ID: 1173407427

View in Genome Browser
Species Human (GRCh38)
Location 20:42778714-42778736
Sequence GACTCCCACGAGTCCAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173407422_1173407427 15 Left 1173407422 20:42778676-42778698 CCAGTCTTAGGCTCATTCTCAAA 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1173407427 20:42778714-42778736 GACTCCCACGAGTCCAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1173407419_1173407427 28 Left 1173407419 20:42778663-42778685 CCAACACAGTTGCCCAGTCTTAG 0: 1
1: 0
2: 0
3: 5
4: 121
Right 1173407427 20:42778714-42778736 GACTCCCACGAGTCCAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1173407418_1173407427 29 Left 1173407418 20:42778662-42778684 CCCAACACAGTTGCCCAGTCTTA 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1173407427 20:42778714-42778736 GACTCCCACGAGTCCAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1173407421_1173407427 16 Left 1173407421 20:42778675-42778697 CCCAGTCTTAGGCTCATTCTCAA 0: 1
1: 0
2: 1
3: 12
4: 174
Right 1173407427 20:42778714-42778736 GACTCCCACGAGTCCAGGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173407427 Original CRISPR GACTCCCACGAGTCCAGGGT GGG Intronic
900568246 1:3345905-3345927 GGCTCCCAGGAGCCCAGGGTGGG - Intronic
902681779 1:18048828-18048850 GGATCCCACCAGTCCAGGGCTGG - Intergenic
903186556 1:21632552-21632574 GCCTTCCACCAGTCCAGGGTGGG + Intronic
905931941 1:41794334-41794356 AATTCCCACGTGTCAAGGGTGGG - Intronic
905974199 1:42163534-42163556 GAGCCCCAGGAGCCCAGGGTTGG - Exonic
909873668 1:80777974-80777996 GACCCACACCAGTCCTGGGTAGG - Intergenic
916670131 1:167010048-167010070 GACCCCCATGTGTCAAGGGTTGG + Intronic
917928347 1:179807183-179807205 GACATCCAGGAATCCAGGGTAGG - Intronic
1070687522 10:78500134-78500156 AATTCCCACGAGTCATGGGTGGG - Intergenic
1073187838 10:101627437-101627459 GACCCCCAAGAGTCCTGGGCAGG - Intronic
1073609361 10:104928146-104928168 GACTCCCAAAAGCCCAGGGATGG + Intronic
1077251393 11:1562205-1562227 GTCTCCCTCGAGGCCAGAGTGGG - Intronic
1077293328 11:1810986-1811008 GACTGCCAGGAGTGAAGGGTGGG + Intergenic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1078341678 11:10501631-10501653 GCCTCCCAGGAGCCCAGGGCAGG - Intronic
1078907368 11:15700000-15700022 AAGTCCCAGGAGTCCAGGGAGGG - Intergenic
1079445763 11:20555019-20555041 AATCCCCACGTGTCCAGGGTGGG - Intergenic
1084962469 11:72724432-72724454 GACTCCCACAAGGCGGGGGTGGG + Intronic
1089012775 11:115144217-115144239 GGCTCCCAGGAGAGCAGGGTTGG - Intergenic
1089096802 11:115926329-115926351 GACTCTCACGAGAACAGTGTAGG - Intergenic
1094342934 12:29432897-29432919 GACTTCCACAAGTCCAGATTTGG - Intronic
1099048373 12:77752387-77752409 AATACCCACGAGTTCAGGGTTGG + Intergenic
1103670806 12:122613744-122613766 CACAGCCACGAGTCCATGGTAGG + Exonic
1113215120 13:108030924-108030946 GAGTCCCCTGAGTCCAGGGTTGG - Intergenic
1115458789 14:33635727-33635749 GACCCCGACAAGTCCAGGGAAGG - Intronic
1118166775 14:63344546-63344568 GAGTCCCTGGAGGCCAGGGTAGG - Intergenic
1118338736 14:64878008-64878030 GACTCCCAGGCATCCAGGATGGG - Intronic
1119673944 14:76539725-76539747 GTCACCCAGAAGTCCAGGGTGGG - Intergenic
1122192501 14:100057194-100057216 CACTCCCAGGAGTCCAGTGGTGG + Intronic
1122693549 14:103542410-103542432 GACTCCCACGAGCCCAGTTCGGG - Intergenic
1127417576 15:58771906-58771928 GACTCCAGAGAGTCCAGGCTCGG - Exonic
1130064280 15:80591817-80591839 GACTCCCTCGAGCCCAGGCTGGG - Intronic
1131407801 15:92180633-92180655 AACTCCCAAGTGTCAAGGGTGGG - Intergenic
1139654043 16:68376751-68376773 GACTCCCAGGAGCCCAGCCTTGG - Intronic
1139953917 16:70684576-70684598 GAATCCCACCAGGCCAGGGATGG - Intronic
1140771669 16:78211202-78211224 ATTTCCCACGAGTCTAGGGTGGG + Intronic
1141488976 16:84359254-84359276 GACGACCAGGAGACCAGGGTTGG + Intergenic
1143718978 17:8797257-8797279 GGCTCCCAGCAGTCCAGGGCAGG + Exonic
1143951899 17:10639253-10639275 GAGTCCCAGAACTCCAGGGTTGG - Intronic
1144480109 17:15621996-15622018 GACTCACAGGAGTCCAGTGGGGG + Intronic
1144918195 17:18741742-18741764 GACTCACAGGAGTCCAGTGGGGG - Intergenic
1146807714 17:35878521-35878543 GACTCACACGACTGCTGGGTTGG + Exonic
1147176316 17:38658310-38658332 GACCCACAAGAGTCCAGAGTGGG + Intergenic
1148135611 17:45289906-45289928 AACTCCCACGAGGCCTGGGTAGG - Intronic
1150781980 17:68131210-68131232 GACTCACTTGAGCCCAGGGTGGG - Intergenic
1151103908 17:71589637-71589659 GAATCCCACGAGTCAAGGGAGGG - Intergenic
1152581431 17:81166966-81166988 GACTCCCACGGGGGCAGGCTGGG - Intergenic
1153809880 18:8742612-8742634 GATCCCCACGTGTCAAGGGTGGG - Intronic
1153884086 18:9447670-9447692 GAGTCCCAAGAGTCAAGGGGAGG - Intergenic
1156269421 18:35517280-35517302 GAGTCCCCCGAGTCCAGGTGTGG - Intergenic
1158332684 18:56380236-56380258 GACTCCCAGGTCTCCTGGGTGGG + Intergenic
1160501259 18:79402014-79402036 GCCTCCCAGGCCTCCAGGGTGGG + Intronic
1163498049 19:17658116-17658138 GACTCCCGGGAGCCCAGGGGTGG + Exonic
1166854172 19:45774804-45774826 GACTCCTAAGAGGCCAGAGTTGG - Intronic
1167260666 19:48455991-48456013 GGCTCCCAGGAGGCCTGGGTGGG + Exonic
1167302785 19:48688591-48688613 GAGCCCCAAGAGTCGAGGGTGGG - Intergenic
925177165 2:1793867-1793889 CCCTCCCACGACTCCTGGGTGGG + Intronic
927083814 2:19655087-19655109 GAGTCCCAGGAGCCCAGGGGTGG + Intergenic
931524081 2:63133495-63133517 AATTCCCACGTGTCAAGGGTGGG + Intronic
932345570 2:70993228-70993250 GCCTCCCATGAGACCAGGGAAGG + Intronic
932508836 2:72264654-72264676 GATCCCCACGTGTCAAGGGTGGG + Intronic
938684491 2:133724506-133724528 GACTCCCACTAGGCCAGCCTGGG + Intergenic
944339658 2:198581360-198581382 GTCCCCCACGTGTCAAGGGTGGG + Intergenic
944469096 2:200033850-200033872 CACTCCCCCGAGTCCCTGGTTGG + Intergenic
947966192 2:234283424-234283446 GATCCCCACGTGTCAAGGGTGGG + Intergenic
948111140 2:235456836-235456858 CACTCCCATGAGAACAGGGTGGG - Intergenic
948295402 2:236856717-236856739 GGCTCCCACGTGGACAGGGTGGG + Intergenic
948737344 2:240017551-240017573 GGCTCCCACGGGCCCGGGGTTGG - Intronic
1170569611 20:17625410-17625432 CCCTCCCCCGAGTCCAGGGCGGG + Intronic
1171409338 20:24935586-24935608 GGCTCCCACCAGCCCAGGGAAGG - Intergenic
1173407427 20:42778714-42778736 GACTCCCACGAGTCCAGGGTGGG + Intronic
1176117632 20:63439979-63440001 GACTCCCACGAGGCTCGGCTAGG + Intronic
1181443756 22:22952670-22952692 GGATCTCAGGAGTCCAGGGTTGG - Intergenic
953567091 3:44042088-44042110 TAGTCCCACTGGTCCAGGGTAGG + Intergenic
954163616 3:48739291-48739313 GGATCCCACAAGGCCAGGGTTGG + Intronic
954301306 3:49702151-49702173 GACTCCCAGGAGCCCTGGGTGGG + Intronic
959237963 3:103748681-103748703 AATCCCCACGTGTCCAGGGTGGG - Intergenic
961384799 3:126517464-126517486 GAGCCCCTGGAGTCCAGGGTGGG + Intronic
968974123 4:3812215-3812237 GCCTCCCAGGAGTGTAGGGTGGG - Intergenic
969439056 4:7206692-7206714 GACACCCACGCCTCCATGGTGGG + Intronic
969598808 4:8163662-8163684 CACTCCCAGCAGCCCAGGGTGGG - Intergenic
983703057 4:170622530-170622552 TAATCCCAGGAGTCCAAGGTGGG - Intergenic
983926316 4:173406640-173406662 GGCTGCCAGGAGTTCAGGGTAGG - Intergenic
984863873 4:184263997-184264019 GACTCCCAGGACACCAGGTTTGG - Intergenic
987709189 5:21487150-21487172 AATTCCCACGTGTCAAGGGTGGG - Intergenic
988039816 5:25874626-25874648 GACTCCCACTGGCCCTGGGTAGG + Intergenic
988750424 5:34187002-34187024 AATTCCCACGTGTCAAGGGTGGG + Intergenic
990122741 5:52475532-52475554 AACTCCCACATGTCAAGGGTGGG + Intergenic
991158463 5:63466690-63466712 AATTCCCACGAGTCCAGAGAGGG + Intergenic
991386062 5:66091824-66091846 CACTCCCATGGGTCCTGGGTTGG + Intergenic
991738683 5:69650201-69650223 AATTCCCACGTGTCAAGGGTGGG + Intergenic
991759515 5:69906226-69906248 AATTCCCACGTGTCAAGGGTGGG - Intergenic
991787821 5:70211892-70211914 AATTCCCACGTGTCAAGGGTGGG + Intergenic
991790258 5:70229942-70229964 AATTCCCACGTGTCAAGGGTGGG + Intergenic
991815007 5:70505033-70505055 AATTCCCACGTGTCAAGGGTGGG + Intergenic
991818142 5:70526318-70526340 AATTCCCACGTGTCAAGGGTGGG + Intergenic
991838744 5:70781292-70781314 AATTCCCACGTGTCAAGGGTGGG - Intergenic
991880267 5:71212256-71212278 AATTCCCACGTGTCAAGGGTGGG + Intergenic
991882707 5:71230282-71230304 AATTCCCACGTGTCAAGGGTGGG + Intergenic
993095018 5:83471593-83471615 CACTCCTAAGAGTCCAGGCTTGG - Exonic
994485727 5:100385821-100385843 AATTCCCACGTGTCAAGGGTGGG + Intergenic
995141161 5:108737102-108737124 AATCCCCACGAGGCCAGGGTGGG - Intergenic
996421671 5:123269676-123269698 GACTGCCTAGAGTCCAGTGTTGG - Intergenic
997365746 5:133324239-133324261 GACTCCGAAGAGTCAAGGGGAGG + Intronic
1003721692 6:8710318-8710340 AACACCCACCAGTCCAGTGTGGG + Intergenic
1005548489 6:26893305-26893327 AATTCCCACGTGTCAAGGGTGGG + Intergenic
1008940539 6:57041086-57041108 GACTCCCTCTAGCCCAGGGCAGG - Intergenic
1009019249 6:57934415-57934437 AATTCCCACGTGTCAAGGGTGGG + Intergenic
1013236189 6:108199262-108199284 GAGTCCCACGACTCCTGGGCGGG - Intergenic
1014524681 6:122488517-122488539 GAATCACCCGAGTCCAGGGAGGG - Intronic
1019348686 7:543133-543155 GACTCTGACGAGGCCAGGGCAGG + Intergenic
1023236711 7:38098024-38098046 AACTCCCACATGTCAAGGGTGGG + Intergenic
1024270667 7:47639088-47639110 GGCTCCCAGGACTCCAGTGTTGG + Intergenic
1024277398 7:47689027-47689049 CAGTCCCACAAGTCCAAGGTAGG + Intergenic
1024366213 7:48522925-48522947 GACTTCCAAAAGTCCAGGATAGG + Intronic
1028416943 7:90590386-90590408 GAATCGCACGAATCCAGGGGTGG + Intronic
1033421397 7:141207764-141207786 GTGTCCCACCAGTCCAGGGATGG + Intronic
1038517227 8:28197326-28197348 GACATCCACGTTTCCAGGGTGGG - Intergenic
1041559185 8:59195732-59195754 GATTCCCACAAGTCAAGGGTGGG + Intergenic
1046680818 8:117168114-117168136 GATCCCCACGTGTCAAGGGTGGG - Intronic
1048134944 8:131739440-131739462 GACTACCAAGATTCCAGGATAGG + Intergenic
1048978672 8:139690980-139691002 GTCTTCCACCAGCCCAGGGTGGG + Intronic
1056149061 9:83766051-83766073 AATTCCCATGAGTCCAGGGTGGG + Intronic
1061190312 9:129078974-129078996 GACCCCGACGAGCCCAGGCTGGG + Intergenic
1061575402 9:131503102-131503124 GACTCCCCCAAGTCCGGGCTGGG - Intronic
1061711777 9:132492960-132492982 GACTCCCACGGCTCCAGCCTGGG + Intronic
1062469965 9:136697980-136698002 GAGTCCCACGAGACTGGGGTGGG + Intergenic
1062495166 9:136828136-136828158 AGCTCCCCCAAGTCCAGGGTGGG - Intronic
1185973858 X:4696222-4696244 AATCCCCACGAGTCAAGGGTGGG - Intergenic
1185973899 X:4696863-4696885 GACTACCACGAGAACAGTGTAGG + Intergenic
1191252488 X:58266203-58266225 GACCCCCACAAGTCCAGCGCAGG + Intergenic
1193698506 X:84737954-84737976 GACTCCCTCCAGGCCAGGGCTGG + Intergenic
1201764145 Y:17563791-17563813 GACTCCCCCGGGCCCAGCGTAGG + Intergenic
1201837408 Y:18342199-18342221 GACTCCCCCGGGCCCAGCGTAGG - Intergenic