ID: 1173414576

View in Genome Browser
Species Human (GRCh38)
Location 20:42844555-42844577
Sequence TGGTTACTCACAGTGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173414574_1173414576 5 Left 1173414574 20:42844527-42844549 CCAGAAAGTCTTGGTCAAAAAAA 0: 1
1: 0
2: 1
3: 31
4: 294
Right 1173414576 20:42844555-42844577 TGGTTACTCACAGTGACAGAAGG 0: 1
1: 0
2: 0
3: 20
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173414576 Original CRISPR TGGTTACTCACAGTGACAGA AGG Intronic
902564915 1:17305086-17305108 TGGTCACTCACAGTGGAACAAGG - Intergenic
906799765 1:48726303-48726325 TTGTTACTCACAGAGAGAAAAGG + Intronic
907956278 1:59231113-59231135 GGGTTATTCCCATTGACAGAAGG + Intergenic
908845426 1:68319960-68319982 TGCTTACTGACAGTTACATAAGG - Intergenic
909153578 1:72040990-72041012 TGGTTACTTACAATGACATATGG - Intronic
912624312 1:111194950-111194972 TGGTGAAGCACAGTGAGAGAGGG - Intronic
918716859 1:187800537-187800559 TGGTTATTTACAGTGACTGTAGG - Intergenic
919727994 1:200896089-200896111 TGGGGACTTACAGGGACAGAGGG - Intronic
921923599 1:220693750-220693772 GGGTCCCTCACAGTAACAGAAGG - Intronic
922900424 1:229132322-229132344 TGGTCAGTCACAATGGCAGAGGG - Intergenic
924377382 1:243427234-243427256 GGTTTGCTCAAAGTGACAGATGG + Intronic
1063456348 10:6185327-6185349 CGCTTACTCACAGTGGCAGGAGG + Intronic
1064623678 10:17240763-17240785 AGTTTTCTCACAGTGACAGATGG + Intergenic
1066637459 10:37520205-37520227 TGTTTCCTCACAGTCTCAGAAGG - Intergenic
1066784098 10:38983249-38983271 TGGTTCCACACTGTGAGAGAGGG + Intergenic
1067371035 10:45682805-45682827 TGGTTCCACACCGTGAAAGAGGG + Intergenic
1067388747 10:45843345-45843367 TGGTTCCACACCGTGAAAGAGGG - Intronic
1067417318 10:46113611-46113633 TGGTTCCACACCGTGAAAGAGGG + Intergenic
1067445518 10:46341222-46341244 TGGTTCCACACGGTGAAAGAGGG + Intergenic
1067874509 10:49992709-49992731 TGGTTCCACACGGTGAAAGAGGG + Intronic
1069873713 10:71548629-71548651 TGTGTACACACAGAGACAGAGGG + Intronic
1070135961 10:73693749-73693771 TGGTTCCACACAGTGAAAGAGGG - Intronic
1075044635 10:119136686-119136708 TGGGTAATCAGAGTGAAAGAGGG - Exonic
1075360526 10:121828606-121828628 TGGTGACTTACACTGACTGATGG - Intronic
1078644378 11:13126514-13126536 TGGTTACTCAGAGAAACACAGGG - Intergenic
1078960616 11:16264028-16264050 TGATTACACACAGAGACAAAGGG - Intronic
1081767873 11:45624446-45624468 GGGTCCCTCACAGGGACAGAGGG + Intergenic
1087957546 11:104307178-104307200 AGGTTAATCACAGTGACTCATGG - Intergenic
1089348009 11:117803992-117804014 TGGCCAGTCACAGTGACAGGAGG - Intronic
1090679194 11:129035412-129035434 TGGCATCTAACAGTGACAGATGG + Intronic
1091645062 12:2266935-2266957 TGGTTACTCACAGTGATAACAGG + Intronic
1097556048 12:61138992-61139014 TATTTAATCACAGTGATAGATGG + Intergenic
1102607321 12:114077949-114077971 TGGGTCCTCATAGAGACAGAAGG - Intergenic
1105383134 13:19905768-19905790 TTGTTACTCACAGTCCCAAAAGG - Intergenic
1107179907 13:37447054-37447076 TTGTTACTCACAGTTCCAGGAGG + Intergenic
1114811205 14:25901751-25901773 ATGTTACTCAAAGTGACTGATGG - Intergenic
1119636843 14:76280163-76280185 TGGTTTCCCACAGTTAGAGATGG + Intergenic
1121023848 14:90600013-90600035 AGGTGACACACAGAGACAGAAGG - Intronic
1123671823 15:22666031-22666053 TGGTTTCTCACAGAGATAGGTGG + Intergenic
1124323865 15:28739246-28739268 TGGTTTCTCACAGAGATAGGTGG + Intergenic
1124527753 15:30472487-30472509 TGGTTTCTCACAGAGATAGGTGG + Intergenic
1124770906 15:32535215-32535237 TGGTTTCTCACAGAGATAGGTGG - Intergenic
1127953073 15:63829026-63829048 AGGTTTCTGACAGAGACAGAAGG + Intronic
1131424479 15:92334392-92334414 GAGTTACTCACAGTGACTTATGG + Intergenic
1135888416 16:26334923-26334945 TGTTTACTCACAGAGTCAAAGGG - Intergenic
1137452738 16:48591993-48592015 TGGCTAATAACAGTTACAGAGGG + Intronic
1137842671 16:51654307-51654329 TGGTTACTCACTCTCACTGAAGG + Intergenic
1138458614 16:57134944-57134966 CTGTTGCTCAGAGTGACAGAGGG + Intronic
1140112565 16:72016409-72016431 TGTCTAGTGACAGTGACAGAGGG + Intronic
1140891561 16:79289441-79289463 TGGCTACCCACCGTGAGAGAAGG + Intergenic
1140986003 16:80158530-80158552 TTGCTTCTCTCAGTGACAGAGGG + Intergenic
1141496312 16:84412779-84412801 TGGCTGCTCAAAGTGATAGAAGG + Intronic
1141674932 16:85512858-85512880 TGCTGACTCACAGGGACAGCTGG + Intergenic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1147939880 17:44038933-44038955 TGGTTAAACAGAGTAACAGATGG + Intronic
1153489762 18:5634949-5634971 TGGTTCCTCTCAGTGGAAGATGG + Intergenic
1155531261 18:26769086-26769108 TGGCTACTCAGAGTCACATATGG - Intergenic
1155809161 18:30209444-30209466 TGTTGACTCACAGTTACACATGG + Intergenic
1156913134 18:42434967-42434989 TGGCCACTCATAGTGACAGATGG + Intergenic
1157420317 18:47542200-47542222 GGGTTACTCACAGAGTCATAGGG - Intergenic
1158790629 18:60776121-60776143 TGGTTTCTCACAGTGTCAGTGGG - Intergenic
1160006890 18:75074678-75074700 TGGTCACTAAAAGTGACAGAAGG + Intergenic
1160029030 18:75242734-75242756 TGGTGACTTAAAGTGAGAGAGGG + Intronic
1160583607 18:79901063-79901085 TGGTGACCCCCAGAGACAGAAGG + Intergenic
1165329654 19:35134500-35134522 TGGACACTCACAGTGACAGCAGG + Exonic
1166163893 19:40972805-40972827 TGGTCACTCACAGAAGCAGATGG + Intergenic
1167781284 19:51600932-51600954 TGGTTACCCACAGTGTCCCAGGG + Intergenic
925678935 2:6396454-6396476 TAATTACTCACAGTTACACATGG + Intergenic
926281893 2:11455924-11455946 TGTTTGCCCACTGTGACAGAGGG + Intronic
927104809 2:19814515-19814537 TGGTTACTGAAACTGACAGTAGG - Intergenic
929293317 2:40217720-40217742 TGGTTTCACAGACTGACAGATGG - Intronic
933851225 2:86368334-86368356 TGGCTTCTCACAGGAACAGACGG - Intergenic
934064750 2:88330558-88330580 TGGCTGCTCGCAGTGAGAGAGGG + Intergenic
935199747 2:100845879-100845901 TGGTTCCTCACCATGGCAGAGGG + Intronic
937145975 2:119644854-119644876 AGGTTTCTCACAGTGGAAGAAGG - Intronic
940142348 2:150506548-150506570 TGCTTACTCACTGTGAGAGAGGG + Intronic
943640556 2:190353127-190353149 TTGTTGTCCACAGTGACAGAAGG - Intronic
944041751 2:195363691-195363713 TGGTTACACACAGTTCCAGCAGG + Intergenic
944165767 2:196718654-196718676 TGCTTCTTCTCAGTGACAGACGG - Intronic
944673311 2:202014625-202014647 GGGTGAGTGACAGTGACAGAGGG - Intergenic
945636547 2:212360284-212360306 GGCTTGCACACAGTGACAGAAGG - Intronic
946681867 2:222225886-222225908 TGTTTACTCACAGACACAAAAGG - Intronic
1169525731 20:6423342-6423364 TGGTTATTCACAGTAAAAGTAGG + Intergenic
1169908001 20:10622967-10622989 TGCTGACTCACAGCTACAGACGG - Exonic
1172649855 20:36495279-36495301 TGGTATCTCATAGTGGCAGATGG + Intronic
1173414576 20:42844555-42844577 TGGTTACTCACAGTGACAGAAGG + Intronic
1175558470 20:59894278-59894300 TGGGTTGTCACAATGACAGAGGG + Intronic
1179230723 21:39501689-39501711 TGTTTACTGACAATCACAGAGGG - Intronic
950092527 3:10306078-10306100 TGGTTACTTATAGTGGAAGAGGG - Intronic
951323812 3:21278673-21278695 TGGTTACCCACAGTCATGGAAGG - Intergenic
951721685 3:25705911-25705933 TCAATACTCACAGTGAGAGATGG + Intergenic
953621131 3:44533855-44533877 TGGTCACTCTGGGTGACAGAAGG - Intergenic
953896731 3:46808909-46808931 TGATTGCTCACAGAGAGAGAAGG - Intronic
959102030 3:102021826-102021848 TGCTTCCCCACAGTGACAGTAGG + Intergenic
960419576 3:117427258-117427280 TGGTTAATCAAAGGGCCAGAAGG + Intergenic
960720510 3:120621000-120621022 TGGTTCCTCCCAGTGACTGAGGG - Intergenic
962262355 3:133920412-133920434 TGGTTAATCACAGTTCTAGAAGG + Intergenic
962791619 3:138816708-138816730 TGGTGACTCACAGTGAGGGTAGG - Intronic
965399112 3:168196783-168196805 TGATTAATCACAGTCAGAGAAGG - Intergenic
969862296 4:10047090-10047112 TGGCTCATCACAGTCACAGATGG - Intronic
969941882 4:10740478-10740500 TGGTGGCTCATAGGGACAGAAGG + Intergenic
973910064 4:55571306-55571328 TGGTTACTCACAGTTTCCAAGGG - Intronic
974519232 4:62959583-62959605 AGGTTATCCACTGTGACAGAAGG + Intergenic
974722469 4:65759288-65759310 TAGTTAATCACAGAGAAAGATGG + Intergenic
975996294 4:80320366-80320388 TGCTTCCTCACAGTGGGAGATGG + Intronic
976913082 4:90332661-90332683 TGTTTTATCACAGAGACAGAAGG - Intronic
976966797 4:91053238-91053260 TTGTTGCTCATAGTGACAGCAGG - Intronic
977902767 4:102441745-102441767 TAGTAACTCACATTGACAGAAGG + Intergenic
981896545 4:149808388-149808410 TGGTTACTAGAAGAGACAGAAGG + Intergenic
982790231 4:159583596-159583618 TGGTTGTTCAAAGTGACACAAGG + Intergenic
983080241 4:163376189-163376211 TTGATACTCACACAGACAGAAGG + Intergenic
985536756 5:469409-469431 GGGGTCCTCACAGGGACAGAAGG - Intronic
985536803 5:469575-469597 GGGGTACTCACAGGAACAGATGG - Intronic
987344888 5:16970325-16970347 TTGCTGCTCACAGTGACAGAGGG + Intergenic
990529945 5:56663523-56663545 TGGTCACTTACTGTGTCAGAAGG - Intergenic
991008392 5:61855000-61855022 TGGTTACCTAGAGAGACAGATGG - Intergenic
992278684 5:75150041-75150063 TGGGAACTCAGAGTGGCAGAGGG - Intronic
993525033 5:88954915-88954937 TGGTTAATAACAGCAACAGAAGG + Intergenic
994242495 5:97441401-97441423 TGAATACTCACAGTGGAAGAGGG - Intergenic
994244699 5:97466667-97466689 TGGTTACTCACCTGGAAAGAGGG + Intergenic
996764211 5:127019434-127019456 TTGTTAGTGACACTGACAGACGG + Intronic
996951506 5:129131606-129131628 AGTTCACTCACAGTGACAGAAGG + Intergenic
999649755 5:153754009-153754031 TGGTTTCTCACAGTGAAGGAGGG + Intronic
1002461281 5:179375165-179375187 AGGTGTCCCACAGTGACAGATGG + Intergenic
1002803734 6:551839-551861 GGGTTAATCAGAGAGACAGAAGG - Intronic
1002807142 6:588215-588237 TGTTTACTGACAATGACAGAGGG + Intronic
1003141091 6:3471902-3471924 TGGTTAGTCACAGTAGAAGAGGG + Intergenic
1004015993 6:11732458-11732480 TGGCTCCTCACAGCCACAGATGG - Intronic
1007423408 6:41733264-41733286 TGGTGACTCACAGTCAGAGGTGG - Intronic
1008754980 6:54784031-54784053 TGGCTACTCTCAGTGAGGGAGGG - Intergenic
1010500418 6:76593427-76593449 TGGGTACTCAAAGTGTGAGAGGG + Intergenic
1010744690 6:79547371-79547393 CTTTTCCTCACAGTGACAGAGGG + Intergenic
1011051299 6:83153227-83153249 TGTTTACTCACTGTCACAGAAGG + Intronic
1013055044 6:106575147-106575169 AGGTTACTCACAGTGAAGTAGGG + Intronic
1016448217 6:144154436-144154458 TGGAGACTCACAGTGTCTGAAGG + Intronic
1017964290 6:159250714-159250736 TAGCTACTCACATTTACAGATGG - Intronic
1018396027 6:163378654-163378676 TGGTTTCTCACAGTTCTAGAAGG - Intergenic
1021878735 7:25073172-25073194 TGGTTACCAAGAGTGACAGTAGG - Intergenic
1023243090 7:38170077-38170099 TGGTGAGTCACAGTGGCAGAGGG + Intergenic
1024002385 7:45199248-45199270 GGTTTATTCACAGTGACAAATGG - Intergenic
1024454836 7:49593243-49593265 TGGTCACCCACAAAGACAGATGG + Intergenic
1028872987 7:95789016-95789038 TTTTCACTCAAAGTGACAGATGG + Intronic
1029695735 7:102212032-102212054 AGGTCACGCACAGTGACAAAGGG - Intronic
1031019788 7:116614662-116614684 TGGTTACTGACTGGGAAAGAAGG - Intergenic
1031286306 7:119873089-119873111 TGAATCCTCACAGGGACAGATGG - Intergenic
1036583964 8:10105946-10105968 TGGTTACTAGCAGGGAAAGAGGG - Intronic
1037532572 8:19791862-19791884 TGGTTTCTCACTGTTAGAGAAGG + Intergenic
1038389059 8:27178112-27178134 TGGTTTGTCACAATGACAGAAGG - Intergenic
1038929606 8:32178170-32178192 TGGTTACTTAGATTGAGAGAAGG + Intronic
1040407993 8:47127579-47127601 TGCTTTCTCACTGTGACAGCAGG + Intergenic
1042639943 8:70922682-70922704 AGGATGCTCACAGGGACAGAGGG + Intergenic
1044328714 8:90891609-90891631 TGGTTGTTGACAGTCACAGAAGG + Intronic
1045003680 8:97899576-97899598 TGGACACTCACAGGTACAGAGGG - Intronic
1046329008 8:112689857-112689879 TTGGTACTCACAGATACAGATGG + Exonic
1046775226 8:118157398-118157420 TGGTTACCTCCAGGGACAGAAGG + Intergenic
1047205356 8:122798846-122798868 TGGTTAATCACAGGGTCAGTTGG - Intronic
1047300637 8:123610920-123610942 TGGGTAATCACGGAGACAGAAGG + Intergenic
1049513777 8:143043066-143043088 TGGTGACGCACAGGGACAGAGGG + Exonic
1050194161 9:3062846-3062868 TGGTTACCTGCAGTGGCAGATGG - Intergenic
1053299316 9:36937382-36937404 GGGTTAGTAACAGTGGCAGAGGG - Intronic
1053538082 9:38946063-38946085 TGGTTACTCACAGTTATGGTTGG + Intergenic
1054628052 9:67417858-67417880 TGGTTACTCACAGTTATGGTTGG - Intergenic
1054899966 9:70358634-70358656 TGGGTATTCACAGTGAAAGAGGG + Intergenic
1055192521 9:73542716-73542738 TGGCTGCTCACAGAGACATAAGG + Intergenic
1058318787 9:103603151-103603173 TAGTTAGCCACAGTGTCAGATGG + Intergenic
1058941224 9:109814499-109814521 TGGATTCTCCCAGTGACAGGAGG - Intronic
1060694638 9:125697801-125697823 TGGTTACTCATATTGATAGTGGG - Intronic
1197509227 X:127350387-127350409 TGGTTACTCACCTAGAAAGAGGG - Intergenic
1197815761 X:130496271-130496293 TGGGTAATCAGAGTGAAAGAGGG - Intergenic
1201374607 Y:13304073-13304095 TGGTCAATAACAGTGGCAGAAGG - Intronic
1201750289 Y:17423881-17423903 TGGCAGCCCACAGTGACAGAGGG + Intergenic