ID: 1173421378

View in Genome Browser
Species Human (GRCh38)
Location 20:42904422-42904444
Sequence GCCAAGGTCATGCAACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173421378_1173421381 7 Left 1173421378 20:42904422-42904444 CCAGCTGGTTGCATGACCTTGGC 0: 1
1: 0
2: 5
3: 29
4: 241
Right 1173421381 20:42904452-42904474 CTTTCTGTTTAAAATGGATCTGG 0: 1
1: 0
2: 1
3: 22
4: 253
1173421378_1173421382 11 Left 1173421378 20:42904422-42904444 CCAGCTGGTTGCATGACCTTGGC 0: 1
1: 0
2: 5
3: 29
4: 241
Right 1173421382 20:42904456-42904478 CTGTTTAAAATGGATCTGGCTGG 0: 1
1: 0
2: 5
3: 17
4: 180
1173421378_1173421380 1 Left 1173421378 20:42904422-42904444 CCAGCTGGTTGCATGACCTTGGC 0: 1
1: 0
2: 5
3: 29
4: 241
Right 1173421380 20:42904446-42904468 GAGTCACTTTCTGTTTAAAATGG 0: 1
1: 0
2: 3
3: 22
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173421378 Original CRISPR GCCAAGGTCATGCAACCAGC TGG (reversed) Intronic
900102358 1:967290-967312 GCCAAGGCCATGCAGCAAGGAGG + Intronic
901599347 1:10410534-10410556 GCCCAGGTCATCCAAACACCTGG + Intronic
903035008 1:20487201-20487223 CCCAAGGTCATGCCAGCTGCTGG + Intergenic
904796208 1:33058263-33058285 GCCAAGGCCACACAACCAGAGGG + Intronic
905277012 1:36824851-36824873 GCCAAGGTCATACAAGCAATAGG - Intronic
906024195 1:42658830-42658852 GCCAACTTCCTGCAATCAGCGGG - Exonic
906331485 1:44888775-44888797 GCCAAGGACATAAAACCAGATGG - Intronic
906680589 1:47723308-47723330 GGCAAGGTCATGCCACCCGCAGG - Intergenic
906940101 1:50248483-50248505 GCCAAGGTCAGACACCCAGGAGG + Intergenic
907555035 1:55336045-55336067 TCCAAGATTATGCAGCCAGCTGG + Intergenic
907914664 1:58857780-58857802 GGCATGGTCATGGAACCAGGAGG + Intergenic
908500158 1:64734902-64734924 GCCAAGGCCAGGAAGCCAGCTGG + Intergenic
908644766 1:66265539-66265561 GCCAAGGTCACACAACCACTGGG - Intronic
908710079 1:67005230-67005252 GCCCAGGTCAGGCATCCAGCTGG - Intronic
911329908 1:96515067-96515089 TCCAGGGTCATGCAGCCAGCAGG + Intergenic
912565186 1:110582444-110582466 TCCAAGGTCATGCAGCTGGCAGG - Intergenic
912994463 1:114519057-114519079 TCCAAGGTCATGAAGCCAGTAGG - Intergenic
918066904 1:181107607-181107629 GACAAGGTCATCCAACCTTCTGG + Intergenic
919777871 1:201205958-201205980 GTCCAGGTCAGGCAAGCAGCTGG + Intronic
920666326 1:207965130-207965152 GCCCAGGTCACTCAGCCAGCTGG + Intergenic
924170907 1:241339770-241339792 GCCAATGGGATGCAAACAGCTGG - Intronic
1063610446 10:7557536-7557558 GCCATGGTCATCCCACCCGCAGG - Intergenic
1063916874 10:10892302-10892324 GCCAAGGTCACTCACCCACCTGG + Intergenic
1065498615 10:26355760-26355782 GCCAAGATCATAGCACCAGCAGG + Intergenic
1069579012 10:69552442-69552464 CACAAGGTCAGGCTACCAGCTGG + Intergenic
1069865790 10:71501979-71502001 GCCAAGGAGTTGCAAACAGCAGG - Intronic
1070056629 10:72941289-72941311 GACAAAGTGCTGCAACCAGCTGG - Exonic
1070633952 10:78108966-78108988 GCCAAGGTCAAGCAACTAATAGG + Intergenic
1072989877 10:100182470-100182492 TCCAAAGTCATGCCACCAACTGG + Intronic
1073036212 10:100565796-100565818 GCCAAGGTCACACAGCCAGTTGG + Intergenic
1074113556 10:110439234-110439256 CCCAAGGTCTTCCAGCCAGCAGG + Intergenic
1076045037 10:127285682-127285704 GCCAAGGTCATGCCATCTTCTGG + Intronic
1076707456 10:132309369-132309391 GCCTAGGACATGCACCCACCTGG + Intronic
1077230764 11:1457328-1457350 CCCAGGGTCATGCCTCCAGCAGG + Intronic
1078756526 11:14215955-14215977 GCCAATGTGATGCAAACAGAAGG - Intronic
1079469404 11:20763954-20763976 GGCAAGGTAATGCAGCCAACTGG + Intronic
1080029152 11:27642739-27642761 TCCAAGATCATGGCACCAGCAGG - Intergenic
1083233128 11:61335688-61335710 CCCAAGGTCACACAGCCAGCAGG - Intronic
1084939582 11:72605308-72605330 GGCAAGGTCATGGAACCTGTGGG + Intronic
1085118698 11:73952765-73952787 GCCCAGGTCACGCAGCTAGCAGG - Intronic
1085896071 11:80641296-80641318 GCTAAGGTCATGCATGCAACAGG - Intergenic
1088190412 11:107222134-107222156 TCCAAGGTCATAAAACTAGCAGG + Intergenic
1089042861 11:115469990-115470012 ACCAAGGTCATGGAAGCAGAAGG - Intronic
1089220603 11:116868081-116868103 GCCAAGTACCTGCAACAAGCAGG + Exonic
1089768569 11:120786154-120786176 CCCAAGGCCATGGCACCAGCGGG - Intronic
1090494110 11:127193043-127193065 TACTAGGTCATGCAACCAGTAGG - Intergenic
1090979227 11:131702464-131702486 TCCAAGGTCACACAACGAGCAGG + Intronic
1091167104 11:133488923-133488945 GCCATGTACCTGCAACCAGCTGG + Intronic
1092033338 12:5308591-5308613 GCCCAGGTCTTGCACACAGCAGG - Intergenic
1096598224 12:52710919-52710941 TCCAAGGTCATGTAACTAGAAGG - Intergenic
1097590909 12:61574024-61574046 TCCAAGGTCAAGGCACCAGCAGG - Intergenic
1098147962 12:67516935-67516957 CCCAAGGTTATGCAGCTAGCAGG + Intergenic
1100673510 12:96841839-96841861 TCCAAGGTCATACAACCAATAGG - Intronic
1100891205 12:99128011-99128033 CCCAAGGTCGTTCAACCAACTGG - Intronic
1101627177 12:106456696-106456718 GCCAAGGTCATCCAAAAAGTTGG - Intronic
1102347389 12:112168706-112168728 CCCAAGGTCATGCAGCCAGCTGG - Intronic
1102434158 12:112907613-112907635 CTCAAGGTCTTGCAGCCAGCAGG - Intronic
1102474882 12:113182196-113182218 CCCAAGGTCACACAGCCAGCAGG + Intronic
1102889923 12:116550621-116550643 CCCAAGGTCATGCAGCTAGATGG - Intergenic
1103450871 12:121027925-121027947 GCCAAGGTCACACAGCCAGTAGG - Intronic
1105427026 13:20302668-20302690 TCCAAAGTCATGGAACCAGTGGG + Intergenic
1105823107 13:24097324-24097346 CCCAAGGTCATGCAACTAGTAGG + Intronic
1106301403 13:28469448-28469470 GCCAAGGTCATGCAGTCAGTAGG - Intronic
1106990426 13:35412850-35412872 CCCAAGATCATACAACTAGCTGG - Intronic
1107977401 13:45703535-45703557 ACCAGGGCCATGCAACCAGAGGG + Intronic
1109161092 13:58975426-58975448 GCCAAGGTCATGTCACCGACAGG - Intergenic
1114715761 14:24822218-24822240 GCCCAGGTCCTGAATCCAGCCGG + Intronic
1116812270 14:49550532-49550554 GAAAAGGTTATGCAACCAGGGGG - Intergenic
1119582029 14:75793634-75793656 ATCAAGGTCATTCAACAAGCTGG + Intronic
1119738322 14:76998214-76998236 GCCAAGGTCATGCCACAGGGTGG - Intergenic
1121404482 14:93711120-93711142 TCCAAGATCATGCAGCTAGCGGG + Intergenic
1121509741 14:94503505-94503527 GACCAGGTCAGGCAAACAGCTGG - Intronic
1122438904 14:101716861-101716883 GCCCATGTCCTGCAGCCAGCAGG - Intergenic
1123943319 15:25227066-25227088 CCCCAGCTCATGCATCCAGCAGG - Intergenic
1124027819 15:25982990-25983012 CCCAAGGGCATGCACCCTGCTGG + Intergenic
1124170188 15:27366256-27366278 CCCACGGTCATGCAGCCAGCTGG + Intronic
1124723628 15:32135085-32135107 GCCAAGGTCATGCAGAAAGCAGG + Intronic
1125492926 15:40161549-40161571 CCCAAGGTCAAACAACTAGCAGG - Intronic
1126388028 15:48113929-48113951 CCCAAGGTCAAACATCCAGCAGG + Intergenic
1127026424 15:54812367-54812389 GCCAAGGTCATTCACACAGGTGG + Intergenic
1128376499 15:67080237-67080259 CCCAAGGTCATGCAACAAGTTGG + Intronic
1128747316 15:70123616-70123638 TCCAAGGTCGTGCAATTAGCAGG - Intergenic
1129775529 15:78233965-78233987 GCCAAGGTCACGCAGCAAACTGG + Intronic
1130194783 15:81769068-81769090 GCCAAGGTCATGCTTCCACTTGG - Intergenic
1131988447 15:98068242-98068264 GCCAACGTCATGCAACTCGCAGG + Intergenic
1132110596 15:99099683-99099705 GACCAGGTCATGCACCCAGTGGG + Intronic
1132680099 16:1136650-1136672 GCCAAAGTCATGAAAACACCAGG - Intergenic
1133025175 16:2986059-2986081 TCCAAGGTCATGCCAGCACCAGG + Intergenic
1133441131 16:5821742-5821764 TCCAAGGTCAAGGCACCAGCAGG + Intergenic
1134717600 16:16364650-16364672 GCCAGGCACATGCCACCAGCCGG - Intergenic
1134826482 16:17288515-17288537 GCCAAGGGCAAGCATACAGCAGG - Intronic
1134957152 16:18387509-18387531 GCCAGGCACATGCCACCAGCCGG + Intergenic
1135187182 16:20325168-20325190 GCCAAGGTCACCCAGCCAGCAGG - Intronic
1136058710 16:27709921-27709943 GCCAAGGTCATGCAGCTGGAAGG + Intronic
1138456038 16:57121287-57121309 CTCAAGGTCATGCAGCCAGAAGG - Intronic
1138963440 16:62054696-62054718 GGTAAGGTCATGCAAACAGGTGG - Intergenic
1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG + Intronic
1139750934 16:69108370-69108392 GGCAAGGTCAGGCAGCCAGGAGG + Intronic
1140953364 16:79839896-79839918 GCCAAGGTCAAGCAGCACGCAGG - Intergenic
1141582636 16:85011028-85011050 CCCAAGGTCAGGCAAAAAGCTGG + Intronic
1146574440 17:33979048-33979070 ACCAAGGCCCTGGAACCAGCTGG - Intronic
1147575582 17:41597241-41597263 GCCAATTTCAAGCAACCAACAGG + Intergenic
1148204377 17:45770737-45770759 ATCAAGGTCATGCAGCCAGTTGG + Intergenic
1148830708 17:50429161-50429183 CCCGAGGTCATACAACCAACAGG - Intronic
1148895688 17:50837812-50837834 GCCAAGGTCATGCCATTAGTTGG + Intronic
1149639214 17:58192386-58192408 CCCAAGGCCATGCAGCCAGGCGG + Intergenic
1150966553 17:69976379-69976401 ACCAAGGTCATGCAAATAGATGG - Intergenic
1151103588 17:71585321-71585343 GCAGAGGTTAAGCAACCAGCTGG - Intergenic
1151182197 17:72337375-72337397 GCCAAGGCAAGGCAACCAGAAGG - Intergenic
1151629840 17:75302997-75303019 CCCAAGGTCACATAACCAGCAGG + Intergenic
1151699757 17:75736973-75736995 GGCAGGGGCATGCACCCAGCAGG + Intronic
1152510466 17:80783602-80783624 GCCAGGCTCATGCATCCAGCAGG + Intronic
1153092847 18:1368504-1368526 TCCAAGATCATGGCACCAGCTGG + Intergenic
1154266960 18:12886782-12886804 TCCAAGGTCAAGGCACCAGCAGG - Intronic
1156263042 18:35462355-35462377 GCCCAGGTGATGCTACCAGGAGG + Intronic
1157087760 18:44599180-44599202 TGAAAGGTCATACAACCAGCTGG - Intergenic
1157193575 18:45601205-45601227 GCCAAGGTCATGAAGCCAGTTGG - Intronic
1157452011 18:47795818-47795840 AACAAGATCATGCAACCAACTGG + Intergenic
1157625578 18:49047995-49048017 TGCAAGGTCATGCAGCCTGCTGG + Intronic
1159124482 18:64207222-64207244 GCCAAGGTCACACAGCCAGTTGG - Intergenic
1159150779 18:64520427-64520449 TCCAAGATCAAGCCACCAGCAGG - Intergenic
1159840806 18:73396384-73396406 TCCAAGGTCAAGCTGCCAGCTGG - Intergenic
1160747573 19:719232-719254 GCCAAGGTCACCCAGCGAGCAGG - Intronic
1160811066 19:1013127-1013149 GTCCAGGACATGCAGCCAGCAGG + Intronic
1160979415 19:1810075-1810097 TCCAAGGCCATACATCCAGCTGG + Intronic
1162412875 19:10517212-10517234 TCCCAGGTCCTGCACCCAGCTGG + Intronic
1163219238 19:15902734-15902756 TCCAAGGTCAAGCAATCAGGAGG - Intergenic
1163572316 19:18089852-18089874 GCCAGGGTCAGGCGCCCAGCAGG + Intronic
1164707533 19:30331571-30331593 GTCAAGGTCATGCATCCAACAGG + Intronic
1164997431 19:32732527-32732549 GCCAAAGTCATGCAACCAAAAGG - Intronic
1167518553 19:49938206-49938228 CCCAAGGTCACACAGCCAGCAGG - Intronic
1167595232 19:50423880-50423902 CCCAAGGTCACACAGCCAGCAGG - Intronic
926780679 2:16468577-16468599 TCCAAGGTCATGCAGCTTGCAGG - Intergenic
928826994 2:35434980-35435002 GCAAATGTCAGGCAACCATCAGG + Intergenic
929795830 2:45057786-45057808 TCCAAGATCAAGCCACCAGCAGG - Intergenic
932521364 2:72416875-72416897 GTCAAGGTCCTGCAAAAAGCAGG - Intronic
933875689 2:86619421-86619443 CCCAAGGTCATGGAACTAGTTGG - Intronic
933974503 2:87497367-87497389 GCCTAGGTCAGGCAACCGTCTGG - Intergenic
934718231 2:96555321-96555343 GCCAAGGTCAGGCAAGAAGTGGG + Intergenic
936319321 2:111453452-111453474 GCCTAGGTCAGGCAACCATCTGG + Intergenic
936842890 2:116795007-116795029 ACCAAGGTCTAGCAACCAACTGG - Intergenic
937230889 2:120397563-120397585 GCCTAGGTCAGGCACCGAGCTGG - Intergenic
939420839 2:141966475-141966497 GCTGAGGTCAAGCAAGCAGCAGG + Intronic
941620353 2:167771071-167771093 CCCAAGGACATACAGCCAGCAGG - Intergenic
941917849 2:170823746-170823768 GTCATTGTCATGCAGCCAGCCGG + Intronic
942291747 2:174479461-174479483 TCCCAGGTCATACAACTAGCAGG - Intronic
944837926 2:203598072-203598094 GCCCAGCTCCGGCAACCAGCAGG - Intergenic
1168814114 20:725032-725054 GCCAAGGTCACACAGCCAGTAGG + Intergenic
1171394786 20:24825008-24825030 TCCAAGGTCAAGGAGCCAGCAGG + Intergenic
1172027265 20:31957004-31957026 CCCAAGGTCATGCAGCCAGATGG + Intergenic
1172230127 20:33330811-33330833 CCCATGGTCATGCAGCCAGGAGG - Intergenic
1172767151 20:37356881-37356903 GCCAAGGTCTGCCAGCCAGCAGG - Intronic
1173421378 20:42904422-42904444 GCCAAGGTCATGCAACCAGCTGG - Intronic
1173732752 20:45339970-45339992 GCCAAGGTCATCCAAGCAGCTGG + Intronic
1173814474 20:45976375-45976397 TCCAAGGTCATGCAGCCAGGAGG + Intergenic
1174435366 20:50502778-50502800 ACCAAGGTCATACAGCCAGTAGG - Intergenic
1174757941 20:53178089-53178111 ATCCAGGTCATGCAACCAGTAGG - Intronic
1175185715 20:57178534-57178556 GTCAAGGTCAAGGAACCATCTGG + Intronic
1175450072 20:59057870-59057892 GCCAAGGTCATAAAAACAGATGG + Intergenic
1178279055 21:31265368-31265390 CCCAAGGTCAAACAACTAGCTGG + Intronic
1178582822 21:33850548-33850570 TCCCAGGTCTAGCAACCAGCAGG + Intronic
1178631278 21:34263559-34263581 GACAAGGGCATGCAAGGAGCTGG - Intergenic
1178774008 21:35531603-35531625 GCCATGGTCATACAACCATGGGG + Intronic
1178836149 21:36099238-36099260 GCCAAGGACATGAAACAAGATGG - Intergenic
1179263487 21:39779849-39779871 GCCAAGCTCATGGAAACAGGAGG + Intronic
1179571768 21:42282728-42282750 GCCAAGGTCATGGGACGACCTGG + Intronic
1180844978 22:18975975-18975997 CCCAAGGTCATACAGCAAGCCGG - Intergenic
1183318330 22:37149018-37149040 GCCAGGGTCCCGCACCCAGCTGG - Intronic
1184473223 22:44707457-44707479 GCCAAGGGCATGCCGGCAGCTGG - Intronic
1184780679 22:46647753-46647775 GCCAAGGTCCTGCATGCAGTGGG + Intronic
1184788802 22:46686466-46686488 GCCAAGGTCATGCTCCCAGCCGG + Exonic
1184973280 22:48043093-48043115 GCCAGGGTCCTGCCAGCAGCTGG - Intergenic
1185006115 22:48277946-48277968 GACAAGGCCAGGCTACCAGCCGG - Intergenic
1185307858 22:50131938-50131960 CCCAAGGTCAAGGCACCAGCAGG + Intronic
949217236 3:1584138-1584160 GCCAAGCTCAGAGAACCAGCAGG + Intergenic
949927042 3:9049612-9049634 GCCAGGGGCTTGTAACCAGCTGG + Intronic
950135963 3:10581122-10581144 CCCAAGGTCATGCAACCAGTAGG + Intronic
950683606 3:14601923-14601945 CCCAAGGTCACACAGCCAGCAGG - Intergenic
951761574 3:26153115-26153137 CTCAAGGTCCTGCAACCAGTGGG + Intergenic
952067566 3:29590218-29590240 GCCAAGGTCACACAGCCAGGTGG - Intronic
952412885 3:33065159-33065181 GCTAAGGTCACCCAGCCAGCAGG - Intronic
952698332 3:36297011-36297033 CTCAAGGTCATGCAGTCAGCAGG - Intergenic
953619052 3:44516890-44516912 GAAATGGGCATGCAACCAGCTGG - Intergenic
955405938 3:58625830-58625852 GCCAGGGTCATGCAGCTAGTGGG - Intronic
956410137 3:68970644-68970666 GCTGAGGTCATTCAATCAGCAGG - Intergenic
957482002 3:80810202-80810224 CCCAAGATCATGCAACCAATAGG - Intergenic
963324802 3:143851012-143851034 GCCAAGGTCACACAGCCAGTAGG + Intergenic
965469667 3:169075157-169075179 GACAAGGTCATGACACTAGCTGG + Intergenic
967233427 3:187362920-187362942 GCCAATGTCAGGAAACAAGCAGG - Intergenic
967680735 3:192360494-192360516 GACAAGGTTATTCAGCCAGCAGG - Exonic
969317818 4:6392676-6392698 GCCGGGGTCCTGCACCCAGCAGG + Intronic
969607509 4:8209984-8210006 GCCCAGGTCCTGCACCCAGAGGG + Intronic
971054402 4:22896415-22896437 TCCAAGATCAAGGAACCAGCAGG - Intergenic
971915397 4:32864308-32864330 ACCCAGGTCATGCAATCAGAAGG + Intergenic
979210373 4:118093860-118093882 TCCAAGGTCAAGGCACCAGCAGG + Intronic
980886774 4:138770949-138770971 TCCAAGGTCAGGGCACCAGCGGG - Intergenic
981907419 4:149937788-149937810 TCCAAGGTCAAGGAACCAGCTGG - Intergenic
981911840 4:149991052-149991074 GCCAAGCTCAAGGCACCAGCAGG + Intergenic
982605199 4:157507273-157507295 GCCAAGTTCATGCTTCCTGCAGG - Intergenic
982744002 4:159087459-159087481 GCCAAGGGCAAGCACCAAGCAGG + Intergenic
986486780 5:8245750-8245772 GGAAAGGTCATGCAACCAAGAGG + Intergenic
987067763 5:14306605-14306627 GGCAAGGGCATGCAGACAGCTGG - Intronic
990982163 5:61611768-61611790 CCCAAGGTCATGCAGCTAGCAGG + Intergenic
991609206 5:68433526-68433548 CTCACAGTCATGCAACCAGCAGG - Intergenic
992982895 5:82195111-82195133 ACCAAGTTCATGGGACCAGCAGG - Intronic
997214615 5:132100560-132100582 TCCAAGGTCTGGCAACTAGCAGG + Intergenic
998133352 5:139662043-139662065 CCCCAGGTCAGGGAACCAGCTGG - Intronic
999097402 5:148992227-148992249 CCCAAGGTCATGCACACAGTGGG + Intronic
999275587 5:150327834-150327856 GTCAAGGTCATGCAGCAATCAGG + Intronic
999302267 5:150498601-150498623 GGCAGGGTTATGTAACCAGCCGG + Intronic
999311571 5:150555057-150555079 GCCGACGTCATGGAGCCAGCTGG + Exonic
1000291231 5:159873391-159873413 GCCAAGCTCATGCTGACAGCTGG - Intergenic
1000570576 5:162908408-162908430 TCCAAGGTCATGCAACTTGCTGG - Intergenic
1001527053 5:172436541-172436563 CCCAAGGTCCTGTAGCCAGCAGG + Intronic
1001587796 5:172845061-172845083 GCCGAGGTCACACAAACAGCAGG + Intronic
1001930772 5:175671343-175671365 GCAGAAGTCCTGCAACCAGCTGG - Intronic
1002535989 5:179875856-179875878 GCCACCCTCATGGAACCAGCAGG + Intronic
1002938367 6:1693962-1693984 CCCAAGGTTATACAACTAGCAGG + Intronic
1003513548 6:6801111-6801133 GCCCAAGTCCTGCCACCAGCTGG - Intergenic
1004161899 6:13221568-13221590 GCCAAGGTCACACAACCAGAGGG - Intronic
1005451181 6:25974242-25974264 GCCAAAGTCCTGCAACCATCAGG - Intronic
1005470331 6:26156766-26156788 GCCAAGGCCAAGAAGCCAGCAGG + Exonic
1006908829 6:37550735-37550757 CCCAAGGTCATGCATCGTGCAGG - Intergenic
1007119546 6:39368734-39368756 GCCAAGGGCATGGAACAGGCTGG - Intronic
1008830676 6:55756839-55756861 GCCAAGGCCATTGAAACAGCAGG - Intronic
1009763146 6:68034920-68034942 TCCAAGGTCAAGGCACCAGCAGG - Intergenic
1011158064 6:84355879-84355901 GCCAAGGTGAAGCAAGCAACAGG - Intergenic
1011722696 6:90175790-90175812 GTCAAAGGCATGCTACCAGCCGG - Intronic
1012692206 6:102328118-102328140 GCCAAGGATATGCTACAAGCAGG + Intergenic
1016673120 6:146731510-146731532 GCCAAGATCCTGCACCCATCAGG - Intronic
1018429031 6:163709248-163709270 CCCCAGGTCATGCACCCAGGGGG - Intergenic
1019014751 6:168871798-168871820 CCCACGGCCATGCAGCCAGCCGG + Intergenic
1019368945 7:650789-650811 GCCAAGGTCACGTGGCCAGCAGG + Intronic
1019690164 7:2405946-2405968 CCCAAGGTCAGCCAACCAACGGG - Intronic
1020429589 7:8105354-8105376 GCCACAGTCATTGAACCAGCAGG - Intergenic
1023090385 7:36611932-36611954 CCCAAGGTCATACAACTAACAGG - Intronic
1023712295 7:43007974-43007996 CTCAAGGTCATGCAACTAGTAGG - Intergenic
1023865334 7:44235685-44235707 GCCAGGGCCATGCGGCCAGCCGG + Intronic
1024055525 7:45657854-45657876 GCCAATGTCATGGAAGCCGCTGG + Exonic
1024208789 7:47186318-47186340 GCCATGGTCCTGCAGCTAGCTGG - Intergenic
1024974918 7:55104444-55104466 GCCAAGGTCATCCAGCCAATAGG - Intronic
1029452373 7:100648356-100648378 GCTGAGGTCATGAAACCAGCTGG - Intronic
1029463905 7:100713195-100713217 GCAAAGGTCATCCTACCAGAAGG + Intergenic
1029647890 7:101869603-101869625 GCCAAGGTCAGGCGGCCAGCAGG + Intronic
1033919832 7:146376967-146376989 GCCAAGATCAAGGAACCTGCAGG - Intronic
1037701068 8:21274151-21274173 GCCAAGGTCATGCAGCAAAAGGG - Intergenic
1037961018 8:23098415-23098437 GCCATGCTCATGCAGCCTGCAGG - Intronic
1038687099 8:29728633-29728655 GCCAAGGTCTTGGTGCCAGCAGG + Intergenic
1041718270 8:60951609-60951631 CCCAAGGTCAAGGAACAAGCAGG + Intergenic
1043593982 8:81863437-81863459 GCCAATGAGATGCAGCCAGCAGG + Intergenic
1044019579 8:87087885-87087907 GCAAAGGTCATGCGGTCAGCAGG + Intronic
1047668108 8:127114755-127114777 GCCAAGGCCCTGCAGCCAGAAGG - Intergenic
1048037633 8:130692698-130692720 GCCAAGCTCAGGGAACCAGCAGG - Intergenic
1048731359 8:137444372-137444394 TCCAAGGTTATGGCACCAGCAGG - Intergenic
1049208140 8:141372872-141372894 CCCAAGGTCATGCAGCTAGGAGG + Intergenic
1049415418 8:142492772-142492794 GCCTGGGTCATGCAAGCAGGGGG - Intronic
1051813757 9:21080215-21080237 GCCAAGGTCTTGCTAAGAGCTGG - Intergenic
1052139413 9:24960403-24960425 TCCAAGTTCAGGCAACCAGTGGG - Intergenic
1055288935 9:74762322-74762344 GCCAAGATCATGCAAACTGGAGG - Exonic
1055794769 9:79964030-79964052 GCCAAGATCATGCAACCGGGAGG + Intergenic
1056222621 9:84465264-84465286 GCTCAGGTCATGCAATAAGCTGG - Intergenic
1058677569 9:107413487-107413509 CCCAAGGGCATGAAACCAGAGGG - Intergenic
1059403547 9:114085764-114085786 CCCAAGGTCACGCAGCCAGTGGG - Intergenic
1059635100 9:116162547-116162569 CCCAAGGTCACACAACCAGCAGG - Intronic
1061220020 9:129245133-129245155 TCCAAGGTCACACAGCCAGCGGG + Intergenic
1061753379 9:132796121-132796143 CCCAAGGTCATCTAGCCAGCTGG + Intronic
1061884065 9:133582789-133582811 CCCAAGGTCAAGCGACCAGCAGG - Intronic
1061886413 9:133593204-133593226 GCCAAGGCAATGCAGCCAGCAGG + Intergenic
1062254923 9:135616374-135616396 ACCAGGGTCATGCAGCCAGGAGG - Intergenic
1062746751 9:138217860-138217882 GCCCAGGTCATGAAAGGAGCTGG - Intergenic
1189069465 X:37848301-37848323 CCCAAGGTCATACAGCCAGTAGG + Intronic
1195427488 X:104750922-104750944 TCAAAGGTCATGCAACCAGCTGG - Intronic
1197725543 X:129773975-129773997 CCCAAGGTTATGCAGCCAGTAGG + Intergenic
1202255264 Y:22914129-22914151 GCCAGGGTCATGTAACAAGAGGG + Intergenic
1202408255 Y:24547878-24547900 GCCAGGGTCATGTAACAAGAGGG + Intergenic
1202462527 Y:25122202-25122224 GCCAGGGTCATGTAACAAGAGGG - Intergenic