ID: 1173417288

View in Genome Browser
Species Human (GRCh38)
Location 20:42868166-42868188
Sequence CAGAGTATTAAGGGTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173417288 Original CRISPR CAGAGTATTAAGGGTGTTTC TGG Intronic
904890864 1:33778589-33778611 CAGAGTATTCTGTGTGTTCCAGG - Intronic
906574277 1:46873992-46874014 CAGAGTCTTCAGGGTTTTCCAGG - Intergenic
906597697 1:47093912-47093934 CAGAGTCTTCAGGGTTTTCCAGG + Intronic
906600158 1:47119671-47119693 CAGAGTCTTTAGGGTTTTTAAGG - Intergenic
907862179 1:58364131-58364153 CAGTGTATTAAAGGTGTGTCTGG - Intronic
907890474 1:58631902-58631924 CAGAGCATTAAGGGTGATTCTGG + Intergenic
908772864 1:67611978-67612000 GAGAGTACAAGGGGTGTTTCTGG - Intergenic
910229151 1:84968363-84968385 CAGAGTTCTGTGGGTGTTTCCGG - Intronic
911032082 1:93499797-93499819 CAGATTTTTAAGTGTCTTTCTGG - Intronic
915970940 1:160354682-160354704 CAGAGTATGAATACTGTTTCTGG - Intronic
916080628 1:161229746-161229768 CAGTGTATCCAGGGTGTTCCAGG + Exonic
1063010000 10:2012377-2012399 CAGGGAATGGAGGGTGTTTCTGG + Intergenic
1064771036 10:18723078-18723100 AAGAATATTAAGGGTGATTCAGG + Intergenic
1064941107 10:20736542-20736564 CAGAGGATGAAGGGTCTTTGTGG + Intergenic
1065989319 10:30992355-30992377 TGGAGCATTAAGGGTGATTCTGG + Intronic
1067963628 10:50884773-50884795 CAGAGAGTTTAGGGGGTTTCTGG + Intronic
1067974713 10:51011292-51011314 TAGAGTATTACTGGTGTTACTGG - Intronic
1068065226 10:52121833-52121855 CAGAGTGTTAAGGGAAATTCTGG - Intronic
1068405235 10:56580108-56580130 AAGAATATTAAGAGTTTTTCTGG - Intergenic
1068547723 10:58368925-58368947 CACAGTCTTAAGGGTATTTTTGG - Exonic
1068860900 10:61846685-61846707 CAGAGTTTTCTGGGTGTCTCAGG + Intergenic
1069118788 10:64541763-64541785 CAGAGTATAAAGGTGGTTGCTGG + Intergenic
1071857315 10:89638890-89638912 CAGAGCATTAAATGTGGTTCTGG - Intronic
1072469371 10:95697980-95698002 TGGAGTATTAAGGGTGATTCTGG + Intergenic
1073449458 10:103601020-103601042 CAGACTATTTTGGGTATTTCTGG - Exonic
1077400404 11:2353158-2353180 CAGAGTATTAAAGGCAATTCTGG - Intergenic
1077849523 11:6062110-6062132 CAGAGGACTCAGGGTGTTCCTGG - Intergenic
1078698809 11:13661290-13661312 CAGCATTTTCAGGGTGTTTCTGG + Intergenic
1078924436 11:15861263-15861285 CAGAGAAGGAAGGGTATTTCAGG - Intergenic
1080166267 11:29241454-29241476 CAAATAATTAAGGGTGATTCTGG + Intergenic
1080863526 11:36172231-36172253 CAGAGTCTTTAGGGTTTTTTAGG + Intronic
1082782254 11:57296890-57296912 CAGACTATTAAAGGTGATTCTGG + Intergenic
1086145304 11:83544981-83545003 CTGAGCAGTAAGGGAGTTTCAGG - Intronic
1087494906 11:98879211-98879233 CAGAGCATTAAGGGCAATTCTGG - Intergenic
1087556084 11:99722728-99722750 TAGAGTATTCTGGGTGTTCCTGG + Intronic
1088537047 11:110872669-110872691 CAGAGGATGCAGGGTGTGTCTGG - Intergenic
1088567435 11:111187184-111187206 CAGAGTCTTTAGGGTTTTTTAGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089807815 11:121107107-121107129 TAGAGTATAAAAGGCGTTTCAGG - Intronic
1089832489 11:121340980-121341002 CAAATTATGAAGGGTTTTTCGGG - Intergenic
1091197391 11:133743588-133743610 CAGAGCATTAAGGGTGATTCTGG + Intergenic
1092078543 12:5693642-5693664 CAGGGTATTGAGGGGGTCTCTGG - Intronic
1092093116 12:5820408-5820430 CAGATAATTAATGGAGTTTCAGG + Intronic
1097565099 12:61258210-61258232 TAGAGTGTTAAGGGTGATTCTGG + Intergenic
1099949763 12:89288590-89288612 CAGAGCATGAAGGAGGTTTCTGG + Intergenic
1100947169 12:99799241-99799263 AAGAATATTCAGGGAGTTTCTGG - Intronic
1101470068 12:104987527-104987549 CAGAGAGTTAAGGGATTTTCCGG + Intronic
1103539783 12:121658264-121658286 CTGAATATTAAATGTGTTTCAGG + Intronic
1107336140 13:39357588-39357610 CAGAGTCTTAAGGGTTTTCTAGG - Intronic
1108173318 13:47766665-47766687 GAGAGGATTAAGGGTGTTGGAGG - Intergenic
1108960279 13:56218238-56218260 AAGAGTTTTAAGGGGTTTTCAGG - Intergenic
1109330200 13:60919598-60919620 CAGAGCAGTAAGAGTGATTCTGG - Intergenic
1109721750 13:66284178-66284200 TAGAGTATTAAGGGTCCTTCTGG - Intergenic
1109967028 13:69713961-69713983 CAATATATTCAGGGTGTTTCAGG + Intronic
1111017514 13:82400797-82400819 CAGAGTCTTTAGGGTATCTCAGG + Intergenic
1111277790 13:85973851-85973873 CAGAGCATTAAGGGTGTTGTGGG - Intergenic
1111998693 13:95190424-95190446 GAGAGGATTAAGTGTGTATCAGG + Intronic
1114904816 14:27114162-27114184 CAGAGTATTTAGGGTTCTCCAGG + Intergenic
1115838784 14:37442272-37442294 CAGAGTCTTTAGGGTATTTTAGG + Intronic
1116347855 14:43819047-43819069 CAGATAATTAAAGGTGTCTCAGG - Intergenic
1116439935 14:44939786-44939808 TAGAATGTTAAGGGTGATTCTGG - Intronic
1117271014 14:54143433-54143455 GAGGGAACTAAGGGTGTTTCTGG + Intergenic
1119609416 14:76048945-76048967 CAGTGTATTTATGGGGTTTCGGG + Intronic
1120671380 14:87366392-87366414 CAGGCTGTTAAGGGTGATTCTGG - Intergenic
1121819180 14:96952476-96952498 CAGAGTATTAAGTATGATTATGG + Intergenic
1121865932 14:97362758-97362780 CAGAGAAGGAAGGGTGTTTCTGG - Intergenic
1121881223 14:97501992-97502014 CAGACTATTAAGGATGATCCTGG + Intergenic
1122873677 14:104653009-104653031 CAGAGCATGGAGGGTGTTTACGG + Intergenic
1123104345 14:105831173-105831195 CACAGTATTTGGGGTGTCTCTGG + Intergenic
1123724825 15:23091509-23091531 CAAAGTCTTAAGTGTGTTTAGGG + Intergenic
1128230635 15:66032444-66032466 CAGAGCATTAAGGGTGATCCTGG + Intronic
1128772177 15:70290811-70290833 CAGATTTTGATGGGTGTTTCAGG + Intergenic
1129171821 15:73812520-73812542 CAGACTATTTAGGGAGGTTCTGG + Intergenic
1131722836 15:95189181-95189203 CAGAGTATTCAGGGTTTTCTAGG + Intergenic
1133393478 16:5427854-5427876 CACAGTATTCTGGATGTTTCTGG - Intergenic
1133691026 16:8215318-8215340 CAGAGGAAGAAGGGTGTTTATGG + Intergenic
1135861224 16:26057902-26057924 GAGTGTATTACGGGAGTTTCAGG + Intronic
1136243722 16:28960839-28960861 ATGAATATTAAAGGTGTTTCTGG - Intronic
1137475836 16:48809890-48809912 CAGAGCATTAAGAGTGATTTTGG - Intergenic
1142249591 16:88985294-88985316 CAGAGTGGGAAGGGTGTTTTAGG - Intergenic
1142330717 16:89451221-89451243 AATAGTTTTAAGGGTGTTTCGGG + Intronic
1143271313 17:5677280-5677302 GAGACTATTAAGAGTGATTCTGG + Intergenic
1147512185 17:41080474-41080496 GAGAGCATTAAGGGTGATTCTGG + Intergenic
1150173191 17:63021786-63021808 CAGAGCGTTAAGGGTAATTCTGG + Intronic
1155123277 18:22844156-22844178 CACAGAATTAAAGGTGTTACTGG - Intronic
1164246965 19:23439164-23439186 CAGAGGAAGAAGGTTGTTTCAGG + Intergenic
1165139436 19:33689970-33689992 CAGAGCAGGAAGGGTGATTCTGG + Intronic
1167465526 19:49649092-49649114 AAGAGTGATAAGGGTGTATCCGG + Intronic
1167833560 19:52047844-52047866 CATATTTTTATGGGTGTTTCAGG - Intronic
925352723 2:3212852-3212874 CAGAGCATCAATGGTGTTTAAGG - Intronic
927084158 2:19657885-19657907 CAGAGCATTAAGGGTGTTTTTGG - Intergenic
927835197 2:26391476-26391498 CAAAGTATGAAAGGTCTTTCAGG + Exonic
928341904 2:30450341-30450363 CACAGTATTACAGGTGTTGCTGG + Intronic
928787650 2:34908991-34909013 CAAATAATTAAGGATGTTTCAGG + Intergenic
930626072 2:53698819-53698841 TGGAGTGTTAAGGGTGATTCTGG - Intronic
935870046 2:107438331-107438353 CAAAGCATTAAGAGTGATTCTGG + Intergenic
936644201 2:114349950-114349972 CAGAGCGTTAAAGGTGATTCTGG - Intergenic
937953437 2:127405811-127405833 CAGAGCATTTAAGGTCTTTCTGG - Intergenic
939825529 2:147010926-147010948 CTGATTTTTAAGGGTGATTCTGG - Intergenic
940201325 2:151154160-151154182 CAGAATATGAAGTGTGTTTTCGG + Intergenic
942592126 2:177557405-177557427 CAGAGCATTAAGGGCAGTTCTGG + Intergenic
942817860 2:180073748-180073770 CAGAGTCTTTAGGGTTTTCCAGG - Intergenic
943275016 2:185855432-185855454 CAGAGTGTTAAGGTTGATTCTGG - Intergenic
943451159 2:188044060-188044082 CAGAGCATTAAAGGTGATTCTGG + Intergenic
943610305 2:190025286-190025308 CAGAGCATACAAGGTGTTTCAGG + Intronic
943633725 2:190282069-190282091 CGGAGCATTAAGGGTGATTCTGG - Intronic
943691212 2:190871467-190871489 CAGAGCATTAAGGGTGATTCTGG - Intergenic
945825506 2:214716489-214716511 CACAGTATTTGGGGTGTCTCCGG - Intergenic
947374645 2:229483201-229483223 CAGAGGACTAAGGTTGTTTCTGG - Intronic
949059064 2:241946351-241946373 CACAGTACTAAGGGAGTTTAAGG + Intergenic
1168733413 20:107721-107743 CAGAGTATTTGGGGTTTTCCAGG - Intergenic
1169405750 20:5319538-5319560 CAGAGAACTCAGGGTGTGTCAGG + Intergenic
1173417288 20:42868166-42868188 CAGAGTATTAAGGGTGTTTCTGG + Intronic
1175296525 20:57912592-57912614 CAGAGTCTTCAGGCTCTTTCTGG - Intergenic
1177618281 21:23554642-23554664 CAGAGCATTAAGGGCAATTCCGG + Intergenic
1179256563 21:39721592-39721614 AACACTAATAAGGGTGTTTCTGG - Intergenic
1179786892 21:43735302-43735324 CAGGGTGTTGAGTGTGTTTCTGG + Intronic
1184319015 22:43724768-43724790 CAAAGCATTATGGGTGATTCTGG - Intronic
1184875875 22:47275238-47275260 GAGAATATTAAAGATGTTTCTGG + Intergenic
949372750 3:3353274-3353296 CAGACTATTAAAAGTGATTCTGG + Intergenic
949681678 3:6520947-6520969 CAGACTATTAAGGGCTATTCTGG - Intergenic
949822016 3:8125875-8125897 CAGAGCATTAAGGGTGATTCTGG - Intergenic
951105457 3:18736854-18736876 CAGAGAATTCAGAGGGTTTCTGG + Intergenic
952149638 3:30574471-30574493 CAGATCATTAAGAGTGATTCTGG - Intergenic
952518761 3:34132948-34132970 CAGAATATAAACTGTGTTTCTGG - Intergenic
952657561 3:35804107-35804129 CAGGGCAATAAGGGTGTTTAGGG + Intergenic
952728215 3:36611901-36611923 CAGAGTCTTAAGGGTTTTCTAGG - Intergenic
953242822 3:41165063-41165085 CACATTATTAAGGATGTTTAGGG + Intergenic
956029883 3:65026065-65026087 CAGAGTGTTAAGGGAGTCTATGG + Intergenic
956082748 3:65577053-65577075 TAGAGTATTAAGTGTGTATGTGG - Intronic
956378386 3:68640149-68640171 CAGAATGTTAAGAGTGATTCTGG - Intergenic
957632886 3:82740752-82740774 CAGTGTCTGAAGGGAGTTTCAGG - Intergenic
959509172 3:107190261-107190283 CAGACTATTAAGGATGATTCTGG - Intergenic
959637584 3:108592396-108592418 GAAAGTATTAAGGGTGTGCCAGG + Intronic
960457406 3:117889761-117889783 TAGATTATTAAGGCTGTTTGGGG - Intergenic
962216595 3:133527724-133527746 CAGAGTTTTAAGGATCTTCCAGG + Intergenic
963636802 3:147808289-147808311 CACAGTATTAAGGGTTTTGGTGG - Intergenic
966141329 3:176759834-176759856 CAGAGTGTTAACAGTGTCTCAGG + Intergenic
966216344 3:177507178-177507200 CAGAACATTAATGGTGATTCTGG + Intergenic
966237156 3:177714625-177714647 CAGGATATTAAGGTTATTTCAGG + Intergenic
968034991 3:195540785-195540807 CAGGGTCTTAAGGGTGCATCTGG - Intronic
970225833 4:13855847-13855869 CAGACTGTTAAGGGTAATTCTGG + Intergenic
970898105 4:21126677-21126699 AAGAGAAATAAGAGTGTTTCTGG + Intronic
972836227 4:42873283-42873305 CAAAGTATTAAGGATTTATCTGG + Intergenic
973259428 4:48146882-48146904 CAGAGTGCTATGGGTGTTTATGG - Intronic
973580335 4:52338312-52338334 CACAGCATTAAGGGTGATTCTGG + Intergenic
974762204 4:66291750-66291772 CAGAGTCTTTAGGGTTTTCCAGG - Intergenic
976026947 4:80699456-80699478 ATGAGGATTCAGGGTGTTTCTGG - Intronic
976598968 4:86920324-86920346 TGGAGTATTAAGGGTGATTCTGG - Intronic
977371014 4:96136249-96136271 GAGAGTTTTCAGGGTGATTCAGG + Intergenic
977702142 4:100033105-100033127 CAGAATATTAAGGATGGTTTTGG - Intergenic
978526878 4:109676504-109676526 CAGAGTATTAAGGGCAATTCTGG - Intronic
981052401 4:140322311-140322333 AAGAGCATTGAGGGTGATTCTGG + Intronic
981548347 4:145917081-145917103 CAGAGCATTAAGGGCAATTCTGG - Intronic
984266831 4:177506081-177506103 CACAGTATTTGGGGTGTCTCTGG + Intergenic
985093466 4:186388209-186388231 CAGAGTATTTAGGATTTTCCAGG - Intergenic
986471022 5:8075072-8075094 CAGAGTCTTTAGGGTTTTCCAGG - Intergenic
990161234 5:52942972-52942994 CAGAGTCTTAAGGGTTTTCTAGG + Intronic
992174407 5:74135225-74135247 CAAAATACTAAGGGTGTGTCAGG + Intergenic
994889816 5:105619131-105619153 TGGAGTATTAAGGGTGATTCTGG + Intergenic
995066296 5:107867157-107867179 CAGAGGATTAAAGGAGTTTGGGG - Intronic
995596811 5:113756167-113756189 CTGAGAAATAAGTGTGTTTCAGG - Intergenic
996234636 5:121110370-121110392 CAGTGTATTACTGGTATTTCTGG + Intergenic
996611090 5:125381534-125381556 CAGAGCATTAAGTGTGATTCTGG + Intergenic
999905797 5:156140303-156140325 CTGAGCATTAAGGGTGCTTCTGG + Intronic
1000577781 5:162995752-162995774 CAGGCTATTAAGTTTGTTTCTGG + Intergenic
1006359138 6:33577742-33577764 CAGAGGACTAAGGGCCTTTCTGG - Intronic
1007191919 6:40026672-40026694 CAGACTGTAAAGGGTGATTCTGG + Intergenic
1007947210 6:45837347-45837369 CAGAGGAAGAAGGGTATTTCGGG + Intergenic
1008335032 6:50292974-50292996 CAGAGTATCATGGTGGTTTCTGG - Intergenic
1008789906 6:55217750-55217772 TAGAGTGTTAAGGGTGCTTCTGG - Intronic
1011862353 6:91775319-91775341 CAGAGTCTTTAGGGTTTTTTAGG - Intergenic
1013376536 6:109521003-109521025 CAGAGTCTTTAGGGTTTTACAGG + Intronic
1014775681 6:125507032-125507054 ATGAGCATTAAGGGTGATTCTGG + Intergenic
1015642688 6:135352973-135352995 CAGAATTTTAAGAGTTTTTCAGG + Intronic
1020525071 7:9249093-9249115 AAGATTATTAAAGGTCTTTCAGG + Intergenic
1021207455 7:17801377-17801399 CAGAGGATGAAGGGCTTTTCTGG + Intronic
1021848931 7:24789139-24789161 GGGAGTGCTAAGGGTGTTTCTGG + Intergenic
1024577546 7:50776899-50776921 CAGAGCATTAAGAATGATTCTGG - Intronic
1027485439 7:78755964-78755986 CAGACTAATAATGGTGTTTGGGG - Intronic
1027742618 7:82030490-82030512 AAGAGTATAAAGGTTTTTTCAGG - Intronic
1030464001 7:109876594-109876616 CAGAGTATAAAGGATCTTTGAGG + Intergenic
1033552667 7:142462155-142462177 CAGAGCATTAAGGGCAATTCTGG + Intergenic
1033559589 7:142518979-142519001 CAGAGCATTAAGGGCATTTCTGG + Intergenic
1036446205 8:8823433-8823455 CAGAGGACTCACGGTGTTTCGGG - Intronic
1037869208 8:22476448-22476470 CACTGTACTAAGTGTGTTTCTGG + Intronic
1038380723 8:27090693-27090715 CAGAGCATTAAGGATGATTCTGG - Intergenic
1041300288 8:56404378-56404400 CAGAGTGTTAAGGGTGATTTTGG + Intergenic
1042169046 8:65974658-65974680 CAGAGCACTAAGGGTGATTCTGG + Intergenic
1046552833 8:115738505-115738527 CAGATTATGAAGGGTCTATCTGG - Intronic
1047596299 8:126381032-126381054 CAGAGTGGAAAGGATGTTTCTGG - Intergenic
1048190625 8:132285224-132285246 TGGAGTATTAAGGGTGATTCTGG + Intronic
1056288811 9:85120171-85120193 TGGAGCATTAAGGGTGATTCTGG - Intergenic
1058327128 9:103712598-103712620 CAGAGTATTTAGGGTTTTTTAGG + Intergenic
1058382403 9:104391982-104392004 TTGAGTATTAACTGTGTTTCAGG - Intergenic
1058572875 9:106366268-106366290 CAGAGCATCAAGGGTCTTTGTGG - Intergenic
1059877036 9:118646353-118646375 CAGAGCATTAAGTGTGATTCTGG + Intergenic
1187334622 X:18371402-18371424 TAGAGCATTAAGGGTGATTCTGG + Intergenic
1187576416 X:20561184-20561206 TGGAGCATTAAGGGTGATTCTGG + Intergenic
1187612367 X:20956297-20956319 CGGATGATTAAGGGTGATTCTGG - Intergenic
1188349321 X:29108066-29108088 CAGAATAAAAAGGGAGTTTCTGG - Intronic
1189421948 X:40864014-40864036 CAGAGCATTAAGGGCAATTCTGG - Intergenic
1189904268 X:45741931-45741953 CAGAGCATTAAGGATGATTCTGG + Intergenic
1190421067 X:50285070-50285092 CAGAGAATTTATCGTGTTTCTGG + Intronic
1192538783 X:71950540-71950562 CAGAGTATTGTGGCTGTTTCAGG + Intergenic
1194108145 X:89797561-89797583 CAGAGCATTAAGGATGATTCTGG + Intergenic
1194452925 X:94066881-94066903 GAGAGAATTAAAGGTGTTCCAGG - Intergenic
1194505841 X:94732378-94732400 CAGACTACTAAGGGTGCTTCTGG + Intergenic
1195591641 X:106635054-106635076 GTGAGTATTAAGGGGGCTTCAGG + Intronic
1197599164 X:128507457-128507479 TAGAGTATTAAGGGCAATTCTGG + Intergenic
1199244341 X:145585181-145585203 CAGAGTATTGAAGAGGTTTCTGG - Intergenic
1200460802 Y:3452290-3452312 CAGAGCATTAAGGGTGATTCTGG + Intergenic