51530534 AAGGGAGACAAGAGGGATGTAGG + Intergenic
1137838151 16:51614116-51614138 AAATGTGATAATTTGGAAGTTGG - Intergenic
1138024170 16:53509937-53509959 CAGTCTTATAAGTGGGAAGTAGG - Intergenic
1138109158 16:54309489-54309511 AAGTGTGACATGTGGGAAGGAGG - Intergenic
1140460819 16:75138333-75138355 ACGTTTAACAAGTGGGAAGTTGG - Intergenic
1141421483 16:83920675-83920697 AGGTGTGAAAGGTGGGAACTAGG - Exonic
1141540079 16:84713392-84713414 CAGGGTGACAAGTGTGAAGGAGG - Intronic
1143863538 17:9908133-9908155 CAGTGTTACAAGTGAGAAGTGGG + Intergenic
1144038951 17:11391429-11391451 AAGTGTAACAAGGAGGAAGAGGG - Intronic
1146957733 17:36946549-36946571 AAGAGAGGCAAGTGGGAACTTGG + Intergenic
1148508529 17:48147920-48147942 AAGTGTGAGAAGGGGGACATGGG + Intronic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1150909023 17:69369037-69369059 AACTGTGAACAGTGGGAAGATGG - Intergenic
1155313459 18:24547544-24547566 AAGGGGGACAATTGGGACGTGGG + Intergenic
1155367860 18:25066606-25066628 AAGGGAGACAAGAGGCAAGTGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156880202 18:42068603-42068625 ATGTGGGAAAAGTGGGAGGTGGG - Intronic
1159602417 18:70441279-70441301 AAATGTGAGAAGAGAGAAGTGGG - Intergenic
1162826094 19:13253140-13253162 AGGGGTGGGAAGTGGGAAGTGGG + Intronic
1164761190 19:30729601-30729623 AAGTGTGAGCAGTGGGCTGTGGG + Intergenic
1167637391 19:50662686-50662708 GAATGTGACAAGGGGGCAGTGGG + Intronic
1167669925 19:50844888-50844910 AAGTGTGAAAAGTGTGAAGGGGG - Intergenic
926247915 2:11134100-11134122 AAGTGTGACCAGCGGTAAGAAGG + Intronic
926846372 2:17145537-17145559 AAGTGTGACTTTTGGGAGGTGGG + Intergenic
926989345 2:18660783-18660805 AAGAGTGACAAGTGGTAATATGG - Intergenic
928139806 2:28718553-28718575 AGGTGTGAAGAGTGGGAACTGGG + Intergenic
928876045 2:36041474-36041496 AAGTGTGGCAAGAGGGCAGCTGG - Intergenic
929287269 2:40149605-40149627 AAGTGTGACAAGATGGAAAGAGG + Intronic
931793586 2:65688401-65688423 AAATGTGCCAAGTTGGAAATAGG - Intergenic
934300713 2:91774587-91774609 AGGTGTGACAACAGGGAAGAGGG - Intergenic
936166253 2:110122259-110122281 AAATGTGACAAGTGAGAACTGGG - Intergenic
936817163 2:116473454-116473476 ATGGCTGACAAGTGGGGAGTCGG - Intergenic
938339171 2:130523953-130523975 GAGAGCGACAGGTGGGAAGTGGG - Intronic
938350666 2:130596797-130596819 GAGAGCGACAGGTGGGAAGTGGG + Intronic
939673580 2:145043701-145043723 ACCTTTGACGAGTGGGAAGTTGG + Intergenic
939771458 2:146324959-146324981 AATTCTGACATGTGGGCAGTAGG - Intergenic
940583945 2:155619157-155619179 TAGTGTGACAAGAGGGAATCAGG + Intergenic
942367659 2:175244765-175244787 AAGAGTGAGAAGTGGAAATTTGG + Intergenic
943322508 2:186463029-186463051 TGGTGTGACAAATGGGAAATTGG + Intergenic
944031353 2:195238497-195238519 AAGTGTGCCAAAAGGGAATTGGG + Intergenic
947157443 2:227176744-227176766 AAGTTCCACAAGTGGGAAGTTGG + Intronic
947219511 2:227779111-227779133 ACGTGTGTCAAGAGAGAAGTAGG + Intergenic
947297721 2:228651107-228651129 AAGGGTGGCAGGTGGGAAGAGGG + Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948609725 2:239159219-239159241 AGGTGTGAAAAGTGAGATGTGGG - Intronic
1168903314 20:1384592-1384614 GATTGAGACAAGTGGGTAGTTGG - Intronic
1169185602 20:3614338-3614360 AAGTGTGTGAGGTGGGAAGGTGG + Intronic
1171494341 20:25544974-25544996 AAGTATGACAAGTGAGATGAGGG + Intronic
1172080984 20:32340488-32340510 AAGTGTGCTTAGTGGGCAGTAGG + Intergenic
1173361230 20:42346369-42346391 CAGTGTGACAGGTGGGGCGTGGG + Intronic
1173398370 20:42702056-42702078 AAGTGTGACAAGTGGGAAGTGGG - Intronic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1174037645 20:47678067-47678089 AAGTCAGACAGGTGGGAGGTGGG - Intronic
1174749267 20:53095838-53095860 TACTGTTACAAGTGGAAAGTGGG + Intronic
1176686307 21:9851308-9851330 AAGGGTGATAAGTGGGATGTAGG - Intergenic
1176715976 21:10349126-10349148 AAGAGGGACAGGTGGTAAGTTGG + Intergenic
1178377809 21:32082470-32082492 AAGTGTGACAAATGGTACGTTGG + Intergenic
1178823579 21:35996863-35996885 AAGTGCTTGAAGTGGGAAGTAGG - Intronic
1180749180 22:18112328-18112350 AAGTGAGACAGGTCAGAAGTTGG - Intronic
1180816449 22:18792550-18792572 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1181202636 22:21226882-21226904 AGGTGTGACAACAGGGAAGAGGG + Intronic
1181637718 22:24182013-24182035 AAGTGAGATAAGTGGCAAGAGGG - Intronic
1181699067 22:24609723-24609745 AGGTGTGACAACAGGGAAGAGGG - Intronic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
1183324168 22:37182627-37182649 AAGGGTGACAAGGGGGAGATGGG - Exonic
1203224277 22_KI270731v1_random:68531-68553 AGGTGTGACAACAGGGAAGAGGG - Intergenic
1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG + Intergenic
949248547 3:1954814-1954836 AAGTGGGACAAGTGAGGAGATGG - Intergenic
951203190 3:19897321-19897343 AAGGCTGAGAAATGGGAAGTTGG - Intronic
951745676 3:25974656-25974678 CAGTGGGACAACTGGGAAGGGGG + Intergenic
952121510 3:30250075-30250097 AAATGTGACAATTGGGGAATTGG + Intergenic
953529699 3:43729229-43729251 ATGTGTGAGAAGTGGAAAGAAGG + Intronic
953637475 3:44675505-44675527 AAGCATGAAAAGTGGGAAGTAGG + Intergenic
953953577 3:47212508-47212530 AGGGGTGACAAGTTGGAAGGGGG + Intergenic
954671093 3:52291771-52291793 CAGTGTGACAGGTGGGATGGGGG - Exonic
954851421 3:53604193-53604215 TTGTGTGAAAAGTGGGAAGTGGG + Intronic
957026828 3:75191992-75192014 AAGTGTAACAAGTTAGAAGTGGG + Intergenic
959502398 3:107121406-107121428 AAGTGTGTGAAGTGGGGAGCAGG - Intergenic
961760319 3:129162335-129162357 AAATGTGACAAGTTTTAAGTGGG + Intergenic
961919465 3:130410768-130410790 GAATGTCACAAGTGGGCAGTGGG - Intronic
963938111 3:151075179-151075201 AAGGATGACAAGAAGGAAGTAGG + Intergenic
969034938 4:4245449-4245471 AACTGTGGCCAGTGGGAATTGGG - Intronic
970794800 4:19898726-19898748 AAATAGGAGAAGTGGGAAGTAGG - Intergenic
971150481 4:24026218-24026240 AACTGGGACTGGTGGGAAGTGGG - Intergenic
971850459 4:31979211-31979233 CAGTGAGATAAGTGGGAAGGAGG + Intergenic
973087631 4:46087288-46087310 TATTGAGACAATTGGGAAGTGGG + Intronic
975471829 4:74778664-74778686 AATTTTGACCAGTGGGAAATTGG - Intronic
975597462 4:76063063-76063085 AAGTGTGAAGTGTGGGGAGTTGG - Intronic
976500740 4:85786086-85786108 AAGTCATACAATTGGGAAGTTGG + Intronic
979590518 4:122474157-122474179 AATTGTGACAAGTGTGAACCTGG - Intergenic
980349759 4:131669784-131669806 AAGGGTGATAAGTGGGATGTAGG - Intergenic
981806789 4:148725168-148725190 AGGTGGGACCTGTGGGAAGTAGG - Intergenic
982522662 4:156438805-156438827 AACTGTGACAAGTTGTAAGAAGG + Intergenic
984277568 4:177628215-177628237 AAGGGTGGAAAGTGGGAAGAGGG - Intergenic
984509913 4:180666969-180666991 AAATGTGACAAGTGAGAGGGTGG - Intergenic
986229194 5:5846050-5846072 AATTGTGACAAGTTATAAGTAGG - Intergenic
987370288 5:17186761-17186783 AAATGTGAAAAGGGGGAAGCCGG - Intronic
989624441 5:43415799-43415821 ACTTGTGACTGGTGGGAAGTAGG + Intergenic
990177004 5:53119059-53119081 AAGTGCGCCAAATGGGAAGGTGG + Intergenic
991157553 5:63457450-63457472 AAGTGGGCAAATTGGGAAGTGGG - Intergenic
992229468 5:74649673-74649695 AGGTGTGACAAATGAGAAGCTGG + Intronic
993272627 5:85814744-85814766 GAGTGTGCCTAGTGGAAAGTAGG - Intergenic
994839160 5:104899111-104899133 ATGTGTAACAAGTGGCAAGAGGG - Intergenic
996397963 5:123032269-123032291 AAATGAGAAAAGTGGGAATTAGG + Intronic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
999115500 5:149160014-149160036 AAGTGTGACAAGTAGAATGAAGG - Intronic
999651861 5:153775825-153775847 AATTGTGATAGATGGGAAGTGGG + Intronic
1001220645 5:169897558-169897580 TACTGTATCAAGTGGGAAGTAGG + Intronic
1001227905 5:169961638-169961660 AATTGTGACAAGTGCTAAGAAGG + Intronic
1001404650 5:171467363-171467385 AGTTGTGACAACTGGGGAGTTGG - Intergenic
1001866533 5:175110884-175110906 AACTGTGACAGAGGGGAAGTTGG + Intergenic
1002011752 5:176288654-176288676 GAGTGGGTCAAGTGAGAAGTTGG - Intronic
1002108887 5:176894611-176894633 AGGTTGGACAAGGGGGAAGTGGG + Intronic
1003113032 6:3264783-3264805 AAGGGTGGCAAGTGGGAAATTGG - Intronic
1009772928 6:68166512-68166534 AAGTGTAAAAAGTGTGAAATGGG + Intergenic
1010701683 6:79056575-79056597 AATTGTGACAAGGGGGTAGTGGG + Intronic
1010973354 6:82286621-82286643 AAGTGGGACAGGAAGGAAGTGGG + Intergenic
1011429080 6:87265968-87265990 AAGAGTGGGAAATGGGAAGTAGG - Intergenic
1012445121 6:99299266-99299288 GACAGTGACCAGTGGGAAGTGGG - Intronic
1012537086 6:100312400-100312422 AAGTGTGACAAGTGTCATGAAGG + Intergenic
1012549360 6:100453515-100453537 CAAGGTGACAAGTGAGAAGTTGG - Intronic
1015311123 6:131768247-131768269 AAGTGTGATAAGCGATAAGTGGG - Intergenic
1015847696 6:137538144-137538166 ACTTGTGATAAGTGGGAAGGAGG - Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1019085603 6:169473307-169473329 AAGAGTGACAAAAGGGAAGGAGG + Intronic
1020035169 7:4959704-4959726 ACGTGGGATGAGTGGGAAGTGGG + Intergenic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1022769785 7:33456972-33456994 AAGTGGGACAAGGAGTAAGTGGG + Intronic
1022946905 7:35294973-35294995 AAGTGTATCAAGTTGGGAGTTGG - Intergenic
1023014211 7:35950775-35950797 AAGAGAGAGAAGTGGGAAATGGG - Intergenic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1024835741 7:53516220-53516242 AAATGTGTCAAGTGGCAAGTCGG - Intergenic
1027588522 7:80088540-80088562 AAGAGTGAAAAGCGGGATGTTGG + Intergenic
1027683920 7:81257143-81257165 AAGAGTGTGAATTGGGAAGTCGG + Intergenic
1028968333 7:96827788-96827810 AAGTGTGGGAAGTGTGAAGAGGG - Intergenic
1029305039 7:99612960-99612982 AAGTGAGACAATTTGGAACTAGG - Intergenic
1030031641 7:105375334-105375356 AAGTGTAACAAGTGGGTATGGGG + Intronic
1031667246 7:124499701-124499723 AAGTTTGACAGAAGGGAAGTGGG + Intergenic
1032320138 7:130878697-130878719 AAGTGGGAGAAGTTGGATGTAGG - Intergenic
1033093702 7:138411110-138411132 AAAATAGACAAGTGGGAAGTGGG - Intergenic
1033521661 7:142167080-142167102 AAATGTGACTATTTGGAAGTAGG - Intronic
1035615454 8:996888-996910 CAGTGTGACTTGTGGGAAGGTGG - Intergenic
1036774376 8:11600033-11600055 AAGGGTTACAGGTGGGAGGTGGG - Intergenic
1037449591 8:19003426-19003448 GAGAGTGAGAAGTGTGAAGTTGG - Intronic
1038709943 8:29934028-29934050 AAGTGAGACAAGCAGGAAGGAGG - Intergenic
1039448955 8:37655824-37655846 ATGTGTGAGGGGTGGGAAGTGGG + Intergenic
1039879117 8:41612730-41612752 AAGCGTTAGAAGTGAGAAGTTGG + Intronic
1040946304 8:52888278-52888300 AAGTGTAAATAGTGAGAAGTGGG + Intergenic
1041423268 8:57692962-57692984 AGCCTTGACAAGTGGGAAGTGGG + Intergenic
1042206686 8:66336617-66336639 AATTGTCACAAGTTGGAGGTGGG + Intergenic
1044271296 8:90247244-90247266 GAGTGTGAAAACAGGGAAGTTGG - Intergenic
1045585609 8:103532198-103532220 TGGTGTAATAAGTGGGAAGTAGG - Intronic
1046195521 8:110858973-110858995 AAGTGTGACTTGTCTGAAGTAGG + Intergenic
1046964036 8:120143107-120143129 AACTGTATCAAGTGGGATGTTGG - Intronic
1048154911 8:131937318-131937340 AACTGTGAGAAGTAGGTAGTAGG + Intronic
1050149823 9:2608284-2608306 AACTCTGACAAGTGGGCACTGGG - Intergenic
1052048961 9:23824225-23824247 AACTGTGACAAATTGGAGGTTGG - Intronic
1053461113 9:38272220-38272242 AAGTGGGACACGTGGAATGTGGG + Intergenic
1054460127 9:65458233-65458255 AGGTGTGACAAGTGGGAGAGGGG - Intergenic
1054963592 9:70997157-70997179 AAATGTGACAAGGGGGTAGGAGG - Intronic
1056835978 9:89955416-89955438 AAGTGTGAGATGGGAGAAGTGGG - Intergenic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1058772398 9:108248289-108248311 AGGAATGACAAGTGTGAAGTGGG - Intergenic
1058940241 9:109806742-109806764 TAGTGTGGCAGGTGGGGAGTGGG + Intronic
1062269716 9:135702846-135702868 AAGAGTCCCCAGTGGGAAGTGGG + Intronic
1187221033 X:17326494-17326516 AGGTGTAAAAAGTGGGAAGGAGG - Intergenic
1189049172 X:37626138-37626160 AAGCGTGAGAAGTGAGAAGATGG - Intronic
1191667775 X:63721016-63721038 AATTGAGACAAGGGGTAAGTGGG - Intronic
1193264245 X:79449631-79449653 CAGTGTCACAGGTGAGAAGTAGG - Intergenic
1194197788 X:90916545-90916567 AAGTGTGACTAGTGAGATGTAGG - Intergenic
1194980444 X:100434818-100434840 AAGTGTGGAAAGTGGCAATTGGG - Intergenic
1195455657 X:105066272-105066294 AAGGGTGAGATGTGGTAAGTAGG - Intronic
1196279800 X:113810741-113810763 GAGTGTGTGAAGTGGGAAGCAGG + Intergenic
1198147334 X:133870528-133870550 ATGTGGGACAAATGGAAAGTAGG - Intronic
1198202617 X:134436934-134436956 AATTGAGAAAAGTGGGAGGTTGG + Intergenic
1200543951 Y:4496273-4496295 AAGTGTGACTAGTGAGATGTAGG + Intergenic
1201456185 Y:14169246-14169268 AAGTCTCACAGGTTGGAAGTTGG - Intergenic