ID: 1173401149

View in Genome Browser
Species Human (GRCh38)
Location 20:42727098-42727120
Sequence AAGACTGCCCTGCTGCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173401146_1173401149 22 Left 1173401146 20:42727053-42727075 CCAGAGTATCTCTGATCACGACG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG 0: 1
1: 0
2: 2
3: 17
4: 174
1173401148_1173401149 -2 Left 1173401148 20:42727077-42727099 CCATCTTTTTAACATCTTTTGAA 0: 1
1: 1
2: 8
3: 77
4: 835
Right 1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG 0: 1
1: 0
2: 2
3: 17
4: 174
1173401147_1173401149 -1 Left 1173401147 20:42727076-42727098 CCCATCTTTTTAACATCTTTTGA 0: 1
1: 0
2: 5
3: 53
4: 518
Right 1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG 0: 1
1: 0
2: 2
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173401149 Original CRISPR AAGACTGCCCTGCTGCTGAC AGG Intronic
900276508 1:1833054-1833076 AGGACTGCCCTGTTGCTGCTTGG - Intronic
903014349 1:20352211-20352233 AGGAAGGCCCTGCTGCTGAGTGG - Intronic
904852361 1:33468589-33468611 AGGACTGCCCTCCAGCTGGCCGG + Intergenic
906089455 1:43166188-43166210 AAAACTGCCCTCCTACTGAGTGG + Intronic
911163428 1:94704633-94704655 TGGACTGGCCTGCTGCTGCCAGG - Intergenic
911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG + Intergenic
911736641 1:101343638-101343660 AAGACCGCCCTGAGGCTGAATGG + Intergenic
913053958 1:115140518-115140540 AAGCCTGGCCTGCTCTTGACTGG - Intergenic
913519127 1:119629445-119629467 CACACTGCCCTGCTGCCCACTGG - Intronic
916260530 1:162837543-162837565 CAGACTTCCCTACTGCTGCCTGG + Intronic
919055906 1:192569646-192569668 AAGACTGCCCTGCTGGGTTCTGG - Intergenic
922870412 1:228898001-228898023 AAGACTGCCCTGTGGCTTCCAGG + Intergenic
923082166 1:230668377-230668399 TAGCCAGCCCTGCTGCTGTCTGG + Intronic
923084522 1:230693369-230693391 AAGGCTGCTCTGCTGTTGCCTGG - Exonic
1063008167 10:1994719-1994741 AAGAGTGCTCTGCTGCTCCCCGG - Intergenic
1063216143 10:3927306-3927328 GAGCCAGCCCTGCTGCTGAAGGG - Intergenic
1064527479 10:16272652-16272674 AAGATTGGCCTGTTGCAGACAGG - Intergenic
1067354884 10:45514924-45514946 AATACTGACCTGCTGATCACAGG - Intronic
1067815868 10:49476543-49476565 AAGACTGGCTTCCTGCTCACGGG + Intronic
1069798714 10:71069337-71069359 GTGCCTGCCCTGCTGCTGGCTGG + Intergenic
1069832299 10:71288819-71288841 AGGACTGCCGTGCTGCAGGCTGG - Intronic
1070514509 10:77191395-77191417 AAGACTGCCCTGAACCTGACGGG + Intronic
1070573853 10:77662126-77662148 GGGACAGGCCTGCTGCTGACGGG - Intergenic
1070748647 10:78950898-78950920 AAGACCTTCCTGCTGCTCACAGG + Intergenic
1072298082 10:94031584-94031606 AATACTGCCCTTCTGCTGTCAGG - Exonic
1072609839 10:97010829-97010851 AAGGCTGCACAGCTGGTGACTGG + Intronic
1073181885 10:101588379-101588401 AAGACTGCGCTGCTGCAGGACGG + Exonic
1074453984 10:113581739-113581761 GAGACTGCACTGGTGCAGACAGG - Intronic
1075329882 10:121566389-121566411 GAGACTGCCTTGCAGCTGTCTGG - Intronic
1075591992 10:123698701-123698723 AAGACAGCACTGAGGCTGACTGG - Intergenic
1075814233 10:125252543-125252565 CAGAATGCCCTGCTGCTCCCAGG + Intergenic
1075844047 10:125530682-125530704 AACTCTGCCCTGCTGCTGACAGG - Intergenic
1078089165 11:8253255-8253277 AAGCTTGCCCTGCTCCAGACAGG - Intronic
1079082785 11:17425472-17425494 AAGCTTGCCCTTCTGCTGATTGG + Intronic
1079297334 11:19244904-19244926 CACACAGCCCTGCTGCTGCCTGG - Intergenic
1081613355 11:44576633-44576655 AATCCTGCTCTGCTGCTGCCTGG + Intronic
1083199580 11:61112187-61112209 CAGACTGCCCTGCTCCTGATGGG + Intronic
1083302773 11:61747571-61747593 AAGACTGCCAAGCTGGCGACTGG + Intergenic
1083485309 11:62979769-62979791 ATGGCTGCACTGCTGCTGGCAGG - Exonic
1083835132 11:65261754-65261776 AGAACTGCGCAGCTGCTGACTGG + Exonic
1084231103 11:67753935-67753957 AAGTCTCCCTTGCTGCTGATGGG - Intergenic
1084345827 11:68548213-68548235 AATTCTGACCTGCTGTTGACTGG + Intronic
1085455266 11:76661878-76661900 AGCTCTGCCCTGCTGCTCACTGG - Intronic
1088533660 11:110837298-110837320 AAGGCTGCCCTCTTGCTGATAGG - Intergenic
1088861405 11:113803216-113803238 AATGCTGCCCTGCTGATGAAGGG - Exonic
1089192190 11:116661115-116661137 CCGACTGCCCTGCTGCTCAAAGG + Intergenic
1089844237 11:121445960-121445982 CTGGCTGCCCTGGTGCTGACAGG + Intergenic
1096264549 12:50112484-50112506 AAGACTGACCTACTGCTGCGAGG - Intronic
1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG + Intergenic
1102474314 12:113178983-113179005 AAGACTGCCCTGATCCTGGGTGG - Exonic
1102493070 12:113300569-113300591 AAGACTGGCCTGCAGCAGCCCGG + Intronic
1105007049 12:132727990-132728012 AAAGCTGCCCTGCGGGTGACAGG + Intronic
1105705164 13:22963819-22963841 GAGCCTCGCCTGCTGCTGACGGG + Intergenic
1106343673 13:28855422-28855444 TAGACTGCCCCACTACTGACAGG + Intronic
1109030741 13:57184462-57184484 AGGACTGCCCTGCTGGTTACTGG - Intergenic
1109134147 13:58625772-58625794 CCTTCTGCCCTGCTGCTGACAGG + Intergenic
1112363937 13:98741191-98741213 ATGGCTGCACTGCTGGTGACTGG + Intronic
1112994555 13:105557143-105557165 CAGAATGCCCTGGTGCAGACTGG - Intergenic
1116955032 14:50914600-50914622 AAGCCAGCCCTGCTGCAGACTGG + Intronic
1116955369 14:50917606-50917628 ATGACCGCCCTCCTGCTGGCAGG + Intronic
1119206117 14:72794808-72794830 AATACAGCCCTGCTGATGCCTGG - Intronic
1119669677 14:76508920-76508942 AAGTCTGCCCTGCCACTCACTGG + Intergenic
1119783601 14:77296155-77296177 CTCACTGACCTGCTGCTGACGGG + Exonic
1121970386 14:98350511-98350533 AAGACTGCCTTTCTGATGGCAGG - Intergenic
1123158383 14:106252528-106252550 ATGACTGCCCTGCTGGTGTTTGG + Intergenic
1124205515 15:27715625-27715647 AGCACTGCCCTGTTGCTGATTGG + Intergenic
1124597341 15:31102059-31102081 AACACTGCCCAGCTGATGAGGGG - Intronic
1128094318 15:64942403-64942425 AGGACTGCCCAGCTGCAGGCTGG - Intronic
1128539799 15:68518600-68518622 AAGGGTGCAGTGCTGCTGACTGG - Intergenic
1129125319 15:73435502-73435524 AAGACTGCCACTCTGCTGCCCGG - Intergenic
1129393374 15:75231694-75231716 ACGACTGCCCTGCTCCTAACAGG + Intergenic
1130192222 15:81748406-81748428 CACCCTTCCCTGCTGCTGACAGG + Intergenic
1130836231 15:87652840-87652862 TAGAAAGCCCTGATGCTGACAGG - Intergenic
1131472375 15:92708401-92708423 AGGACTGCCCTCCTCCAGACCGG - Intronic
1132016336 15:98320729-98320751 CAGACTGCCCAGCTACTGTCAGG - Intergenic
1132573049 16:652338-652360 AAGACTGCCCTGGTCCTGGGTGG - Intronic
1136490073 16:30602001-30602023 AACACTGCATTGCTGCTGAGAGG - Intergenic
1137578923 16:49621664-49621686 GTGGCTGCCCTGCCGCTGACGGG - Intronic
1141050240 16:80754991-80755013 AAGCCTGCCCTTCAGCTGAAGGG + Intronic
1141602988 16:85137469-85137491 TGGAGTTCCCTGCTGCTGACAGG + Intergenic
1141979568 16:87541478-87541500 AAGACAGCGCTGCTGGTGAGTGG + Intergenic
1142374104 16:89697943-89697965 GAGGCTCCCCTGCTGCTTACAGG - Exonic
1142741589 17:1934818-1934840 AAGCCGGCCGTGCTGCTGGCCGG - Exonic
1145260264 17:21350572-21350594 ATGGCTGCCCTGCAGCTCACAGG + Intergenic
1148053235 17:44779463-44779485 TCGACTGCCCTGCTGCGGCCAGG + Intronic
1148073147 17:44920373-44920395 AAGACTGCACAGCTACTGAGTGG - Intergenic
1150569617 17:66374438-66374460 CAGACTCCTCTGCTGCTTACAGG + Intronic
1152408977 17:80112501-80112523 AGCTCTGCCCTGCTGGTGACAGG + Intergenic
1154193859 18:12252114-12252136 GTCACTGCCCTGCTGCTGAGTGG - Intergenic
1155071847 18:22324217-22324239 AAGACTGCTCTGCTGGCCACAGG - Intergenic
1156396928 18:36707261-36707283 AAGACCCCCCTGCAGCTGAGGGG - Intronic
1157757626 18:50232598-50232620 AAGACTGCCCTGATGATCAAAGG + Intronic
1160032998 18:75278655-75278677 GAGCCTGGCCTGCTGCTGCCTGG + Intronic
1160087044 18:75786303-75786325 AACACAGCCCTGCTGATGGCTGG - Intergenic
1161389841 19:4015255-4015277 AAGCCTGCCCTGCCGCTCCCAGG - Intronic
1162797805 19:13095617-13095639 CAGACTGCCCTGCTGGGGCCGGG + Exonic
1163304778 19:16471464-16471486 GAGATCGCACTGCTGCTGACGGG + Intronic
1165132109 19:33639425-33639447 AAGGCTGCCCCGATGCTGAGAGG - Intronic
1168319054 19:55498126-55498148 CCGACTGCCCTGCTGCTCCCTGG + Exonic
924997964 2:381404-381426 GAGGCTGCCCTGCTGCTGCCTGG + Intergenic
925449530 2:3956943-3956965 AAGACAGCCCTGTGGCTGGCAGG - Intergenic
927201729 2:20582480-20582502 AAGAGTGCCCTGCAGATGTCTGG + Intronic
929894131 2:45943797-45943819 CAGCCTCCCCTGCTGCTGTCTGG - Intronic
937294110 2:120799386-120799408 AAGACTGCTCTGAAGCTAACAGG - Intronic
941685047 2:168439711-168439733 AAGACAGCCAAGCTGGTGACTGG + Intergenic
942567330 2:177280090-177280112 AAGCCAGCCCTGCTGATGTCTGG - Intronic
945884057 2:215355874-215355896 AAGATTGCCCACCTACTGACTGG - Intergenic
947797267 2:232902344-232902366 AAGACTGCGCTGCAGCGGGCTGG - Intronic
948023045 2:234752998-234753020 AAGACTGCGCTGCAGCAGAGGGG + Intergenic
948602884 2:239117279-239117301 AAGCATGCCCTGCTGCAGACAGG + Intronic
1170408225 20:16062065-16062087 ATGACATCCCTGCTGCTTACTGG - Intergenic
1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG + Intronic
1174772041 20:53309215-53309237 ACGACTGCCCTGTTGCTGTCAGG + Intronic
1175526830 20:59640141-59640163 AATATTGCTCAGCTGCTGACGGG - Intronic
1178428605 21:32499463-32499485 AAGTCTCCCTTGCTGCTGATGGG + Intronic
1180000616 21:44993770-44993792 CATACGGCCCTGCTGCTGGCTGG + Intergenic
1180948112 22:19707938-19707960 AAGACGGGCCTGCAGCTGAATGG + Intergenic
1181010314 22:20036493-20036515 AAGACTACCATGGTGCTGATGGG + Intronic
1181056668 22:20263524-20263546 AAGAATGCCAGGGTGCTGACTGG + Intronic
950335279 3:12188287-12188309 AAGACAGCTCTGCTGCTTGCAGG - Intronic
950535348 3:13575182-13575204 GGGACTTCCCTGCTGCTTACAGG + Intronic
951682588 3:25310001-25310023 AATACTACCATGCTGCTAACAGG - Intronic
955017888 3:55089602-55089624 AACACTGCTCTGCTGCTGACTGG - Intergenic
956058038 3:65321442-65321464 AAGACTCCACAGCTGCTGAGGGG + Intergenic
961030860 3:123602449-123602471 AAAGCTGTCCTGCTGCTGTCCGG + Intergenic
961879725 3:130052951-130052973 AAGTCTCCCTTGCTGCTGATGGG - Intergenic
962341672 3:134590879-134590901 AGGTCTGCCCTGCTCCTGTCTGG + Intergenic
962840062 3:139225265-139225287 AAGACTGCCATGCTTCAGAGGGG - Intronic
964191262 3:154003792-154003814 AAGTCTGCACTGCTGCAGCCAGG + Intergenic
966263131 3:178003668-178003690 AAGACTGCCCAGATGGTGAGTGG + Intergenic
967057697 3:185844100-185844122 ATCACTGCCCTACTGCAGACTGG + Intergenic
967129687 3:186458987-186459009 AATCCTGCTCTGCTGCTTACTGG - Intergenic
967494521 3:190127943-190127965 TGGCCTGCCCTGCTTCTGACAGG + Intergenic
968464283 4:742742-742764 GAGACTGCCCGGCGGCAGACGGG - Intronic
968991931 4:3920060-3920082 AAGTCTCCCTTGCTGCTGATGGG - Intergenic
969823407 4:9737619-9737641 AAGTCTCCCTTGCTGCTGATAGG + Intergenic
971969910 4:33606992-33607014 AAGACTGCCCTGCAGATATCAGG - Intergenic
972312498 4:37893793-37893815 AACACTACTCTGCTGCTGAATGG - Intronic
975900174 4:79141751-79141773 AAGACAGCCCTGCTGTTTCCAGG + Intergenic
979282112 4:118879908-118879930 CAGACCTCCATGCTGCTGACAGG - Intronic
980134083 4:128843870-128843892 AAGGCTGCCCTGCTGTGGAGTGG + Intronic
980734482 4:136867365-136867387 AGGACAGCCCAGCTGCTGAATGG + Intergenic
984656727 4:182326581-182326603 ATGACTGCCCCGCTGCAGTCAGG - Intronic
985785345 5:1890311-1890333 AACACTGCCCTTCTGCTGTCAGG - Intergenic
986173671 5:5333934-5333956 AACTCTGTCCTGCTGCTGAGGGG - Intergenic
986333845 5:6738187-6738209 CAGCCTTCCCTACTGCTGACTGG + Intronic
988460092 5:31427418-31427440 AAAACAGCCCTGCTGTTTACAGG + Intronic
990318308 5:54605119-54605141 AAGTCAGCCCTCATGCTGACTGG - Intergenic
992760531 5:79947605-79947627 AAGATTGGCCTTTTGCTGACTGG - Intergenic
999739079 5:154535549-154535571 AAGGCTGCCTTCCTGCTTACTGG + Intergenic
1001900305 5:175421527-175421549 AAGACAGACCTGCTCCTGATAGG - Intergenic
1001913430 5:175540162-175540184 AAGGCTGCCCTCCTGCAGAGAGG - Intergenic
1002318616 5:178361849-178361871 GAGCCTGCCCGCCTGCTGACTGG - Intronic
1003761364 6:9182066-9182088 AAGGCTGCTCTGCTTCTGAGAGG + Intergenic
1004583879 6:16980512-16980534 AAGAATGGGCTTCTGCTGACCGG - Intergenic
1004881921 6:20017240-20017262 TTGCCTGCCCTGCTGCTGGCTGG - Intergenic
1006361408 6:33589349-33589371 AGGGCTGCCCTGCTGCAGAGTGG + Intergenic
1006548150 6:34796732-34796754 AAGGCTGCCCTGCTGATTAGTGG - Intronic
1007254816 6:40521235-40521257 AAGAGTGCCTTGCTGCTGGCAGG - Intronic
1013584211 6:111564450-111564472 AAAAATGCACTGCTGCTGGCTGG - Intronic
1016440386 6:144077127-144077149 AAGAATGCTCTGCTCTTGACTGG + Intergenic
1018811270 6:167300069-167300091 AAGACAGCCCTGGGGTTGACAGG + Intronic
1019189729 6:170244883-170244905 AGGGCGGCCCTGCTGTTGACAGG - Intergenic
1020314748 7:6897630-6897652 AAGTCTCCCTTGCTGCTGAGGGG - Intergenic
1022104125 7:27186133-27186155 GGGGCTGCCCTGCTGCTCACCGG + Intergenic
1025610549 7:63072663-63072685 AAGACTGCCCTTCGGCTCCCTGG + Intergenic
1031574040 7:123394210-123394232 AAGACTGTCCTGAAGCTGAAAGG + Intergenic
1031805863 7:126305243-126305265 AAAACTGCCATGGTGCTGGCGGG - Intergenic
1033958809 7:146886935-146886957 ACGTCTGCCCTGCTGCTCAGTGG + Intronic
1035975538 8:4306736-4306758 AACACTACCCTGCTGCGGTCGGG - Intronic
1036697984 8:10991273-10991295 AAGTCTGCTCTGGTGCTGATGGG + Intronic
1037902338 8:22695212-22695234 CAGCCTGCCCTGATTCTGACCGG - Intergenic
1038575880 8:28702433-28702455 AGGGCTGCCCGGCTGCTGATGGG + Intronic
1039316139 8:36374698-36374720 CAGGCTGCCCTGCTGCTGAAGGG - Intergenic
1045504205 8:102767174-102767196 AAGAGTGTCCTGCTGTTGGCTGG + Intergenic
1048123519 8:131607840-131607862 AAGAGAGCCCTGCGGCTGAGGGG - Intergenic
1048820734 8:138378348-138378370 AAGACTGCACAGCTGCTGAGGGG - Intronic
1049201756 8:141343774-141343796 AGGACTGCCCCGCTGCTGCCCGG - Intergenic
1049788998 8:144464508-144464530 AAGACTGCCTTGCTGGAGCCTGG - Exonic
1053384581 9:37676780-37676802 CACACTGCCCTGCTGTTGGCAGG + Intronic
1057218864 9:93244906-93244928 TGGGCTGCCCTGCTGCTGAGTGG + Intronic
1057242885 9:93427859-93427881 AAGACTGACCTAATGCTGACTGG - Intergenic
1060261070 9:122073974-122073996 AAGAGTGCCATGATGCTGGCCGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1186062924 X:5730244-5730266 AGGACTGCCATGTTGCAGACTGG + Intergenic
1187072054 X:15898279-15898301 GAGACTGCACTGCTGCAGAGAGG + Intergenic
1187611269 X:20946233-20946255 AAGTCTGCACTGGTGCTGAGAGG - Intergenic
1188114113 X:26223032-26223054 AAGACTTCCCTTTTGCTGACTGG - Intergenic
1188596655 X:31909333-31909355 AAGACTGCTCTGAAACTGACTGG - Intronic
1192588370 X:72339138-72339160 CAGGCTGTCCTGCTGCTGGCAGG + Intronic
1195094558 X:101491897-101491919 AAGACTGGATTGCTGCTGAGCGG + Exonic
1195172915 X:102286375-102286397 AAGATTGCCCTGCTGCGTCCAGG + Intergenic
1195185951 X:102400720-102400742 AAGATTGCCCTGCTGCGTCCAGG - Intronic
1201533846 Y:15023507-15023529 AGGACTGCCATGTTGCAGACGGG - Intergenic