ID: 1173422485

View in Genome Browser
Species Human (GRCh38)
Location 20:42914911-42914933
Sequence AGCCCCTGCCTCACACAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173422485_1173422488 -3 Left 1173422485 20:42914911-42914933 CCAATCTGTGTGAGGCAGGGGCT No data
Right 1173422488 20:42914931-42914953 GCTTGGAAAACATGACGCTAGGG No data
1173422485_1173422487 -4 Left 1173422485 20:42914911-42914933 CCAATCTGTGTGAGGCAGGGGCT No data
Right 1173422487 20:42914930-42914952 GGCTTGGAAAACATGACGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173422485 Original CRISPR AGCCCCTGCCTCACACAGAT TGG (reversed) Intronic