ID: 1173400435

View in Genome Browser
Species Human (GRCh38)
Location 20:42721516-42721538
Sequence TTGTCCAACCAGAAGCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 322}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173400435_1173400442 30 Left 1173400435 20:42721516-42721538 CCCTCAGGCTTCTGGTTGGACAA 0: 1
1: 0
2: 4
3: 55
4: 322
Right 1173400442 20:42721569-42721591 ACAAACAAAGAAGCAGGTTAGGG 0: 1
1: 0
2: 2
3: 56
4: 606
1173400435_1173400441 29 Left 1173400435 20:42721516-42721538 CCCTCAGGCTTCTGGTTGGACAA 0: 1
1: 0
2: 4
3: 55
4: 322
Right 1173400441 20:42721568-42721590 CACAAACAAAGAAGCAGGTTAGG 0: 1
1: 0
2: 1
3: 39
4: 443
1173400435_1173400440 24 Left 1173400435 20:42721516-42721538 CCCTCAGGCTTCTGGTTGGACAA 0: 1
1: 0
2: 4
3: 55
4: 322
Right 1173400440 20:42721563-42721585 ACGGACACAAACAAAGAAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 276
1173400435_1173400438 5 Left 1173400435 20:42721516-42721538 CCCTCAGGCTTCTGGTTGGACAA 0: 1
1: 0
2: 4
3: 55
4: 322
Right 1173400438 20:42721544-42721566 TACACAGCCATGCTGAGAAACGG 0: 1
1: 0
2: 0
3: 20
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173400435 Original CRISPR TTGTCCAACCAGAAGCCTGA GGG (reversed) Intronic
900280857 1:1867314-1867336 TTGTCCAACCTGAGGCCTGTGGG - Intronic
900426650 1:2583404-2583426 TTGTCCACTCAGTAGCATGAAGG - Intergenic
900831659 1:4969868-4969890 TTTTCCAACAAGAAGGCTGCTGG + Intergenic
901309391 1:8257511-8257533 TTTCCCAACCACAAACCTGACGG - Intergenic
901926587 1:12570229-12570251 TTGTACGAGGAGAAGCCTGAAGG - Intronic
901949033 1:12726691-12726713 TCTTCCAACCAGAAGCCCCAAGG + Exonic
902927451 1:19705620-19705642 TTGTCCAACCAGTGGCCTGCTGG - Intronic
903845526 1:26277824-26277846 TTGTTCTCCCAGAAGCCTCAGGG + Exonic
904390114 1:30179255-30179277 GGGTCCAAACAGAGGCCTGAAGG - Intergenic
905926591 1:41754299-41754321 TTCACCACCCAGAAGCCAGAGGG - Intronic
907161893 1:52376802-52376824 TTGTCCCAGCAGCAGCCCGAAGG - Intronic
909389155 1:75098504-75098526 TTGTCCAACCCACAGCCTGTGGG + Intergenic
909782927 1:79570337-79570359 TTATCCCACCAGAAGGGTGAGGG + Intergenic
910160400 1:84266341-84266363 TTGTCCAACCTGCAGCCTGTGGG - Intergenic
910992152 1:93067497-93067519 TGACCCAACCAGAAGCCAGAGGG - Intergenic
911191072 1:94949002-94949024 TTGTCCAACCCGCAGCCTGCGGG + Intergenic
911462287 1:98206044-98206066 TTGTCCAACCTGCAACCTGTGGG + Intergenic
911749522 1:101480566-101480588 TTGTCCAACCTGCAGCCTGTGGG + Intergenic
911906568 1:103576679-103576701 TTATCTAAACAGAAGCATGATGG + Intronic
912878688 1:113388700-113388722 AAGTCCAACCAGACGCCAGAGGG - Intergenic
912939939 1:114035881-114035903 TTGTCCAACCTGCAGCCTATGGG - Intergenic
915617381 1:157049591-157049613 TTGTCCAACCTGGGGCCTGCAGG + Intergenic
915796316 1:158738151-158738173 TTGTCCAACCCACAGCCTGCAGG - Intergenic
916347549 1:163811091-163811113 TTGTCCAACATGCAGCCTGCAGG + Intergenic
916620018 1:166487072-166487094 GTGTCCAAACAGAGGCCTGGAGG + Intergenic
919601041 1:199622378-199622400 TTGGCCTAGCAGACGCCTGAAGG + Intergenic
921372160 1:214435060-214435082 TTGTGCAACCCGCAGCCTGCGGG - Intronic
921472444 1:215565822-215565844 TTGTCCAACCTGCAGCCCCATGG + Intergenic
923828102 1:237522397-237522419 TTGTCCAACACGCAGCCTGCGGG - Intronic
924416877 1:243865087-243865109 TTGTCCAACCCGCGGCCTGAGGG - Intergenic
1062977589 10:1696869-1696891 TTGTCCAACCTGCAGCCTATGGG + Intronic
1063151140 10:3337494-3337516 GTGTCCAACCCGCAGCCTGTGGG - Intergenic
1063536294 10:6886933-6886955 TTGTCCAACCCGCAGCCTGCAGG + Intergenic
1064589400 10:16873143-16873165 CTTTCCATACAGAAGCCTGATGG - Intronic
1065414609 10:25470890-25470912 TTTTCCACCCAGTAGCCAGAGGG + Intronic
1066359483 10:34716536-34716558 TTGTCCAACCTGCAGCCCCATGG + Intronic
1066443312 10:35459300-35459322 TTGTCCAGCCTGCAGCCTGCAGG + Intronic
1067582516 10:47454490-47454512 TTGTCCAACCAGATGCCAAAGGG + Intergenic
1071208404 10:83310822-83310844 TTGTAGCACCAGAATCCTGAGGG - Intergenic
1071555012 10:86594795-86594817 TTGTCCAACCAGAGGCCCGCAGG + Intergenic
1071619421 10:87105581-87105603 TTATCTAACAAGAAGTCTGAAGG + Intronic
1071802799 10:89083299-89083321 TTTCCCAAACTGAAGCCTGATGG - Intergenic
1072443506 10:95477976-95477998 TTGTCCAACCCAAGGCCTGCAGG - Intronic
1075491482 10:122874721-122874743 TTGTCCAACCTACAGCCTGCGGG + Intronic
1076757026 10:132577862-132577884 TTCTCAAACCAGGAGTCTGACGG - Intronic
1078061341 11:8047009-8047031 TTGTCCACCCTGCAGCCTGCAGG - Intronic
1078859500 11:15234211-15234233 TTATCCAACCAGGCCCCTGATGG + Intronic
1078892356 11:15568575-15568597 TTGTCCAACCTGCAGCCTGTGGG - Intergenic
1080207233 11:29744244-29744266 GTGTGCAGCCAGAAGCCTGGGGG + Intergenic
1080703183 11:34663081-34663103 TTGTCAACCCAGGAGCCAGATGG - Intergenic
1080755519 11:35193339-35193361 TTGTCCAACCCGTAGCCTGTGGG - Intronic
1081270776 11:41079678-41079700 TTGTCCAACCAGTGGCCTATGGG + Intronic
1082017989 11:47506517-47506539 TTGTCCAACCCGCAGCCTGTGGG - Intronic
1083778805 11:64907557-64907579 CTGTCGTGCCAGAAGCCTGAGGG + Exonic
1084065938 11:66704569-66704591 TGGTCCCACTAGGAGCCTGAGGG + Intronic
1084660696 11:70544788-70544810 TTGTGGCATCAGAAGCCTGAGGG - Intronic
1084925427 11:72507596-72507618 TTGTCCAACCTGCAGCCTGCTGG + Intergenic
1085781134 11:79410133-79410155 TTGTCCAACCCGCAGCCTGCAGG - Intronic
1086229987 11:84556623-84556645 TTGTCCAACCTGCGGCCTGTGGG - Intronic
1086480815 11:87236451-87236473 TTGTTCAACCTGCAGCCTGCAGG - Intronic
1086851229 11:91811337-91811359 TTTTAGAACCAGAAGTCTGAAGG + Intergenic
1088299560 11:108341987-108342009 TTGTCCAACCCACAGCCTGCAGG + Intronic
1089102239 11:115973291-115973313 TTGTCCAACCTACAGCCTGGGGG - Intergenic
1089406475 11:118201851-118201873 TTGTCTAACTAGATGCCTGGGGG - Intronic
1090156739 11:124446218-124446240 TTGTGCCACCAGAAGTCTGAGGG - Intergenic
1091458945 12:629507-629529 TTGTCCAACCCACAGCCTGTGGG + Intronic
1092343476 12:7696128-7696150 TTGTCCAACCTGCGGCCGGAGGG + Intergenic
1092397412 12:8140107-8140129 TTGTCCAACCTGTAGCCTGCAGG + Intronic
1093368850 12:18340379-18340401 TTGTCCAACCTGCGGCCTGTGGG - Intronic
1093659765 12:21742184-21742206 TTGTCCAACCTGCAGCTTGCAGG + Intronic
1095202664 12:39402647-39402669 TTGTCCAACCTGCAGCCTGTAGG + Intronic
1095700550 12:45186775-45186797 TTGTCCAACCCACAGCCTGCAGG - Intergenic
1097243528 12:57592150-57592172 TTGACCAAAGAGAAGGCTGAGGG + Intronic
1097830363 12:64218010-64218032 TTGTCCAACCTGTGGCCTGCGGG - Intronic
1097856891 12:64472874-64472896 TTGTCCAACCTGCAGCCTGTGGG - Intronic
1097959713 12:65520574-65520596 TTCTCCACCCAGCAGCCAGAGGG + Intergenic
1098147268 12:67510560-67510582 TTGTCCTACTAGAAACCTCAGGG - Intergenic
1098198650 12:68030447-68030469 TTGGTCAATCAGAAACCTGAAGG + Intergenic
1099453062 12:82831224-82831246 TGGTCAAACCAGAAGGCAGAAGG - Intronic
1099495471 12:83340693-83340715 TTGTCCAACCAAGACCATGAAGG + Intergenic
1103219217 12:119229586-119229608 TTGTCCAACCCGCAGCCCGTGGG + Intergenic
1103590726 12:121990317-121990339 TTGCCCACCCATAGGCCTGAAGG - Intronic
1105388112 13:19950911-19950933 TTGTCCAACCAGTGGCCAGGAGG + Intergenic
1105736038 13:23271506-23271528 TTGTCCAACCTGTAGCCCGCCGG - Intronic
1105949051 13:25213245-25213267 TTGTTCAACCTGCAGCCTGCAGG + Intergenic
1106549049 13:30755714-30755736 TTGTCCAACCCGGAGCCTGCGGG - Intronic
1107871614 13:44751605-44751627 TTGTCCAACCTGTGGCCTGTGGG - Intergenic
1107946659 13:45422886-45422908 GTGTCCAAACTGAGGCCTGATGG - Intergenic
1109584928 13:64387117-64387139 TTGTCCAACCTGAGGCCCGTGGG - Intergenic
1109744328 13:66602295-66602317 TTGTCCAACCCACAGCCTGTGGG - Intronic
1110357209 13:74580741-74580763 TTGTCCAACCCGTGGCCTGCAGG - Intergenic
1111520088 13:89390103-89390125 TTGTCCAACCTGCAGCCTGCAGG + Intergenic
1112308003 13:98292727-98292749 TTGTCCAGCCCAAAGCCTGAGGG + Intronic
1112429538 13:99338428-99338450 TTGTTCAACCTGAGGCCTGTGGG - Intronic
1112478977 13:99756502-99756524 TTGTCCAACCTGTGGCCTGTGGG + Intronic
1117504689 14:56390391-56390413 TTGTTCAACCCGCAGCCTGCAGG + Intergenic
1117847892 14:59932818-59932840 TTCTCCACACAGAAGCCTGATGG + Intronic
1118079940 14:62347187-62347209 TTGTCCAACCTGCAGCCCGTGGG - Intergenic
1119678092 14:76571324-76571346 TTGTCCAACCTGTGGCCTGCGGG + Intergenic
1120549494 14:85851978-85852000 TTGTCCAACCACATGTCTGTGGG - Intergenic
1122194689 14:100076214-100076236 TAGCCCAACCAGCAGCCTGGTGG - Intronic
1124235437 15:27985483-27985505 TTGTCTAACCAGAATACCGATGG - Intronic
1124485559 15:30111931-30111953 TTGTCCAACCCGCAGCCCGTGGG - Intergenic
1124518017 15:30385336-30385358 TTGTCCAACCCGCAGCCCGTGGG + Intronic
1124540636 15:30580917-30580939 TTGTCCAACCCGCAGCCCGTGGG - Intergenic
1124758019 15:32426665-32426687 TTGTCCAACCCGCAGCCCGTGGG + Intergenic
1126888559 15:53179128-53179150 TTCCCCAACCAGAAGCCAGAGGG - Intergenic
1126929762 15:53634585-53634607 TTGTCCAACCTGCAGCCTATGGG - Intronic
1127246966 15:57187606-57187628 TTGTCCAACCCACAGCCTGTGGG - Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129649950 15:77477990-77478012 TTGTACAATCAGAAGCCTGAGGG - Intronic
1129876048 15:78976483-78976505 TTGTCCAACCCGTGGCCTAAGGG - Intronic
1131861246 15:96655762-96655784 TTGTCCAACCTGCAGCCCGTGGG - Intergenic
1133679898 16:8111060-8111082 TTGTTCAACCTGCAGCCTGTGGG - Intergenic
1135043800 16:19137936-19137958 TTGTCCAACCCACAGCCTGTGGG + Intronic
1135872244 16:26161736-26161758 TTGTCCAACCAGAGGCCCGCAGG - Intergenic
1135977454 16:27118269-27118291 TTGTCCAGCCTGCAGCCTGCAGG + Intergenic
1137317785 16:47345673-47345695 TTGTCCAACCTGCAGCCCGTGGG - Intronic
1138485883 16:57343266-57343288 TTGTCCAACCCAAGGCCTGTGGG - Intergenic
1140788539 16:78367312-78367334 TTGTTCAACCTGCAGCCTGTGGG + Intronic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1141401968 16:83756450-83756472 TTGTCCAACCCACAGCCTGTGGG + Intronic
1141871694 16:86790859-86790881 TGGCCCAGCCAGAAGCCTGCGGG - Intergenic
1142394430 16:89823684-89823706 TTGTCCAACCCGCGGCCTGTGGG + Intronic
1143069468 17:4278526-4278548 TTGTCCAGCCTGCAGCCTGCGGG - Intronic
1143667983 17:8375419-8375441 TTGTCCAACCTGTGGCCTGTGGG + Intronic
1144831139 17:18131790-18131812 TTGGCCAAGCAGGTGCCTGAAGG - Intronic
1145099688 17:20064248-20064270 TTGCACATCCAGAACCCTGATGG + Intronic
1146017270 17:29244048-29244070 TTGTCCAACCGGCAGCCTGCAGG + Intergenic
1146204116 17:30886925-30886947 TTCTCCAACCTGAACACTGAAGG - Intronic
1147454877 17:40530924-40530946 CTGTCCAAGCAGAGGTCTGAAGG + Intergenic
1149525855 17:57355240-57355262 ATGTGCATCCAGAATCCTGACGG - Intronic
1150316369 17:64172479-64172501 ATGCCCAACCAGAAGCTGGAGGG - Intronic
1150943088 17:69714552-69714574 TTGTCCAACCTGTGGCCTGAGGG - Intergenic
1152933176 17:83120791-83120813 TTGTCTAACCAGAATGATGAGGG + Intergenic
1153954573 18:10085461-10085483 TTATCCACCCAGGAACCTGATGG - Intergenic
1154426012 18:14272547-14272569 GTTTCCAAACAGAAGCCTGCTGG - Intergenic
1155037833 18:22040129-22040151 TTGTCCAACCTGCAGCCTGAGGG + Intergenic
1155676534 18:28436016-28436038 TTGTCCAACCTGTGGCCTGCAGG + Intergenic
1155880152 18:31136780-31136802 TTGTCCAACCTGTGGCCTGCAGG - Intronic
1157052193 18:44179353-44179375 TTATCCAACCTGAAGCCTAAAGG - Intergenic
1157526211 18:48384542-48384564 TTGTCCAACCCACAGCCTGTGGG + Intronic
1159020086 18:63136132-63136154 ATGTCCAGACAGAAGCCTGATGG - Intronic
1159115634 18:64109872-64109894 TTGTCCAACCTGTGGCCTGTGGG + Intergenic
1159955118 18:74513552-74513574 TTGTCCACCAAAGAGCCTGAGGG - Exonic
1164634092 19:29780099-29780121 TTCTCCACCCAGCAGCCTGGGGG + Intergenic
1165265671 19:34661725-34661747 TTGTCCAACCTGCGGCCTGCAGG + Intronic
1166875233 19:45892864-45892886 TTTTTCCACCAGCAGCCTGAGGG + Intronic
925750191 2:7082763-7082785 TTGTCCAACCAGTGGCCCGTAGG - Intergenic
928081925 2:28319512-28319534 TTGTCCAGCTAGAACCCTGAGGG - Intronic
928467172 2:31532966-31532988 TTGTCCAACCCACAGCCTGTGGG + Intronic
928916041 2:36471817-36471839 TTGTCTAACCTGCAGCCTGCGGG - Intronic
929230522 2:39555499-39555521 TTGTCCAACCCGCGGCCTGCAGG + Intergenic
929543346 2:42839231-42839253 TTGTCCAACCTGCAGCCTATGGG - Intergenic
930383563 2:50662483-50662505 TTCTCCAACCAGCAACCTGTAGG + Intronic
930906058 2:56569373-56569395 TTGTCCAACCCGCAGCCTTCAGG - Intergenic
931667363 2:64618925-64618947 TTGTCCAACCTGTGGCCTGCAGG + Intergenic
932222201 2:70008531-70008553 TTGTCCAACCCACAGCCTGTGGG + Intergenic
934484138 2:94686835-94686857 TTGTCCAACCCGCAGCCCAAAGG + Intergenic
934489239 2:94747932-94747954 TTGTCCAACCTGCAGCCTGTGGG + Intergenic
935229948 2:101087159-101087181 TTGTCCAACCTGTGGCCTGCTGG - Intronic
935600157 2:104914511-104914533 TTGCCCAACCAGAACCCTCTTGG + Intergenic
936052736 2:109237496-109237518 TTGTCCAACCCGCGGCCTGCAGG + Intronic
937192081 2:120112014-120112036 TTCTCCAATAAGAAACCTGATGG - Intronic
937225868 2:120368414-120368436 ATGGCCACCTAGAAGCCTGAGGG + Intergenic
937937971 2:127261197-127261219 TAGTCTAACCAGAAGCCAAATGG + Intronic
940179232 2:150913676-150913698 ATGTCCAAGCAGTAGCCTGTTGG - Intergenic
940456958 2:153913419-153913441 CTGTCCAACCTGAACTCTGAAGG - Intronic
940726061 2:157337888-157337910 TTTTCCATCCAAAATCCTGAGGG + Intergenic
940940046 2:159549698-159549720 TTGTCCAACCTGTGGCCTGTGGG - Intronic
941379009 2:164768322-164768344 TTGTCCAACCTGTGGCCTGCAGG + Intronic
942872643 2:180753810-180753832 TTGTCCTATCAGAGCCCTGAGGG + Intergenic
944110756 2:196129314-196129336 TTGTTGAACCAGAAACCAGATGG - Intergenic
944432382 2:199647104-199647126 GAGTCCAACCAGAAGCCAGAGGG - Intergenic
946045674 2:216819012-216819034 GAATCCAACCAGAAGCCAGAGGG + Intergenic
946186616 2:217984326-217984348 TTGTCCAACCTGCAGGCTGCAGG + Intronic
946471251 2:219963368-219963390 TTGTCCAACCCACAGCCTGTGGG + Intergenic
947030332 2:225785062-225785084 TTGTCCAACCCGCAGCCTGCGGG + Intergenic
948093053 2:235311873-235311895 TTGTCCAACCCACAGCCTGCAGG + Intergenic
948114488 2:235484327-235484349 TTGTCCAACCCCCGGCCTGAGGG - Intergenic
948452972 2:238089540-238089562 TTGTCCAACCTGCGGCCTGCAGG + Intronic
948789141 2:240368334-240368356 TTGTCCAACCCGAGGCCCGTGGG - Intergenic
948934252 2:241151964-241151986 TTGGCCAAAGTGAAGCCTGAGGG - Intronic
1168903828 20:1388715-1388737 TTGTCCACACAGTAGCCAGAAGG + Intronic
1170539035 20:17369791-17369813 TTGTCCAACAAGAACCCAAATGG - Intronic
1171027345 20:21642811-21642833 TTGTCTAACAGGAAGCCTCAGGG - Intergenic
1172997716 20:39083423-39083445 TAGTTCAACCAGGAGCCAGAGGG + Intergenic
1173372419 20:42448957-42448979 TTGTCCAACCAGCAGCCCCTGGG - Intronic
1173400435 20:42721516-42721538 TTGTCCAACCAGAAGCCTGAGGG - Intronic
1173597285 20:44267046-44267068 TTGTCCAACCTGCAGCCCGCGGG - Intronic
1173634039 20:44539337-44539359 TTGTCCAATCCGCAGCCTGTGGG + Intronic
1174541215 20:51291191-51291213 TTGTCCAACCCACAGCCTGCAGG - Intergenic
1175071961 20:56342466-56342488 TTGTCCAACCCACAGCCTGAGGG + Intergenic
1175532062 20:59680568-59680590 TTGTCCAACCCAAGGCCTGTGGG + Intronic
1176848747 21:13896836-13896858 GTTTCCAAACAGAAGCCTGCTGG + Intergenic
1177245280 21:18515187-18515209 TTGTCCAACCCACAGCCGGAGGG + Intergenic
1177337431 21:19749446-19749468 TTGTCCCACTAGAAGTCTGCAGG - Intergenic
1177529430 21:22340738-22340760 GTGTCCAGGTAGAAGCCTGAAGG - Intergenic
1177621201 21:23596678-23596700 TTCTCCAAGAAGTAGCCTGAAGG + Intergenic
1178049167 21:28729733-28729755 TTGTCCAACCCACAGCCTGTGGG - Intergenic
1180392138 22:12293974-12293996 TTGTCCAACCAATGGCCTGTGGG + Intergenic
1180407609 22:12570797-12570819 TTGTCCAACCAATGGCCTGTGGG - Intergenic
1180673502 22:17571242-17571264 TTGTCCCTCCGGATGCCTGAGGG - Intronic
1180968894 22:19804680-19804702 TTTTCCATCCCCAAGCCTGAGGG - Intronic
1181395674 22:22619483-22619505 TTGTCCAGCCTGCAGCCTGCAGG - Intergenic
1181756531 22:25028549-25028571 CTGCCCACCCAGAAGCCTGCGGG + Exonic
1182244010 22:28940813-28940835 TATTGCAGCCAGAAGCCTGATGG + Intronic
1182364676 22:29770454-29770476 TTGTCCAACCCGTGGCCTGCAGG - Intergenic
1182881596 22:33738536-33738558 CTGCCCAACCAGGAGGCTGAGGG - Intronic
1183992178 22:41604825-41604847 TTGTCCAACCTGCAGCCTGTGGG - Intronic
1185225568 22:49649943-49649965 CTGTCCATCCAGCCGCCTGACGG + Intronic
949634287 3:5965958-5965980 TTGTCCAACCTGCAGCCCAAGGG - Intergenic
950150460 3:10682828-10682850 TTGTCCCATCAGAAGCCGGTGGG - Intronic
952484204 3:33793194-33793216 TTTTCCAACGAGAACCCTGGTGG + Intergenic
953188898 3:40665016-40665038 TTGTCCATCCAGATGTCTGTTGG + Intergenic
954305281 3:49722343-49722365 ATGTCCATCCAGAAGCCTGTAGG + Exonic
956020252 3:64926284-64926306 TAGTCCAACCAGAGGCATGTAGG + Intergenic
958810038 3:98850434-98850456 TTGTCCAACCTGTGGCCTGCAGG - Intronic
959475271 3:106803357-106803379 TTGTCCAACCCAAGGCCTGTGGG + Intergenic
959574745 3:107922484-107922506 TTGTCCAACCTGCAGCCCAAGGG - Intergenic
959576417 3:107939138-107939160 TTGTCTGTCCTGAAGCCTGATGG + Intergenic
959922715 3:111886345-111886367 TTGTCCAACCTGTGGCCTGTGGG + Intronic
960311498 3:116121780-116121802 TTGTCCAACCCGCACCCTGTAGG + Intronic
960769322 3:121174789-121174811 TTCTCCAGCAAGAACCCTGAAGG - Intronic
960836242 3:121909717-121909739 TTGTCCAACCTGCAGCCTGCAGG + Intronic
962270622 3:133975491-133975513 TTCTCCACCCAGCAGCCAGAAGG + Intronic
962545544 3:136430721-136430743 TTGTCCAACCTGTGGCCTGCAGG - Intronic
962665843 3:137652759-137652781 TGTTCCAACAAGAATCCTGATGG - Intergenic
963024500 3:140905477-140905499 TTGTCCAACTTGCAGTCTGAGGG + Intergenic
963933294 3:151026562-151026584 TTGTTCAACCAGTGGCCTGTGGG - Intergenic
964020662 3:152006444-152006466 TTGTCCAACCTGCGGCCTGTGGG + Intergenic
965723249 3:171685025-171685047 TTGTCCAACCCACAGCCTGTGGG + Intronic
966139285 3:176736374-176736396 TTGTCCAACCTACAGCCTGTGGG + Intergenic
967794517 3:193585028-193585050 TTGTCCATCCTGCAGCCTGCAGG + Intronic
968336364 3:197916984-197917006 TTGTCCAACCTGTAGCCCGCAGG - Intronic
969435524 4:7187012-7187034 ATGTCCAACCAGAAGACGGAGGG - Intergenic
969482918 4:7456451-7456473 TTTCCCACCCATAAGCCTGAAGG + Intronic
970911052 4:21276049-21276071 TTGTCCAACCTGCTGCCTGCAGG - Intronic
971775517 4:30959617-30959639 TTTTTCTTCCAGAAGCCTGATGG + Intronic
972259619 4:37395270-37395292 TTGTACAACCAGCATACTGAAGG + Intronic
972259722 4:37396075-37396097 TTGTACAACCAGCATACTGAAGG - Intronic
972378731 4:38498990-38499012 TTGTCCAACCCGCAGCCTGTGGG + Intergenic
972457228 4:39266472-39266494 TTGTCCAACCCACAGCCTGCAGG - Intronic
973256559 4:48119128-48119150 TAATCCAACCAGAACCCAGAGGG + Intronic
974624087 4:64399804-64399826 GTGTCCAAGCAAAAGCCTGATGG + Intronic
975003391 4:69255166-69255188 TTATCCAACCTGCAGCCTCAGGG - Intergenic
975011678 4:69362529-69362551 TTCTCCAACCTGCAGCCTGAGGG - Intronic
975116150 4:70683438-70683460 TTGTCCAACCCACAGCCTGCAGG + Intronic
975867709 4:78741450-78741472 TTCTCCAATAAGAAGCTTGACGG - Intergenic
977185776 4:93933522-93933544 TTGTCCAACCTGTGGCCTGCAGG - Intergenic
979808984 4:125012026-125012048 ATGTACACCCAGAAGCCAGAGGG - Intergenic
982693484 4:158573395-158573417 TTGTCCAACCCGCAGCCTGCAGG + Intronic
982703077 4:158677424-158677446 TTGTCCAACCTGCAGCCTATGGG - Intronic
983503554 4:168527785-168527807 TAGCCCAACCGGAAACCTGAAGG - Intronic
984158248 4:176220122-176220144 TTGTCCAACCTGCGGCCTGTGGG - Intronic
984253021 4:177357276-177357298 TTGTCCAACCATAGGCTTGTGGG + Intronic
984429514 4:179629818-179629840 AAGCCCAGCCAGAAGCCTGAGGG + Intergenic
984687668 4:182689753-182689775 TTGTCAAACCTGAGGCCTGTGGG + Intronic
984723050 4:182994373-182994395 TTGTCCAACCCACAGCCTGCAGG + Intergenic
985432772 4:189897400-189897422 TTGTCCAACCTGTGGCCTGTGGG - Intergenic
985922880 5:2993288-2993310 TTGTCCAACCCACAGCCTGTGGG - Intergenic
986173179 5:5330369-5330391 TTGTTCAACCCGAGGCCTGCGGG - Intergenic
986623580 5:9702719-9702741 TTGTCAAACCAGAAGACATAAGG + Intronic
987253822 5:16127835-16127857 CCGTTCAACCAGAAGCCAGAGGG - Intronic
987446103 5:18021517-18021539 TTGTCCAAGCTGAAGTCTAATGG - Intergenic
987674248 5:21053513-21053535 TTCTCCAAGCAGAAGCCTGAGGG - Intergenic
988544969 5:32146993-32147015 TTGTCCAACCCGTGGCCTGTGGG - Intronic
991412814 5:66361758-66361780 TTGTCCATCCCGCAGCCTGTGGG + Intergenic
991570016 5:68043952-68043974 TTGTCCAGCCCGCAGCCTGTGGG + Intergenic
992240431 5:74764398-74764420 TTGTCCAACCCGTGGCCTGCAGG + Intronic
992440815 5:76796172-76796194 TTTACCAACAAGAAGACTGAGGG + Intergenic
992916721 5:81462268-81462290 TTGTCCAACCTGTGGCCTGTGGG - Intronic
993816696 5:92557236-92557258 TTGTCCAACCTGCGGCCTGTGGG - Intergenic
994082540 5:95723286-95723308 TTGTCCAACCTGTGGCCTAAGGG - Intronic
994496399 5:100518242-100518264 TTGTCCAAGCATAAACCTGGGGG - Intergenic
994996695 5:107072688-107072710 TTGTCCAACCCACAGCCTGTGGG - Intergenic
995033050 5:107500919-107500941 TTGTTCATCCTGAAGCCTGCAGG + Intronic
996449997 5:123610125-123610147 TACTCCAACCAAAAGCCTGCAGG - Intronic
996563436 5:124855210-124855232 TTGTCCAACCAGCTGCCCAAGGG - Intergenic
996650190 5:125866471-125866493 TTGTCCAACCCACAGCCTGCAGG + Intergenic
996772723 5:127101814-127101836 CTTTCCAACCAGAAGCCTAAAGG - Intergenic
997185855 5:131881161-131881183 TTAGCAAACCAGAAACCTGAAGG - Intronic
997454617 5:134007509-134007531 TTGACCCACCACAACCCTGAGGG + Intergenic
997606864 5:135181315-135181337 TTGTCCAACCCGTGGCCTGCAGG + Intronic
1000599828 5:163259269-163259291 TTGTCCAACCCGCAGCCTGTGGG + Intergenic
1002783099 6:382038-382060 TTGTACACCCCGAAGCCTGCCGG - Intergenic
1003329110 6:5114838-5114860 TTGTCCAACCCACAGCCTGCGGG - Intronic
1004296122 6:14412966-14412988 TCGGCCCAGCAGAAGCCTGAGGG + Intergenic
1004380035 6:15124771-15124793 TTGTCCAACCTGTGGCCTGCAGG - Intergenic
1004780710 6:18905575-18905597 AAATCCAACCAGAAGCCTGAGGG - Intergenic
1004817172 6:19324574-19324596 TGGTCCAGCCAGAAGACTGCTGG + Intergenic
1006118607 6:31790200-31790222 TTGTCCAACCTGCAGCCTGTGGG - Intronic
1006701025 6:35973445-35973467 TTGTCCAACCTGAGGCCTGCGGG + Intronic
1007182800 6:39942528-39942550 GACTCCAAACAGAAGCCTGAAGG - Intergenic
1007189785 6:40003693-40003715 TAACCCAACCAGAAGACTGATGG - Intergenic
1008390328 6:50943442-50943464 TTGTCCAACACGCAGCCTGAGGG - Intergenic
1008394405 6:50990298-50990320 TTGTCCAACCCACAGCCTGTGGG + Intergenic
1008641436 6:53466575-53466597 TTGTCCAACCCCCAGCCTGCAGG + Intergenic
1009658017 6:66570484-66570506 TTGTCCAACTCGAGGCCTGAAGG - Intergenic
1009885125 6:69616483-69616505 TGGTTCATGCAGAAGCCTGATGG - Intergenic
1010486651 6:76422408-76422430 TTGTCCAACCTGCGGCCTGAGGG - Intergenic
1011834384 6:91412723-91412745 TTGTCAAACCTGCAGCCTGTAGG + Intergenic
1012577801 6:100825168-100825190 TTGTCCAACCCGTGGCCTGTGGG + Intronic
1014108013 6:117589151-117589173 TTGTCTAACCCGCAGCCTGTGGG - Intronic
1014693767 6:124593861-124593883 TTGCCAAAACAGAAGCCTGGAGG - Intronic
1015235486 6:130966125-130966147 TTGTCCAACCTGTGGCCTGCAGG - Intronic
1015258459 6:131207262-131207284 TTGTCCTCCTAGAAGCCAGATGG + Intronic
1015681619 6:135814809-135814831 TTGTCCAACCTGCAGCCTGCAGG + Intergenic
1016398853 6:143656521-143656543 TTGCCCAACCTGCAGCCTGTGGG - Intronic
1016996462 6:149965052-149965074 TGGTCCACCCAGAAGCCTCCTGG - Intronic
1017374140 6:153747978-153748000 TTCTCCAACCTGAAACATGAGGG - Intergenic
1018666574 6:166143821-166143843 TTGTCCAACCTGCAACCTGCAGG + Intergenic
1021248963 7:18300085-18300107 TTGTCCAACCTGTGGCCTGCGGG + Intronic
1023678667 7:42659640-42659662 TTGTCCAACCTGCAACCTGAAGG - Intergenic
1026102729 7:67396221-67396243 GTGGCCAGCCAGCAGCCTGATGG + Intergenic
1027763374 7:82307866-82307888 TTGTCCCAGCAAAAACCTGATGG + Intronic
1029188875 7:98758171-98758193 TTGTGCTACTAAAAGCCTGATGG + Intergenic
1029802860 7:102967865-102967887 TTGTCCAGGCACAAGCCTGGGGG - Intronic
1030043165 7:105469962-105469984 TTGTCCAACCTGCAGCCTGCGGG - Intronic
1030108659 7:106008232-106008254 TTGGCCAACTAGAAGCTGGAAGG - Intronic
1030462167 7:109853234-109853256 TTCTCCAAACAGCAGCTTGAAGG + Intergenic
1030715630 7:112803808-112803830 TGGCCCATGCAGAAGCCTGATGG - Intergenic
1031670360 7:124535553-124535575 TTGTCCAACCCACAGCCTGTGGG + Intergenic
1032232155 7:130084263-130084285 TTCTCCAACCAGCAGCTAGAGGG - Intronic
1032317294 7:130850501-130850523 TTGTCCAACCCATGGCCTGAGGG - Intergenic
1032341251 7:131075403-131075425 TTGTCCAACCTGTGGCCTGCAGG - Intergenic
1032685952 7:134233875-134233897 TTGTCCAACCCACAGCCTGCCGG + Intronic
1033284674 7:140030692-140030714 TTGTCCAACCTGCAGCCCGCAGG + Intronic
1033929190 7:146503287-146503309 TTGTCCAACCCGCAGCCTATGGG + Intronic
1034170436 7:149058834-149058856 TTGTCCAACCCTCAGCCTGCAGG - Intergenic
1034745126 7:153517314-153517336 TTATCCAACCTGCAGCCTGCAGG + Intergenic
1034980427 7:155472353-155472375 TTGTCAAACCACAAGCCTAAAGG - Intergenic
1037280851 8:17240258-17240280 TTGTCCAACCTGCAGCCAGTGGG + Intronic
1037596925 8:20361954-20361976 TTGTCTATCCAGAAGCCAGCTGG - Intergenic
1038651521 8:29407928-29407950 TTGTCCAACCTGTGGCCTGTGGG + Intergenic
1039497864 8:37994603-37994625 TTGTCCAACCTGCAGCCTGTGGG - Intergenic
1040516092 8:48136368-48136390 GAGCCCAACCAGAAGCCAGAAGG - Intergenic
1040602730 8:48899931-48899953 CTGTCCAGCCAGAGGCCCGAGGG - Intergenic
1040804621 8:51380223-51380245 TTGTCCAACCTGCAGCTTGTGGG - Intronic
1041229213 8:55731905-55731927 TTGTCCCACCAGCACCATGACGG - Intronic
1041524255 8:58788122-58788144 TTGTCCAATCAGAAGCCTTAGGG + Intergenic
1042008136 8:64205845-64205867 TTGTCCAACCCTCAGCCTGTGGG - Intergenic
1042669378 8:71245127-71245149 TTGCCCAACCTGCAGCCTGCAGG + Intronic
1043714333 8:83462573-83462595 TTGTCCGACCTGCAGCCTGTGGG + Intergenic
1044079370 8:87864899-87864921 TTGTCCAACCTGTGGCCTGTGGG - Intergenic
1045185948 8:99838198-99838220 TTATTCAACCAGAGACCTGAAGG + Intronic
1045261411 8:100578092-100578114 TTGTCCAACCCACAGCCTGCGGG - Intronic
1046764590 8:118056168-118056190 TTGTCCAACCTGTGGCCTGTGGG - Intronic
1049174952 8:141186420-141186442 TTGTCCAACCTGTGGCCTGCAGG + Intronic
1052913814 9:33908283-33908305 TGGGCCAATCAGAAGCCTGGTGG - Intronic
1055587753 9:77773017-77773039 TTGTCCAACCCATAGCCTGTGGG - Intronic
1056145140 9:83721767-83721789 TTGGCCAAACTGAAACCTGATGG - Intergenic
1057788700 9:98108293-98108315 TTATCCAACCTGCAGCCTGTGGG + Intronic
1059609770 9:115879675-115879697 GAGTCTAACCAGAAGCCAGAAGG + Intergenic
1059859802 9:118447206-118447228 TGATTCATCCAGAAGCCTGAAGG - Intergenic
1060183973 9:121552653-121552675 ATGTCTAAGCAGAAACCTGAGGG - Intergenic
1061487004 9:130925087-130925109 TTGTTGGTCCAGAAGCCTGAGGG - Intronic
1061636063 9:131909130-131909152 TGCTCAAACCAGAAGCCTGCAGG - Intronic
1062032238 9:134366909-134366931 TTCTCCCAGCAGGAGCCTGAGGG - Intronic
1062308878 9:135925223-135925245 TTGTGCAACCAGTGGCCTGGCGG + Intergenic
1062401463 9:136374556-136374578 TTGTCCGCACAGAGGCCTGAGGG - Intergenic
1186844977 X:13521827-13521849 TTGTCCAACCCACAGCCTGTGGG + Intergenic
1187210231 X:17223004-17223026 TTATCTAACAAGAAGACTGAGGG + Intergenic
1188379680 X:29476132-29476154 TTAGCCATCCAGATGCCTGAAGG + Intronic
1188509258 X:30916604-30916626 TTGTCAAACCAGAAACTGGAAGG + Intronic
1188680603 X:32999193-32999215 TTGTCCAACCCGCAGCCTACAGG + Intronic
1190149609 X:47933201-47933223 TTGTCCAACCCACAGCCTGCGGG - Intronic
1190339191 X:49282877-49282899 TTTTCCAAGCAGCAGCCAGAGGG - Intronic
1191694673 X:63977727-63977749 TGGCCCAACCCGAAGCCTGGGGG + Intergenic
1192373378 X:70534379-70534401 TTGGGCAACCAGAAGAATGATGG + Intronic
1194601894 X:95931715-95931737 TGGTCTAAGCAGAAGCCTAATGG - Intergenic
1195808074 X:108798000-108798022 TTGTCTTACCAGAAGCATGAAGG + Intergenic
1195943366 X:110183105-110183127 TCGTGTACCCAGAAGCCTGAGGG + Intergenic
1197701517 X:129603731-129603753 TTGTCCAACCAGTGGCCCGTGGG + Intergenic
1198131891 X:133704059-133704081 TTGTCCAACCTGCAGCTTGCAGG - Intronic
1198189631 X:134288968-134288990 TTTTCCAGCCAGAAGCCTCTGGG - Intergenic
1199744978 X:150766816-150766838 TTCTGCAAACAGAAGGCTGAGGG + Exonic
1200157167 X:153983169-153983191 CTGTCCAACCATGAGCATGAGGG - Exonic
1200694901 Y:6350264-6350286 TTATCCAACAACAGGCCTGAGGG - Intergenic
1200750046 Y:6936491-6936513 TTGTTTGATCAGAAGCCTGAAGG - Intronic
1201040376 Y:9824446-9824468 TTATCCAACAACAGGCCTGAGGG + Intergenic
1202047079 Y:20746016-20746038 TGGTCAAACCAGAAGAGTGAAGG + Intergenic