ID: 1173399895

View in Genome Browser
Species Human (GRCh38)
Location 20:42715926-42715948
Sequence GTGCAAATCCAGAGATATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173399892_1173399895 16 Left 1173399892 20:42715887-42715909 CCAAAAATAGTTAAAACAATCTT 0: 1
1: 18
2: 133
3: 579
4: 2083
Right 1173399895 20:42715926-42715948 GTGCAAATCCAGAGATATATGGG 0: 1
1: 0
2: 0
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173399895 Original CRISPR GTGCAAATCCAGAGATATAT GGG Intronic
903739767 1:25552054-25552076 AGGCAAATCCAGAGAAATGTGGG + Intronic
904681695 1:32233881-32233903 CTGCAAACCCAGAGATAAATAGG - Intergenic
911285543 1:95987739-95987761 GTCCAAACACAGAAATATATTGG + Intergenic
912080299 1:105928000-105928022 GTGCAAATCCAAAGAAACCTGGG + Intergenic
913448194 1:118972283-118972305 GTGTAAATCCAAACATATAATGG - Intronic
914233446 1:145786716-145786738 GTGCTAATTAAAAGATATATTGG - Intronic
918396117 1:184114809-184114831 GGGAAAATCCTGAGATATGTGGG + Intergenic
920276027 1:204804956-204804978 GGGCAGATCCAAAGATACATGGG + Intergenic
921104840 1:211966074-211966096 GAGCAAAACCAGGGATATTTTGG + Intronic
921607449 1:217172646-217172668 GTGGATATCCAGTGATATAAAGG + Intergenic
1063727049 10:8648554-8648576 GTGTAAAGGCAGAGATATAACGG + Intergenic
1064995405 10:21292365-21292387 GTGCAATTCCAGTGATATTCTGG - Intergenic
1073710069 10:106026545-106026567 CTACAAATCCAGAGAAAAATGGG + Intergenic
1074275335 10:111996377-111996399 GTGCTAATGCAGGGATATAGTGG - Intergenic
1074278740 10:112029935-112029957 GGGAAAATCCAGAGCTATCTAGG - Intergenic
1074294548 10:112171629-112171651 GTGCAAATGCGGAGAGATACAGG - Intronic
1077724102 11:4656794-4656816 GTACAAATAAAGAGAAATATGGG - Intergenic
1078680243 11:13469111-13469133 ATGGCATTCCAGAGATATATAGG - Intergenic
1082660999 11:55911165-55911187 GTACAAATTCAGAGAAATAATGG + Intergenic
1082843558 11:57709422-57709444 GTGGAAATCAAGAGTTATTTTGG - Intronic
1091510013 12:1112918-1112940 ATGCAAATCCACAGATATGGAGG - Intronic
1092240088 12:6830847-6830869 CTACAAATCCAGAGACAGATGGG - Intronic
1092628702 12:10356042-10356064 GTGCAACTGCAGAGTTATGTGGG - Intergenic
1092777494 12:11956782-11956804 GTGCATATCCACTGATATTTTGG - Intergenic
1093065023 12:14648619-14648641 GTGCACATTCAGAGAGATAAAGG - Intronic
1095145308 12:38720415-38720437 GTGCAAATCTAGCAATATTTGGG - Intronic
1095218082 12:39573582-39573604 GTGCAACTTAAGAGAAATATGGG + Intronic
1095257201 12:40052430-40052452 GGGCAAATCATGAGGTATATTGG + Intronic
1097352695 12:58565894-58565916 GTCAGAATCCAGAGATATAATGG - Intronic
1097631696 12:62072077-62072099 TTGCATATCCAGAGAAAGATAGG + Intronic
1098930132 12:76402097-76402119 ATGCAAATACAAATATATATAGG + Intronic
1101445702 12:104735599-104735621 GAGCAAATCCAGAGAGACTTGGG + Intronic
1102614877 12:114144860-114144882 TTGAAAATCCAGAGATCTCTGGG - Intergenic
1103749175 12:123147764-123147786 GTGCAAATCCAGGGAAACTTGGG + Intronic
1104561557 12:129850049-129850071 TTTCAAATCCACAAATATATGGG - Intronic
1104838058 12:131804895-131804917 GTGCTAATACAGTGATATAGTGG - Intergenic
1105903180 13:24775864-24775886 GTCCCAAACCAGAGATATAAAGG - Intronic
1106513751 13:30434459-30434481 GTGGATATCCAAAAATATATGGG - Intergenic
1108682858 13:52794269-52794291 GTGACAAACCAGAAATATATTGG - Intergenic
1108870429 13:54977546-54977568 GGGCAAGTCCAGAGATAAACTGG - Intergenic
1110159200 13:72354902-72354924 CTACAAACCAAGAGATATATAGG - Intergenic
1110608809 13:77465647-77465669 GTGTTCATCCAGAGATATAATGG + Intergenic
1111220756 13:85202913-85202935 GTATAAATTCAAAGATATATTGG + Intergenic
1114928381 14:27434545-27434567 GTGGTACTCCAGAGAAATATGGG - Intergenic
1115062707 14:29212795-29212817 CGGCAAAACCAGAGATGTATTGG + Intergenic
1115699718 14:35939956-35939978 GAGCAAATCCAGAATCATATTGG + Intergenic
1119608802 14:76044359-76044381 ATGCAAATGAAGAGCTATATAGG + Intronic
1120279434 14:82420321-82420343 GTGTAAATGCAGGCATATATGGG - Intergenic
1120413447 14:84188426-84188448 GTAAAAATACAGAAATATATTGG + Intergenic
1121651472 14:95562157-95562179 ATGCAATTCAAGAGATATTTGGG - Intergenic
1123765687 15:23476429-23476451 ATGCAAATCCAAACATATCTGGG + Intergenic
1126200147 15:45976176-45976198 GTGCTATTCCAGAGACATAAAGG + Intergenic
1126510430 15:49465612-49465634 TTGAAAAACCAGAGATATTTGGG + Intronic
1126575994 15:50197054-50197076 GTGCAAACCAATAGACATATGGG - Intronic
1127816144 15:62610840-62610862 GTGCACATACAGAGATACACAGG - Intronic
1138714598 16:59006684-59006706 GGACAAATACAGAGAGATATTGG - Intergenic
1139005128 16:62560314-62560336 GTGCAAATCTAGAAATATTTTGG - Intergenic
1143208336 17:5162940-5162962 GTGCCAATCCACAGCAATATAGG - Exonic
1146480744 17:33203075-33203097 GTGCTAAACCAGAGACACATTGG + Intronic
1147994063 17:44351782-44351804 GTCCAATCCCAGAGGTATATGGG + Exonic
1149258200 17:54850843-54850865 TTGCAAATCCAGAAACATAAGGG - Intergenic
1149812079 17:59685483-59685505 TTGCAAAACCAGATTTATATTGG + Intronic
1151698973 17:75732420-75732442 TTTGAAATACAGAGATATATGGG + Intronic
1152288468 17:79425525-79425547 GGGCAAAGCCTGAGATATCTGGG + Intronic
1153271858 18:3330355-3330377 TTGCAAATGCAGAGCTATATAGG - Intergenic
1156157220 18:34317250-34317272 TTGCAAATTCTGAAATATATTGG - Intergenic
1159135235 18:64329713-64329735 GTGTTGATCCAGAGATGTATTGG + Intergenic
1164235663 19:23331095-23331117 GTGCAAATACACAAATATTTAGG - Intronic
1166029474 19:40116121-40116143 GTGCAAATTCAGGGAGATAAAGG + Intergenic
925140658 2:1547674-1547696 GTGCAAATGCAGAGTTAGTTAGG - Intergenic
925805815 2:7646689-7646711 GCACATATCCAGAGATACATTGG + Intergenic
926947020 2:18199645-18199667 GTGCAAGTCCAGAGAGAGGTGGG + Intronic
927237356 2:20886407-20886429 GTGCCAACCAAGAGACATATAGG + Intergenic
931297191 2:60938794-60938816 GTGTAGATACAGAGATGTATAGG + Intergenic
935834198 2:107032474-107032496 ATGCAAATCGAGTGGTATATGGG + Intergenic
936554701 2:113484991-113485013 GTGCATATAGACAGATATATAGG - Intronic
948236897 2:236397897-236397919 GTGCTAGCCCAGAGATATAAAGG - Intronic
1172534477 20:35662371-35662393 GTGCAAACCAAAAGGTATATGGG + Intronic
1173399895 20:42715926-42715948 GTGCAAATCCAGAGATATATGGG + Intronic
1182266413 22:29119225-29119247 CTGCAGATGAAGAGATATATAGG + Intronic
951618813 3:24578753-24578775 ATGCTAATCCTGAGATAAATTGG - Intergenic
956963822 3:74435122-74435144 ATGCAAAATCAGAGATAAATGGG - Intronic
957482120 3:80811774-80811796 TTGCAAATACACAGCTATATAGG - Intergenic
958498895 3:94880209-94880231 TTTCAAATCCAGAGAGATATAGG - Intergenic
958537653 3:95425067-95425089 CTGCAAAGCCACAGGTATATGGG - Intergenic
959381580 3:105647539-105647561 GTGCTCATCTAGAGATATATTGG - Intergenic
960224318 3:115151494-115151516 CTGCAAATCCAGTGAAATAAGGG - Intergenic
960839943 3:121947179-121947201 GTAAAAATCTAGAGATATAATGG - Intergenic
961274555 3:125716534-125716556 ATGCACATCCAGTGCTATATTGG + Intergenic
962567103 3:136672039-136672061 GTGAAACTCCAGAAATTTATTGG - Intronic
967080881 3:186048490-186048512 GTGCCAATCCAGAGACAGCTTGG + Exonic
967760437 3:193218270-193218292 GTGCAAAGTCATAGTTATATTGG + Intergenic
975654093 4:76623740-76623762 GTGCAAATCCAAAGCTAAATAGG - Intronic
977115050 4:93013690-93013712 GTGCAAATACAGATTTACATAGG - Intronic
977357551 4:95966630-95966652 GGTCAAATCCAGAAAGATATTGG - Intergenic
977780432 4:100975282-100975304 ATGCAAATCAAGAGGTAGATTGG - Intergenic
979104140 4:116663273-116663295 GTGCAAAGGAAGAGATAAATAGG - Intergenic
981472993 4:145158183-145158205 TTACAAATCAAGAGATATACAGG + Intronic
990273450 5:54170760-54170782 GTTCATATCCAGAAATAGATGGG - Intronic
991152947 5:63393360-63393382 GTTCAAATCCAGTGATCTTTGGG - Intergenic
991253269 5:64586863-64586885 GTGCAAATCCACTGAAATAATGG + Intronic
991615738 5:68495431-68495453 GTGCAAATGCAAAGGCATATAGG - Intergenic
991944829 5:71889996-71890018 CAGCAAGTACAGAGATATATTGG + Intergenic
994046324 5:95314441-95314463 GTTAAAATCATGAGATATATTGG - Intergenic
994890042 5:105621967-105621989 AAAGAAATCCAGAGATATATAGG - Intergenic
996594849 5:125188645-125188667 CTGGAAGTCCAGAGAAATATAGG - Intergenic
997919206 5:137962221-137962243 GTACAAATCCAAACATTTATGGG + Intronic
1000395730 5:160772834-160772856 TTGCAAACCCAGAGATATCTGGG - Intronic
1000799147 5:165702890-165702912 AAGCAAATCCAGAGATTTAGGGG - Intergenic
1003593013 6:7451612-7451634 GGGCAAATCCATAGATACAGAGG + Intergenic
1005370869 6:25131232-25131254 ATGTAAATACATAGATATATTGG - Intergenic
1009460518 6:63907295-63907317 TTGTAAATCTAGAGATATATGGG - Intronic
1009641755 6:66346509-66346531 GGGCAATTCCAGAGCTATAGAGG + Intergenic
1012346227 6:98190541-98190563 GGCCAAATCTATAGATATATGGG - Intergenic
1012479696 6:99652838-99652860 GTGCAAATGCAGAGAGGTATGGG - Intergenic
1016239289 6:141909672-141909694 GAGCAAATCCAGAGGTAGGTCGG + Intergenic
1016897064 6:149063785-149063807 GTGGAAATACAAAGATAAATGGG + Intronic
1023259097 7:38340821-38340843 CTGCAACTCCAGGGATATGTTGG - Intergenic
1024211594 7:47210686-47210708 GTGCAAAGCCAAAGGGATATTGG - Intergenic
1024388274 7:48778520-48778542 GTGAAAACCCAAAGATTTATAGG + Intergenic
1024553727 7:50584974-50584996 GTGCAAACCCACAGATCTCTGGG - Intergenic
1028746961 7:94337994-94338016 ATCCATATCCAGTGATATATGGG - Intergenic
1029868922 7:103667119-103667141 CTGCAAATCCATAGAAATGTTGG - Intronic
1032355780 7:131209334-131209356 GTGGAAGTCCAGAGATGTTTAGG + Intronic
1032745705 7:134783846-134783868 GGGTAAATACACAGATATATAGG + Intronic
1034692761 7:153027168-153027190 GTGCCAAGCCAGACATATGTTGG - Intergenic
1036854020 8:12227041-12227063 GTGGAACTCCAGGTATATATGGG + Intergenic
1038192937 8:25340467-25340489 GTAGAAATCAAGAGATATTTGGG - Intronic
1039458537 8:37724756-37724778 GTGCCCAGCCAGAGATATTTGGG - Intergenic
1039918922 8:41879526-41879548 GTGCAATGCCAGAGAGATGTAGG + Intronic
1042977403 8:74485229-74485251 TTCCAAATCCAAAGATTTATAGG + Intronic
1043365337 8:79526378-79526400 GGGCAAATCCACAGAAATTTGGG + Intergenic
1046893101 8:119444709-119444731 GAACAATTCCAGAGATCTATAGG + Intergenic
1047340636 8:123977135-123977157 GTGCAACTCCAGAAATACAGTGG - Intronic
1049898311 9:132193-132215 GTGCATATAGACAGATATATAGG + Intronic
1052242121 9:26286325-26286347 AACCAAATGCAGAGATATATGGG - Intergenic
1053741374 9:41142473-41142495 GTGCATATAGACAGATATATAGG + Intronic
1054346586 9:63971976-63971998 GTGCATATAGACAGATATATAGG + Intergenic
1054444363 9:65298625-65298647 GTGCATATAGACAGATATATAGG + Intergenic
1054485909 9:65722880-65722902 GTGCATATAGACAGATATATAGG - Intronic
1054686975 9:68288821-68288843 GTGCATATAGACAGATATATAGG - Intronic
1186123579 X:6388470-6388492 GTGCTAATTCAGAAATATGTTGG - Intergenic
1188614672 X:32142993-32143015 ATGCAAATCCAGAGATAGGATGG - Intronic
1188890734 X:35608905-35608927 ATACAAATTCATAGATATATAGG + Intergenic
1189584977 X:42450325-42450347 GGGCATATCCAGATATATAAAGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190378263 X:49812607-49812629 GTACTAATCCTGAGATATTTCGG - Intergenic
1194717265 X:97301617-97301639 TTTCAAATCCAGAGATTTGTGGG + Intronic
1198884578 X:141320393-141320415 GGGCACATCCAGTGATATAGAGG - Intergenic