ID: 1173403820

View in Genome Browser
Species Human (GRCh38)
Location 20:42747769-42747791
Sequence GGGTGGGGCATTACAAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173403820 Original CRISPR GGGTGGGGCATTACAAATCA AGG Intronic
900888621 1:5432916-5432938 GGGAGGGGCAATACCAAACATGG - Intergenic
904387572 1:30154070-30154092 GGGTGGGACAATTCAAAGCAGGG + Intergenic
905313329 1:37065604-37065626 TGGTGGGGCATGACCAATCAAGG + Intergenic
905760754 1:40555439-40555461 GGGTTGGGCATTAAAAACTATGG + Intergenic
907419501 1:54337330-54337352 GGGTGGGTTATTGCAAAGCAAGG - Intronic
908634918 1:66153128-66153150 GTGTGGGGCATGAGAAGTCATGG - Intronic
911366961 1:96950205-96950227 GGCAGGGGGATGACAAATCAAGG + Intergenic
913187662 1:116384168-116384190 GCCTGGGGGATTAAAAATCATGG - Intronic
916483422 1:165235781-165235803 GGATTGGGCATTAGAACTCAGGG + Intronic
916720255 1:167479751-167479773 GGAAGGGGCATTCCAAGTCAGGG - Intronic
918902062 1:190434784-190434806 GGCTTGGGTATTATAAATCAAGG - Intronic
919418381 1:197340263-197340285 GAGTGGGGCATTACAAGTAAGGG + Intronic
920876774 1:209843734-209843756 GGGAGGTGCAGGACAAATCATGG + Intronic
1063931941 10:11037347-11037369 GTGGGGGTCATTACAATTCAAGG + Intronic
1063984309 10:11484895-11484917 GGGTGGGGAATGAGAAATCAAGG + Intronic
1064592855 10:16912637-16912659 GGGAGGGGCATTCCAGATGAAGG + Intronic
1068749671 10:60577439-60577461 GGGTGGGAGGTAACAAATCATGG + Intronic
1071214274 10:83380820-83380842 GTGTGGGTCATTCAAAATCAGGG - Intergenic
1072815722 10:98507150-98507172 GGGTGGGACAGGAGAAATCAGGG + Intronic
1073783559 10:106864914-106864936 GGGTGGGGCCTCCCAAACCAGGG + Intronic
1076441935 10:130486081-130486103 TGGGGCGGCATTCCAAATCAGGG + Intergenic
1079721680 11:23822682-23822704 GAGTGGGTAATTATAAATCATGG - Intergenic
1084128538 11:67117717-67117739 GGCTGGGGCGTTACACATCGGGG - Intergenic
1084514671 11:69630158-69630180 GGTTGGGGCATTAAAAGGCAGGG - Intergenic
1085916600 11:80896044-80896066 TTGGGGGGCATTACAAATAATGG + Intergenic
1087593474 11:100222742-100222764 AGGTGAGGCCTCACAAATCAGGG - Intronic
1089198923 11:116711610-116711632 GCGTGGGGCATTGGAAAGCAGGG - Intergenic
1090591410 11:128274139-128274161 GGGTTGGACATTAAAAATGAGGG - Intergenic
1091466308 12:687782-687804 GGGTGGGACATCTCAAAACAGGG + Intergenic
1093557284 12:20491312-20491334 GGGTTGGGTATTAAAAATAAGGG + Intronic
1098348267 12:69529010-69529032 GGGTGGGGGATAGCAGATCATGG + Intronic
1099080672 12:78176399-78176421 GAGTGTGGAATTACAAATCAAGG - Intronic
1103713065 12:122927563-122927585 GGGTGTGGGTTTACAAATCAAGG + Intronic
1103965824 12:124638714-124638736 GGGTGGGGCCTTGAAAGTCATGG + Intergenic
1104337172 12:127909974-127909996 GAGGGAGGGATTACAAATCAAGG + Intergenic
1106603184 13:31204578-31204600 GGGTAGGGCCTTGCAGATCAGGG + Intronic
1113735107 13:112672764-112672786 GGGTGGGGCTTTGCAAAAAACGG + Intronic
1116581182 14:46643587-46643609 GGGTGGGGCATAACATGGCAGGG - Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1121119019 14:91364259-91364281 GGGTGTGGCATTGCAATCCAGGG + Intronic
1121803288 14:96793444-96793466 AGGTGGGGGAGTACAAACCAGGG + Intergenic
1123064520 14:105610501-105610523 AAGTGGGGAATTCCAAATCATGG - Intergenic
1124865960 15:33491616-33491638 GGGTGCTGCATGACAAATTATGG - Intronic
1125384986 15:39127620-39127642 GGGAGGGGAATTAAAAACCAAGG - Intergenic
1133590801 16:7241186-7241208 AGGTGGGGCAATACATTTCAGGG - Intronic
1139974605 16:70799427-70799449 GGGTGGGGGATTTCTTATCAAGG + Intronic
1141094576 16:81153975-81153997 GGCTGTGGCATGACAACTCAGGG - Intergenic
1146210147 17:30936040-30936062 GGGTGGGGGATTACAGCTAAGGG - Intronic
1147440894 17:40446699-40446721 GGGAGGGGCATTACAGACCTTGG - Intronic
1149524070 17:57340499-57340521 GGGTGGGGCATGAGAAATAGAGG + Intronic
1154147671 18:11879770-11879792 GGGTTAGACATTACGAATCATGG - Intronic
1158771741 18:60526100-60526122 CGGTGGGGCATAACAAATTGTGG - Intergenic
1159151932 18:64532978-64533000 GGCTGGGGCCTTCAAAATCATGG - Intergenic
1159246801 18:65816377-65816399 GCATGGGGAATTATAAATCAAGG + Intronic
1168125708 19:54281423-54281445 TGATGGGACATTACAAACCAAGG - Intergenic
1168171558 19:54593298-54593320 TGATGGGACATTACAAACCAAGG + Intronic
1168622061 19:57887503-57887525 AGGTTGGGCATTACAACACAAGG - Intronic
926683076 2:15678634-15678656 GGGCGGGGCATCACATACCAGGG + Intergenic
928388360 2:30888891-30888913 GGGGGGGACAATACAACTCATGG - Intergenic
930166305 2:48206857-48206879 GGGTTGGGCATTAGAAGACATGG - Intergenic
935120316 2:100178395-100178417 GGGTGGGCCAATGCAAATCAAGG - Intergenic
936168413 2:110145220-110145242 AGGTGGTGCATTACAATTAAAGG - Intronic
936265139 2:110999177-110999199 GGGGCGGCCATTACAAACCAAGG - Intronic
937442648 2:121930022-121930044 GGGTGGAGCATTTCAGATGACGG + Intergenic
937833558 2:126448638-126448660 AGGTGGGGCATTACAAAATTCGG - Intergenic
940059044 2:149544792-149544814 GAGGGGGGCATTCCAAATAAAGG + Intergenic
941637870 2:167955454-167955476 CGGTGGGGCATGACAGATCAGGG + Exonic
942876463 2:180805471-180805493 GTGTGGGGCATTTAAAAACAAGG + Intergenic
945454323 2:210032641-210032663 GGGCGGGACATTTCAAAGCAGGG - Intronic
1173403820 20:42747769-42747791 GGGTGGGGCATTACAAATCAAGG + Intronic
1173802788 20:45905122-45905144 GGGTGGGGCATTCACAGTCAGGG + Intronic
1174467464 20:50729283-50729305 GGGTGTGGCCTTGCCAATCAGGG + Intergenic
1181647845 22:24243417-24243439 GGGGGTGGCATGAGAAATCAGGG + Intronic
1184896464 22:47409950-47409972 GCTTGGGGCATCACAACTCAGGG - Intergenic
949543962 3:5056011-5056033 TGGTAGGACATTACAAATCTTGG - Intergenic
949577928 3:5356902-5356924 GGGTGGGGAAAAAAAAATCAAGG + Intergenic
949865628 3:8544605-8544627 GGGTGGGGGAGTACAAGTCTAGG - Intronic
951176711 3:19609912-19609934 GGGGGGGTTATTACAATTCAAGG + Intergenic
951185450 3:19707273-19707295 GGGTGGGGCATCACACACTAGGG - Intergenic
952454999 3:33464590-33464612 GGGTGGGACAATTCAAAGCAGGG - Intergenic
953925501 3:46980479-46980501 GGGTGGGTCATTTCAAGTCAGGG - Intronic
954522043 3:51237201-51237223 GGGTGGTACAATACAGATCAGGG - Intronic
955731210 3:61989135-61989157 ATGAGAGGCATTACAAATCATGG - Intronic
956506068 3:69941599-69941621 GGGTTGGGCATTAGATGTCAAGG - Intronic
957237947 3:77619534-77619556 GGGTGTGACATTACACACCATGG + Intronic
960304048 3:116039709-116039731 GGGTGGGGCATTACAAAGAGAGG + Intronic
961623547 3:128243630-128243652 GGGTGGGGCATCAAGGATCAGGG + Intronic
962668467 3:137680200-137680222 GGGTGGTGCATCACACACCAGGG + Intergenic
968980444 4:3846144-3846166 GGCTGGGGCATTACAAGTGGTGG + Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
976055453 4:81060618-81060640 GGGTGGGGAAGTTCAACTCAGGG - Intergenic
976615904 4:87076603-87076625 GGGTGATGGATTACAAAACAAGG - Intronic
984385573 4:179052988-179053010 GGGTGGCTCAGTACAAATTAGGG - Intergenic
989585955 5:43074075-43074097 GGGTGGGGCATGGCCAAACATGG + Intronic
990028459 5:51225236-51225258 GGTGGGGGCATCACACATCAAGG + Intergenic
992768399 5:80024409-80024431 GGGTGGTGCGTAACATATCATGG - Intronic
995882541 5:116858863-116858885 GGTTGGGGCATTCTAAGTCATGG - Intergenic
998219607 5:140265990-140266012 GGAGAGGGCATTTCAAATCAAGG - Intronic
998700187 5:144689453-144689475 AGGTGGGACATTTCAAAGCAGGG - Intergenic
998779530 5:145640881-145640903 GAGTGTGGCATTACAAATCAAGG + Intronic
1002183803 5:177444631-177444653 GGGTGGGGCAGCACCAAACAGGG + Intergenic
1003593914 6:7457888-7457910 GGCTGGGGCCTTACTAAGCATGG - Intergenic
1005079752 6:21945000-21945022 GGGTGGGCCATTAAAATTCCAGG - Intergenic
1005931454 6:30487948-30487970 GGGTTGGGCATTAAAAGTGAGGG + Intergenic
1007616203 6:43180991-43181013 GGCTGGGGCATGGCAAATCAGGG + Exonic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1013678392 6:112493065-112493087 GGTTGGGGCATCAGAATTCAGGG + Intergenic
1014289880 6:119545961-119545983 GAGAGGCCCATTACAAATCAAGG - Intergenic
1015416443 6:132954352-132954374 GGCTGGGGTATTACAGAGCAGGG - Intergenic
1016233538 6:141834146-141834168 GGCTTGGGCATTTCAAATAAGGG - Intergenic
1017395195 6:153990751-153990773 GAGTGGGTGATTAAAAATCATGG - Intergenic
1018369547 6:163155319-163155341 GGGAGGGTCATTCCAACTCAAGG + Intronic
1021120014 7:16788724-16788746 GGCTGGGGCATGAGAAACCAAGG - Intergenic
1021320802 7:19208464-19208486 GTGTGGGCCAGTACAAATCATGG - Intergenic
1021788507 7:24176616-24176638 GGGTCAGGCCTTACAAATCTTGG - Intergenic
1023077414 7:36497996-36498018 GGGTGGGGCACTAAAAGGCAGGG + Intergenic
1023966033 7:44963490-44963512 GGCTGTGGCATTACACAGCAAGG + Intronic
1029440816 7:100585825-100585847 GGGTGGGGCTATGCAAATGAGGG + Intronic
1033131158 7:138746728-138746750 GGGTGGGTCATTTGAGATCAGGG - Intronic
1037964310 8:23121801-23121823 GAGTTGGGAATTACAAAACAAGG + Intergenic
1043963067 8:86439748-86439770 GGCTGGGGCAGAACAAATAAGGG - Intronic
1051102679 9:13539728-13539750 GGGAGGAGCATCACACATCAGGG - Intergenic
1059395513 9:114031913-114031935 GGGTGGGGGATAAAAATTCATGG + Intronic
1060288094 9:122272907-122272929 GGGCGGGGCATTACAAATCTGGG - Intronic
1187083929 X:16021972-16021994 AAGTGGGGCATTATAAATCAGGG + Intergenic
1195173871 X:102296221-102296243 GAGTAAGGCATTACAAACCAAGG + Intergenic
1195184994 X:102390872-102390894 GAGTAAGGCATTACAAACCAAGG - Intronic
1195462269 X:105140874-105140896 GGGAGGAGCATCAGAAATCATGG + Intronic
1198128630 X:133672493-133672515 GGGTGGGGAATAACAGAACAAGG + Intronic
1198932807 X:141879130-141879152 GGGAGGGGCACTACCAGTCATGG - Intronic
1198963574 X:142205751-142205773 GGGAGGGGCACTACCAGTCATGG + Intergenic