ID: 1173398496

View in Genome Browser
Species Human (GRCh38)
Location 20:42702985-42703007
Sequence GATCATACCCTGCTGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173398496 Original CRISPR GATCATACCCTGCTGCTGGC AGG (reversed) Intronic
903319443 1:22533535-22533557 TATCAGACCCTCCTGATGGCAGG - Intergenic
904352963 1:29920849-29920871 GATCATTCCCAGGTGCTGACAGG + Intergenic
913485506 1:119329502-119329524 GAAAATATCCTGCTGTTGGCAGG - Intergenic
917684959 1:177406593-177406615 GATTATATCCTGCACCTGGCTGG - Intergenic
920041885 1:203103368-203103390 CATCTTCCCCTGCTTCTGGCAGG + Intronic
920194441 1:204217517-204217539 CCTCAGACCCTGCTGCTGCCAGG - Intergenic
920215259 1:204358343-204358365 GAGCAGACCCTGCTGGTGGAGGG - Intronic
920956170 1:210621982-210622004 GAACAGACCCTGGGGCTGGCAGG + Intronic
1066662453 10:37749702-37749724 GAACACAGCATGCTGCTGGCTGG - Intergenic
1069798714 10:71069337-71069359 GTGCCTGCCCTGCTGCTGGCTGG + Intergenic
1070167039 10:73906724-73906746 GGTCATAGCCTGATGCTGGAGGG + Intergenic
1070763054 10:79037273-79037295 GATCATACCTCACTGCAGGCTGG + Intergenic
1070883652 10:79871046-79871068 GATCATGCTATGCTGCTGGTTGG - Intergenic
1071124191 10:82315478-82315500 GATCTTACACTGAAGCTGGCAGG + Intronic
1078073141 11:8132133-8132155 GACCATACCATGCTTCTAGCAGG + Intronic
1078512692 11:11997396-11997418 GATCATATCCTATGGCTGGCTGG + Intronic
1084600914 11:70144975-70144997 TATAATACCCAGCTGCTGCCAGG - Intronic
1085045914 11:73353268-73353290 GACCCTACCCCGCTCCTGGCTGG + Intronic
1086193058 11:84103331-84103353 GATCTGTCCCTGCAGCTGGCAGG - Intronic
1089023657 11:115244678-115244700 CATCAAAGCCTGATGCTGGCTGG - Intronic
1089405471 11:118194020-118194042 GATCAGACCCTCCTGTGGGCAGG - Exonic
1092069180 12:5618860-5618882 GATGATACTCTGCTGCTGACAGG - Intronic
1092239295 12:6827580-6827602 GAGCATATCCTGCTGGGGGCGGG + Intronic
1096009291 12:48199169-48199191 GATCATAGCTTACTGCAGGCTGG + Intergenic
1102207655 12:111101347-111101369 GGTCACACCCTGCAGGTGGCAGG - Intronic
1107610556 13:42108382-42108404 GAAAATACACTGCTGCTAGCAGG + Intronic
1113003507 13:105671905-105671927 TATGATACCCTGCTGCTCTCAGG - Intergenic
1114613530 14:24056737-24056759 GACCCTACCCTGGTGCTGCCTGG + Intronic
1118008817 14:61589761-61589783 GATCAATGCCTGCCGCTGGCAGG - Intronic
1122322828 14:100865963-100865985 AAGCATAACCTCCTGCTGGCTGG - Intergenic
1130254266 15:82318627-82318649 CATCATACCTTTCAGCTGGCTGG + Intergenic
1131527799 15:93166489-93166511 AATCCCACCCTGCTGCTCGCTGG - Intergenic
1132273855 15:100549359-100549381 GATCTTACCCCACTGCTGGGGGG + Intergenic
1135981576 16:27151828-27151850 GATCACAGCTTCCTGCTGGCTGG - Intergenic
1137886639 16:52111532-52111554 TATCAGACCCTACTTCTGGCTGG + Intergenic
1138463265 16:57166586-57166608 GAGCATACAATGCTGCTGGGAGG - Intronic
1143593534 17:7900320-7900342 GATCATAAGTTGCTGCTGACAGG + Exonic
1145385453 17:22408976-22408998 GATCATTCTCTGCTGCAGCCAGG + Intergenic
1147443167 17:40459866-40459888 GATCAAGCCCTGATGTTGGCTGG + Intergenic
1151529573 17:74695801-74695823 GACCTGACCCTGCAGCTGGCCGG - Exonic
1158351728 18:56571319-56571341 GATCATAGCCTGATGCTGTATGG + Intergenic
1159552034 18:69905197-69905219 GATCCTGCCCTGCTGCAGGGTGG - Intronic
1163400715 19:17090895-17090917 GAAAATACCCTGGTTCTGGCGGG - Intronic
1163648529 19:18503798-18503820 GAGCCTTCCCTGCTGCAGGCTGG + Intronic
1166211514 19:41309520-41309542 CATCATACCCTGTCTCTGGCTGG - Intronic
930022468 2:47009629-47009651 GCTCATACCCTGCTGTAGACAGG + Intronic
931977043 2:67654395-67654417 GATTATATCCTGCACCTGGCTGG + Intergenic
932478123 2:72021619-72021641 GATTATATCCTGCACCTGGCTGG - Intergenic
934632223 2:95939732-95939754 TATCATTCGCTTCTGCTGGCAGG + Intronic
934801279 2:97163550-97163572 TATCATTCGCTTCTGCTGGCAGG - Intronic
935676298 2:105597445-105597467 GATCATATACTGATGCTGCCGGG + Intergenic
939845488 2:147241094-147241116 GAGCATACCCTTCTTCTGTCAGG + Intergenic
940814026 2:158278468-158278490 GATTATATCCTGCACCTGGCTGG + Intronic
942859436 2:180591403-180591425 GATTATACCCTGCACCTGGCTGG - Intergenic
1169687458 20:8291236-8291258 GATCAGGCTCTGCTGCTTGCAGG + Intronic
1173398496 20:42702985-42703007 GATCATACCCTGCTGCTGGCAGG - Intronic
1175403876 20:58714999-58715021 GAGCCTTCCATGCTGCTGGCTGG - Intronic
1176050464 20:63116642-63116664 GATGAAACCCAGCTTCTGGCTGG - Intergenic
1178552498 21:33552512-33552534 CGTCATACTCTGCTGCTGACCGG + Exonic
1179513540 21:41891352-41891374 GAACACACCCTGCTGATGGCTGG - Intronic
1183547767 22:38464094-38464116 GATCTGTCCCTGCTGCTGGGTGG - Intergenic
1183838728 22:40479403-40479425 GGGCATCCGCTGCTGCTGGCCGG + Intronic
949538399 3:5013322-5013344 GATAACACCCAGCTGCTGTCAGG + Intergenic
963145175 3:141986753-141986775 GCTCATACACTGCTGGTGGCAGG - Intronic
964479498 3:157127659-157127681 GATGCTACCCTGCTGCTGGCGGG - Intergenic
966403592 3:179571670-179571692 GATCATAACTTGTTGCTGGAGGG - Intronic
968687922 4:1973898-1973920 GTCCATTCCCTGCTGCTGGGTGG + Intronic
969676801 4:8618853-8618875 GTTCATACCCTGTTGATAGCTGG + Intronic
970226271 4:13860514-13860536 AATCACACCCTGCTGCTTACAGG + Intergenic
971372053 4:26027734-26027756 CATCATAACCTCCAGCTGGCAGG - Intergenic
973733262 4:53844287-53844309 GAGCGGACCCTGCTGCTGGTTGG + Intronic
977621726 4:99145444-99145466 TCTCATACACTGCTGCTGGTAGG - Intronic
979204079 4:118013779-118013801 GATAATAGCTTGATGCTGGCAGG - Intergenic
984015230 4:174417687-174417709 GATTATATCCTGCGCCTGGCTGG - Intergenic
988086011 5:26476368-26476390 GATTATATCCTGCACCTGGCTGG + Intergenic
988284350 5:29191763-29191785 GATTATATCCTGCACCTGGCTGG - Intergenic
989336584 5:40324333-40324355 AATGATCCCCTGCTGCTGTCTGG + Intergenic
991552785 5:67860453-67860475 GATTATACACTGCTGGTGGGAGG + Intergenic
998522962 5:142817255-142817277 GATGAGACCCAGCAGCTGGCTGG + Intronic
999606852 5:153325657-153325679 GATTATATCCTGCACCTGGCTGG + Intergenic
1001090442 5:168736399-168736421 GATCAACCCCTCCAGCTGGCTGG + Intronic
1005262280 6:24073817-24073839 GCTTATACTCTGCTGCTGGTGGG - Intergenic
1006741899 6:36314860-36314882 TATCAGAGCCTGCTCCTGGCTGG + Intergenic
1015056708 6:128911311-128911333 GATTATATCCTGCACCTGGCTGG - Intronic
1015715182 6:136185098-136185120 GATCATAGCCTTCTGAGGGCAGG - Intronic
1019231840 6:170572484-170572506 GCTCATACCGTGCTGCTATCTGG + Exonic
1019522805 7:1468258-1468280 GATCAGACCCTGAGGCGGGCAGG + Intergenic
1019909588 7:4091636-4091658 AAGCATACCTTGCTGTTGGCAGG - Intronic
1024656403 7:51454484-51454506 GAACACACCCTGGTGCTGGGAGG + Intergenic
1024877925 7:54047116-54047138 GATTATATCCTGCACCTGGCTGG - Intergenic
1032921025 7:136548095-136548117 GATAATACCTTTTTGCTGGCAGG + Intergenic
1035452369 7:158985738-158985760 GATCTGACCCTGCAGCTGGCTGG - Intergenic
1039380758 8:37082810-37082832 GATCATGTCTTGCTGTTGGCAGG - Intergenic
1039528550 8:38238103-38238125 CATCAGACCCTGCAACTGGCTGG - Exonic
1039968296 8:42299601-42299623 GATCATGCCCAGAAGCTGGCAGG - Intronic
1040919093 8:52597295-52597317 CGTCATACGCTACTGCTGGCGGG - Intergenic
1048934961 8:139347386-139347408 GACCCTACCATGCTACTGGCAGG - Intergenic
1049596430 8:143485971-143485993 GCTCACATGCTGCTGCTGGCAGG + Intronic
1049601747 8:143511078-143511100 GCTCAAACCCTGCTGATGGATGG - Intronic
1049672144 8:143874700-143874722 GAGCAGACCCTGCTCCTGGGTGG - Intronic
1050398335 9:5223864-5223886 GATCTTGTCCTGATGCTGGCTGG - Intergenic
1051108005 9:13603233-13603255 GTTCATACCATACTGCTGCCAGG - Intergenic
1055796145 9:79976871-79976893 CATCATTCCCTCCTCCTGGCTGG - Intergenic
1056790714 9:89623652-89623674 GAGCACAGCCTGCTTCTGGCAGG + Intergenic
1060859658 9:126944117-126944139 TCCCATACACTGCTGCTGGCTGG - Intronic
1061316432 9:129799145-129799167 GATTATACCGGGGTGCTGGCAGG - Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062714852 9:138004009-138004031 AACCATCCTCTGCTGCTGGCGGG + Intronic
1190576787 X:51847582-51847604 GATGGGAGCCTGCTGCTGGCAGG - Intronic
1196210460 X:112990301-112990323 GATCATACCTTACTGCAGCCTGG + Intergenic
1198637604 X:138716513-138716535 GATCATAGCTTGCTGCAGCCTGG - Intronic