ID: 1173408180

View in Genome Browser
Species Human (GRCh38)
Location 20:42785705-42785727
Sequence TTGGATAAGTAGCCTCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173408180_1173408187 -8 Left 1173408180 20:42785705-42785727 CCCAGATGAGGCTACTTATCCAA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1173408187 20:42785720-42785742 TTATCCAAGGGAGGGCATGGAGG 0: 1
1: 0
2: 2
3: 35
4: 484
1173408180_1173408189 6 Left 1173408180 20:42785705-42785727 CCCAGATGAGGCTACTTATCCAA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1173408189 20:42785734-42785756 GCATGGAGGTTACTGAGTACAGG 0: 1
1: 0
2: 0
3: 10
4: 110
1173408180_1173408190 20 Left 1173408180 20:42785705-42785727 CCCAGATGAGGCTACTTATCCAA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1173408190 20:42785748-42785770 GAGTACAGGCTTAACAACACTGG 0: 1
1: 0
2: 1
3: 3
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173408180 Original CRISPR TTGGATAAGTAGCCTCATCT GGG (reversed) Intronic
902306293 1:15542263-15542285 TTGAGTAAGGAGCCTCACCTGGG + Intronic
904123639 1:28220591-28220613 TTGGATTAATGTCCTCATCTTGG - Intronic
904766150 1:32849065-32849087 TTGGATTATTAGCCCCACCTGGG + Intronic
905644127 1:39612697-39612719 TTACATAAGTATCCTCATCAAGG - Intergenic
1064675409 10:17755447-17755469 TCGCAGAAGTAGCCACATCTGGG - Intronic
1068155747 10:53195877-53195899 TTGGCTAAGGAGCCGTATCTTGG + Intergenic
1069092172 10:64213257-64213279 TTGAATGACTAGCCTCACCTGGG - Intergenic
1069838671 10:71325722-71325744 TTGGACCAGCAGCCTCACCTGGG + Intronic
1073508594 10:104025486-104025508 TTGGACAAGTAGTTTTATCTTGG + Intronic
1075223540 10:120604540-120604562 TTGGGTAAGGAGCCTAAACTTGG - Intergenic
1080651726 11:34228108-34228130 TTGGCTCAGTAGCATGATCTTGG + Intronic
1080651775 11:34228433-34228455 TTGGCTCAGTAGCATGATCTTGG + Intronic
1081638472 11:44736673-44736695 TCTGATATGCAGCCTCATCTGGG + Intronic
1082758757 11:57105638-57105660 TTGAACAAGTAGCCTGTTCTGGG - Intergenic
1088910934 11:114192034-114192056 TTGGATAACTGGGCTCAGCTGGG + Intronic
1089366186 11:117922521-117922543 TTGGATAAGAAGTCTCGGCTGGG - Intronic
1090031295 11:123208923-123208945 TTAGAGAAGTACACTCATCTTGG + Intergenic
1096260053 12:50084993-50085015 TTGGAGTAATAGCTTCATCTTGG - Exonic
1097781640 12:63713477-63713499 TTGGATAAGCATCCTGATGTGGG - Intergenic
1098315743 12:69191751-69191773 TGGGAAAACTGGCCTCATCTTGG + Intergenic
1099256447 12:80319881-80319903 TTGGATAAATAGTCTCTTCTTGG + Intronic
1099612110 12:84887077-84887099 TTGCACATGTAGCCTCATGTAGG - Intronic
1100038170 12:90279126-90279148 TTGGATAAATTGCCTCCTTTGGG + Intergenic
1104560265 12:129837525-129837547 TTGGAGAAGTTGCCTCATTGAGG - Intronic
1112497504 13:99916370-99916392 ATGGAGAAGTAGGCTCATCGGGG - Intergenic
1115051375 14:29067958-29067980 TTGGTTAAGCAGCCTCCCCTGGG + Intergenic
1119899577 14:78248502-78248524 AGGGATAAGCAGCCTCCTCTTGG - Intronic
1140178505 16:72689862-72689884 TTGCATATCTAGTCTCATCTTGG + Intergenic
1156740370 18:40319297-40319319 ATGGATAAATAACCTCAACTTGG - Intergenic
1158038075 18:53058879-53058901 TTGGAGAAGTAGCCTCATGAAGG + Intronic
1158800776 18:60906023-60906045 TTACTTAAGTAGCCTCATCTTGG - Intergenic
1158817927 18:61125291-61125313 TTGGAGAAGTAGCCTGGGCTGGG - Intergenic
1161948549 19:7454190-7454212 TTGGATCAGTGGCACCATCTTGG + Intronic
1162817196 19:13203171-13203193 TTGTTTATGTAGACTCATCTTGG - Intergenic
1164394088 19:27848913-27848935 TTCCATAAGTAGCCTCTTTTGGG + Intergenic
927587933 2:24325881-24325903 TTCAGTAAGTAGTCTCATCTCGG + Intronic
928262390 2:29779451-29779473 TTAGAAAAGTAGCTTCATTTGGG + Intronic
932657173 2:73620182-73620204 TTAGATCAGGACCCTCATCTTGG - Intergenic
938121351 2:128636471-128636493 TTGGATGAGGAGGCTCTTCTGGG - Intergenic
939864318 2:147455985-147456007 TTGGATAGGTAGCCACATTTCGG + Intergenic
945114540 2:206398296-206398318 TTGGGTTGGTAGACTCATCTTGG - Intergenic
1170568258 20:17618662-17618684 TAGGAGAAGTTGCCTCAGCTTGG + Exonic
1171196449 20:23203443-23203465 TAGGAAATGTGGCCTCATCTGGG + Intergenic
1173408180 20:42785705-42785727 TTGGATAAGTAGCCTCATCTGGG - Intronic
1177421596 21:20865753-20865775 ATGCATAAGTATGCTCATCTGGG - Intergenic
1178103537 21:29295708-29295730 TGGGACAAGTAGCCTAGTCTTGG - Intronic
1181928241 22:26377668-26377690 TTGGAATAGTAGCGACATCTGGG - Exonic
949183863 3:1167395-1167417 TTGGATATGGATCCCCATCTGGG - Intronic
949418497 3:3838532-3838554 TTGGATATGTACCCTGAACTGGG + Intronic
950353350 3:12379592-12379614 TTGGCAAAGTAATCTCATCTGGG - Intronic
953204867 3:40817199-40817221 TTGGACCAGTAGCATCATCTGGG + Intergenic
959921628 3:111874559-111874581 TAGGACAACTAGCCTCATCCAGG - Intronic
964099162 3:152967688-152967710 TTGGTTAAGTGGGCTCAGCTGGG - Intergenic
965354858 3:167661439-167661461 TCAGATAAGTTGCCTCATATGGG + Intergenic
966783301 3:183603371-183603393 TTGTATGAATAGCCTCATTTGGG + Intergenic
970039016 4:11774744-11774766 TTGGATGTGGGGCCTCATCTTGG - Intergenic
970726505 4:19051782-19051804 TTGGGGAATTAGCCTTATCTTGG + Intergenic
972648126 4:40989553-40989575 TTGGAAAACTGGCCACATCTGGG - Intronic
975153351 4:71044594-71044616 CTGGAGTAGTGGCCTCATCTTGG - Intergenic
982003802 4:151045993-151046015 ATGAATAAGTGGCCTCAACTGGG - Intergenic
982028272 4:151274403-151274425 TGGGGTAAGTACCCTCATATGGG - Intronic
982197030 4:152926967-152926989 TTAGATAAGTAGCCGAATCAGGG - Intergenic
982527338 4:156495457-156495479 GTGGATAAGTAGCATGTTCTAGG - Intergenic
985611234 5:890720-890742 TTGGAACAGTAGCCCCATCTGGG - Intronic
986691180 5:10315259-10315281 TTTTATAAGTGGCTTCATCTTGG + Intergenic
992981338 5:82176862-82176884 TTCAATAAGTATCTTCATCTTGG - Intronic
998317494 5:141196369-141196391 TTGGAAAAGTAGACTCATACAGG - Intergenic
999183282 5:149685761-149685783 ATGGATAAGTTGCCTCAGTTGGG + Intergenic
1000281948 5:159789670-159789692 TTGGATGAGTTACTTCATCTTGG + Intergenic
1003451996 6:6243499-6243521 TTCAATAATTTGCCTCATCTGGG + Intronic
1007960991 6:45959089-45959111 TTAGATAAGTTACCTCCTCTTGG + Intronic
1010393346 6:75361417-75361439 TTGGATAAATGGTCTCATTTGGG - Intronic
1014514810 6:122365639-122365661 TGGAATAAGTGGCCTCATCAAGG + Intergenic
1014670246 6:124294777-124294799 TTGGAAATGTTGACTCATCTGGG + Intronic
1017678590 6:156840596-156840618 TTGGAGAATGAGCCTAATCTCGG - Intronic
1021345411 7:19521310-19521332 TTGGATGAGAATCCTGATCTGGG + Intergenic
1021878538 7:25071071-25071093 TTGGATTAGTTGTCACATCTGGG - Intergenic
1022557109 7:31309316-31309338 TTTGAGAAGTATCCTCATTTGGG - Intergenic
1022940240 7:35229571-35229593 TTGGATAAGCATCCTGATGTGGG - Intronic
1026393675 7:69928742-69928764 TTGGGTCTGTAGCCACATCTAGG + Intronic
1027614381 7:80403137-80403159 TTGGATAAGCATCCTTATGTGGG + Intronic
1028123748 7:87087619-87087641 TTGGATAAATACCCAGATCTAGG + Intergenic
1035776116 8:2190061-2190083 TTGGATAAATAACTTCAACTTGG - Intergenic
1043613859 8:82101201-82101223 TTGGAAAAGCATCTTCATCTAGG + Intergenic
1052532017 9:29698033-29698055 TTTGATTTGTAGTCTCATCTTGG + Intergenic
1052998312 9:34563570-34563592 TTGCATAAGAATTCTCATCTTGG + Intronic
1055627822 9:78192712-78192734 TTGGCTAAGGAGCCTCAGCGGGG + Intergenic
1058507934 9:105685634-105685656 TTTGAGAAATAGTCTCATCTTGG - Intergenic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1186236506 X:7516599-7516621 TTGTATAAGTTGCCTCATAAAGG - Intergenic
1186294763 X:8136879-8136901 TTGTATAAGTAGCCTCATAAAGG + Intergenic
1187071131 X:15889535-15889557 TAGGCTAAGTACCCTCCTCTGGG + Intergenic
1189103062 X:38210932-38210954 TTTGATAACCAGCCTCACCTGGG - Intronic
1191741195 X:64436823-64436845 ATGGACAAGCATCCTCATCTTGG + Intergenic
1195305241 X:103575630-103575652 TTAGAAAAGTAACCTCTTCTAGG - Intergenic
1199376708 X:147121090-147121112 TTGGATATATAGTATCATCTAGG - Intergenic
1199861203 X:151801615-151801637 TTGGATCCGTAGCCACAACTTGG + Intergenic
1200720252 Y:6598292-6598314 TTGGATAAGTATCCAGAACTGGG + Intergenic