ID: 1173422881

View in Genome Browser
Species Human (GRCh38)
Location 20:42918286-42918308
Sequence AGCTGTTACCTGGAGATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173422881_1173422892 25 Left 1173422881 20:42918286-42918308 CCCCCCATCTCCAGGTAACAGCT 0: 1
1: 0
2: 1
3: 14
4: 261
Right 1173422892 20:42918334-42918356 TACAGCTTAGATAAGACTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173422881 Original CRISPR AGCTGTTACCTGGAGATGGG GGG (reversed) Intronic
900370113 1:2328512-2328534 ACCTGTCACCTGGAGGTGGCCGG + Intronic
901015222 1:6225539-6225561 AGCTCACACCTGGAGGTGGGGGG - Intronic
904003962 1:27353699-27353721 AGCTGCTGCCTGGATGTGGGTGG - Exonic
904840734 1:33370334-33370356 AGCTGGGAGCTGGAGAAGGGTGG - Intronic
905872241 1:41411741-41411763 AGCTGAGACCCAGAGATGGGTGG + Intergenic
906088347 1:43155784-43155806 AAATGTTACCAGGAGATGAGAGG - Intronic
907401879 1:54229395-54229417 AGATGTTTCCTGGGGCTGGGCGG + Intronic
907573734 1:55507080-55507102 AGCTGTGCCCTGGGGCTGGGTGG - Intergenic
907720713 1:56969480-56969502 AGCTTATACCTGTTGATGGGAGG + Intergenic
907854076 1:58284142-58284164 GGCTGTTACATGGAGTTGGCTGG + Intronic
909041458 1:70657781-70657803 AGTTGTTGCCAGGAGCTGGGTGG + Intergenic
915507281 1:156365990-156366012 AGCTGGAATCTGGAGATGGAAGG + Intronic
915575530 1:156774074-156774096 AGCAGTTACCAGGGGCTGGGGGG + Intronic
916188396 1:162155058-162155080 AACTGTTGCCTGGATAAGGGAGG + Intronic
916319518 1:163488019-163488041 AGCTGATACCAGGAAATTGGTGG + Intergenic
917786856 1:178468379-178468401 AGCTGATACCTAGAGAAGGGAGG - Intronic
918608897 1:186463961-186463983 AGCTGTTATCAATAGATGGGAGG - Intergenic
920499041 1:206474755-206474777 AGCTGGGACCTGGAGAATGGGGG + Intronic
921376866 1:214483478-214483500 AGTTGTTAACTGGAGGCGGGTGG - Intronic
921522745 1:216176723-216176745 AGTAGTTACCTGGGGTTGGGGGG - Intronic
922712051 1:227841724-227841746 GGCTGTTACTGGGAGGTGGGTGG - Intronic
923068178 1:230539164-230539186 AGCTGTTTCCTGTGGCTGGGAGG - Intergenic
923070208 1:230557344-230557366 AGCAGTTGTCTGGGGATGGGAGG + Intergenic
924209034 1:241745852-241745874 AGCTTTTCCCAGGTGATGGGTGG - Intronic
924867863 1:248005345-248005367 ATCAGTTAACTGTAGATGGGTGG + Intronic
1066252275 10:33646300-33646322 GGCTGTTACCTGGGGAAGGCAGG - Intergenic
1068648667 10:59497698-59497720 ATATGCTACCTGGAGGTGGGAGG - Intergenic
1070352647 10:75608309-75608331 GGTTGTTACCAGGGGATGGGGGG + Intronic
1070797839 10:79227387-79227409 AGCTGTTTCATAGAGAAGGGTGG + Intronic
1071422231 10:85512080-85512102 GTCTATTACCTGCAGATGGGAGG + Intergenic
1071826210 10:89328828-89328850 AGTGGTTGCCTGGAGATGGTGGG + Intronic
1072199432 10:93145096-93145118 AGAAGGTCCCTGGAGATGGGTGG + Intergenic
1073482749 10:103797372-103797394 AGCAGTTACCAGGTGATCGGTGG + Intronic
1075088936 10:119432061-119432083 AGCTGTTAGATGGAGGAGGGTGG - Intronic
1075258931 10:120946282-120946304 CGCTGCTGCCTGGAAATGGGTGG + Intergenic
1075739865 10:124688459-124688481 AGCCTTTGCCTGCAGATGGGAGG + Intronic
1075851726 10:125593736-125593758 AGAGGTTACCTGGGGATGAGGGG + Intronic
1076250777 10:128982392-128982414 TCCTGTGACCTGGAGGTGGGGGG + Intergenic
1077383796 11:2259684-2259706 AGCTGGGACCTGTAGACGGGAGG - Intergenic
1079376832 11:19900517-19900539 AGCTGTTACCTGGGAATGCAGGG - Intronic
1080726215 11:34901611-34901633 ACCTCTTACCTGCAGATGGGGGG + Intronic
1080787854 11:35492320-35492342 AGCAGTTTCCTTGAGATGAGAGG - Intronic
1081304613 11:41496564-41496586 TGCTTTTACCTTGAGATGGCAGG - Intergenic
1081839929 11:46192623-46192645 AGTTGTTGCCAGGAGTTGGGGGG + Intergenic
1083155441 11:60820130-60820152 AGTTGTTACCTGGGGCTGGAAGG - Intergenic
1083629476 11:64088267-64088289 AGCCGTAGCCAGGAGATGGGGGG + Intronic
1083754700 11:64785197-64785219 AGTTGTTACTTGGGGATGGGAGG + Intergenic
1085960044 11:81450882-81450904 AGCTGTAACTTGGAGAAGGATGG - Intergenic
1088981727 11:114870649-114870671 GGCTGTTGCCTGGAGAGAGGTGG + Intergenic
1089452430 11:118607686-118607708 CGCTCTTACCTAGAGGTGGGGGG - Intronic
1090876803 11:130797387-130797409 AGTGGTTGCCTGGATATGGGAGG + Intergenic
1090953470 11:131494844-131494866 AGCTGTCACCAGAAGGTGGGTGG + Intronic
1091835689 12:3583979-3584001 AGGTGTGCCCTGGAGGTGGGAGG + Intronic
1096135206 12:49194500-49194522 AACTGTTGCCTGGATAAGGGAGG + Intronic
1097175626 12:57141295-57141317 AGCTGTTCACTGGGGATGAGGGG - Intronic
1098335452 12:69399951-69399973 AGTGGTTGCCAGGAGATGGGTGG + Intergenic
1100007331 12:89910053-89910075 ATTTAATACCTGGAGATGGGGGG - Intergenic
1102146101 12:110656179-110656201 AGCTTCTGCCTGGAGATGCGAGG + Intronic
1104043102 12:125143411-125143433 AGCTGTGCCCTGGAGTTGTGTGG + Intergenic
1106898429 13:34330237-34330259 AGCTGTGTCCTGGAGTTTGGAGG - Intergenic
1107123535 13:36819969-36819991 AGCTGAGGCCTGGGGATGGGAGG + Intronic
1108786659 13:53911155-53911177 AGAAGTTACATGCAGATGGGAGG + Intergenic
1109171190 13:59099153-59099175 GGCTGGTACATGGTGATGGGAGG - Intergenic
1111698325 13:91653993-91654015 AATGGTTACCTGAAGATGGGGGG - Intronic
1112035572 13:95493399-95493421 AACTCTTTTCTGGAGATGGGTGG - Intronic
1113476332 13:110584310-110584332 AGTTGTTGCCTGGGGCTGGGAGG - Intergenic
1118898350 14:69965659-69965681 AGCTGTGCCATGGGGATGGGAGG + Intronic
1119080022 14:71684379-71684401 AGGTGAGACATGGAGATGGGGGG - Intronic
1119583610 14:75811084-75811106 AGCTGCTAACTGGAGGTAGGGGG + Intronic
1119603409 14:75993416-75993438 AGCAGTTAACTGGAGAGGGATGG - Intronic
1120772048 14:88389711-88389733 AGCTGTCACTTACAGATGGGTGG + Intronic
1121045258 14:90783070-90783092 AGCTGTTTCCTGTACTTGGGTGG - Intronic
1121655798 14:95594687-95594709 AGATGCTAGGTGGAGATGGGAGG - Intergenic
1124211430 15:27768075-27768097 AGCTGTGACCTGGCGCAGGGAGG + Intronic
1125964361 15:43861599-43861621 AGCTGTTCTCTGCAGGTGGGAGG + Intronic
1126139317 15:45424483-45424505 TGCTGGTAACTGGAGGTGGGTGG + Intergenic
1127469840 15:59281049-59281071 AGCTGTGGTCTGGTGATGGGTGG - Intronic
1128074902 15:64819947-64819969 AGCTGTGGCCTGGAGCTGGCGGG + Exonic
1128767536 15:70260266-70260288 AACTGCAACCTGGAGGTGGGTGG + Intergenic
1129948614 15:79563993-79564015 AGCTGGGACCTGGAGGTGGTGGG + Intergenic
1132310297 15:100852719-100852741 AGCTGTCATCTGGAGATGCCTGG - Intergenic
1132367313 15:101266951-101266973 AGCAGTTACCAGGACCTGGGGGG - Intergenic
1132936343 16:2483197-2483219 AGCTGTGAGCTGGAGAGGAGAGG + Intronic
1133367092 16:5218621-5218643 ATCTGTTACCTGAAGAAGTGAGG + Intergenic
1133765019 16:8831927-8831949 CCCTGTTCCCTGGAGAAGGGAGG - Intronic
1135696326 16:24590033-24590055 AGTTGTTGCTTGGGGATGGGAGG - Intergenic
1139574104 16:67830577-67830599 GGCTGTCACCTGGAGATCAGGGG + Intronic
1141468526 16:84222779-84222801 AGCTCCTACCTGGAGAAGGTGGG - Exonic
1142003235 16:87675975-87675997 AGCTGTTGGCAGGAGCTGGGAGG + Intronic
1142222487 16:88862347-88862369 AGCTGTGGCGTGGAGGTGGGTGG + Exonic
1142595637 17:1028550-1028572 AGGTGTTACCTGAGGAAGGGCGG - Intronic
1143295433 17:5868058-5868080 AGCTGTTTCCTGGGCATGAGGGG - Intronic
1144727932 17:17511157-17511179 AGCTGGCAGCTGGAGGTGGGGGG - Intronic
1145018537 17:19413670-19413692 AGCTCCTACCAGGTGATGGGGGG + Exonic
1146927735 17:36756586-36756608 AGAGGTTACCAGGAGCTGGGGGG - Intergenic
1147255061 17:39176450-39176472 AACTGTTACCTAGAGATCTGGGG + Intronic
1148843922 17:50517587-50517609 AGCTGTCACCGGGACCTGGGAGG - Exonic
1149995593 17:61404592-61404614 AGCTGCTTCCTGGGGATGAGCGG - Exonic
1150626956 17:66848012-66848034 TGTTGTTTCCTGGAGAAGGGTGG + Intronic
1152525664 17:80887030-80887052 AGCTCTTACCTGGTTATGGAGGG + Intronic
1152971367 18:164783-164805 AACTCCTACCTGGAGATGGGAGG + Intronic
1153100168 18:1459137-1459159 TGCTGTGACTGGGAGATGGGAGG + Intergenic
1154933251 18:21023067-21023089 AGTGGTTACCAGGAGCTGGGGGG + Intronic
1156446329 18:37239664-37239686 AGCATTTATCTGGGGATGGGAGG + Intergenic
1157733733 18:50028000-50028022 AGAGGTTACCTGGGGATGGAGGG + Intronic
1159183198 18:64937173-64937195 AACTAATACCTGGACATGGGGGG - Intergenic
1159779603 18:72645836-72645858 AGATGTGAGCTGGAGAGGGGAGG - Intergenic
1159894474 18:73983392-73983414 AGCGGCTTTCTGGAGATGGGGGG - Intergenic
1160074000 18:75654546-75654568 AGCTGTTTTCTGGGGATGGTGGG + Intergenic
1161590916 19:5128807-5128829 AGCTGTTATCTGGCCAGGGGAGG - Intronic
1162738403 19:12759469-12759491 AGCTGGGAGGTGGAGATGGGTGG + Intergenic
1162896332 19:13766584-13766606 AGCTGTGACCAGGAGACAGGGGG + Intronic
1163117565 19:15197653-15197675 AGCTGTTGCCTGGTGGAGGGAGG - Intronic
1164589548 19:29499059-29499081 AGCTGTTTCCTGGAGACAGATGG - Intergenic
1164662949 19:29994437-29994459 AGTGGTTACCAGGGGATGGGGGG - Intronic
1165798411 19:38532671-38532693 AGCTGCCACCTGGAGGAGGGAGG + Exonic
1166310744 19:41961075-41961097 AGGTGTTCCCAGGAGGTGGGAGG + Intergenic
1166468337 19:43054801-43054823 AGTTGTTACCTGGGGTGGGGAGG - Intronic
1166488772 19:43239119-43239141 AGTTGTTACCTGGGGTGGGGAGG - Intronic
1166631604 19:44411981-44412003 AGCTGAAATCTGGAGATGGTTGG - Intergenic
1166636572 19:44456640-44456662 AGCTGAAATCTGGAGATGGTTGG + Intergenic
1167586091 19:50376791-50376813 CGCTGTTGCTTGGAGAGGGGCGG + Exonic
1167757197 19:51420266-51420288 ATAAGTAACCTGGAGATGGGAGG + Intergenic
925847687 2:8048667-8048689 AACCGTTACCTGGGGATGGTTGG + Intergenic
926138921 2:10356855-10356877 AGCTGGGATTTGGAGATGGGTGG - Intronic
926320309 2:11744734-11744756 AGCTCCTCCCTGGAGGTGGGAGG + Intronic
931073187 2:58678185-58678207 AGCTTTTACCTGCACATGAGGGG + Intergenic
931269955 2:60692748-60692770 AGCGGTTACCAGGGGCTGGGAGG + Intergenic
931309119 2:61061906-61061928 GGCAGCTACCAGGAGATGGGGGG + Intergenic
932595334 2:73089699-73089721 TGCTGGGGCCTGGAGATGGGAGG - Intronic
932699462 2:73983707-73983729 AGCTGTTAGCTGCAGCCGGGCGG + Intergenic
933266734 2:80189034-80189056 TGCTTAAACCTGGAGATGGGAGG - Intronic
933648915 2:84833233-84833255 AGCTGTAACCTAGAAATGTGGGG + Intronic
934713273 2:96529085-96529107 AGATGTTGCCTGGTGATGGAGGG + Intergenic
934858755 2:97746145-97746167 AGAAGTTACCAGGAGCTGGGGGG + Intergenic
942177201 2:173345558-173345580 ACCTGTTACCTGGGACTGGGTGG - Intergenic
942674271 2:178411280-178411302 AGTGGTTTCCAGGAGATGGGAGG + Intergenic
945983743 2:216338406-216338428 AGTTGCTACGTGGAGCTGGGAGG - Intronic
946313094 2:218893601-218893623 ACCCCTTCCCTGGAGATGGGAGG + Exonic
946841376 2:223823566-223823588 AGTGGTTACCAGGAGCTGGGGGG + Intronic
947979274 2:234395464-234395486 AACTGGAACCTGGAGATGGAAGG + Intergenic
1169100005 20:2939376-2939398 AGCTGTAACATGGAGAAGAGGGG + Intronic
1170162322 20:13325986-13326008 AGTGGTTACCCGGAGTTGGGAGG - Intergenic
1170436105 20:16330931-16330953 AGCTATCACCTGGAGAAGTGAGG + Intronic
1170653812 20:18267635-18267657 ATCTGTTCCCTGGGGATAGGTGG + Intergenic
1171419160 20:25006370-25006392 AGCTGTGCCCTGGGCATGGGGGG - Exonic
1171439486 20:25148683-25148705 AGCTGTTGCCTCGAGATGTGTGG - Intergenic
1172634483 20:36400889-36400911 AGCTGTCACCGGGCGCTGGGGGG + Intronic
1173422881 20:42918286-42918308 AGCTGTTACCTGGAGATGGGGGG - Intronic
1173795128 20:45854592-45854614 AGCTGTAAAATGGAGAAGGGTGG - Intronic
1174236463 20:49097280-49097302 TGCTGTTCCCTGGAGAGTGGAGG + Intergenic
1174665237 20:52251930-52251952 GTCTGTTACCTGGACAAGGGAGG - Intergenic
1175331805 20:58169823-58169845 AGCTGCTAGCTGGAGATGAGTGG - Intergenic
1175467537 20:59200643-59200665 AGCGGTTACCTGGGGATGGAAGG - Intronic
1175817573 20:61891471-61891493 ATCAGTCACCTGGAGAAGGGGGG - Intronic
1175889004 20:62307837-62307859 TGCTGTCGCCTGGAGCTGGGTGG + Intronic
1176219686 20:63964062-63964084 AGCCCCTACCTGGAGCTGGGTGG + Exonic
1176233155 20:64042158-64042180 ATGTGTTTCCTGGAGTTGGGGGG - Intronic
1176612081 21:8992395-8992417 AGCTGACATCTGGAGATGGTTGG - Intergenic
1178568114 21:33707558-33707580 AGTGGTTTCCTGAAGATGGGAGG - Intronic
1180008803 21:45035804-45035826 AACTGTTATCTGGGGGTGGGGGG + Intergenic
1180066237 21:45413918-45413940 AGCTGGTCCATGGAGCTGGGAGG + Intronic
1180756396 22:18164869-18164891 AGCTTTCTCCTGGAGAGGGGAGG - Intronic
1180797317 22:18612175-18612197 AGGTGGTACCTGGATGTGGGAGG - Intergenic
1181075373 22:20372565-20372587 AGCTTTCTCCTGGAGAGGGGAGG + Intronic
1181224405 22:21383097-21383119 AGGTGGTACCTGGATGTGGGAGG + Intergenic
1181254227 22:21551716-21551738 AGGTGGTACCTGGATGTGGGAGG - Intronic
1182562009 22:31167476-31167498 AGAGGTTACCAGGAGCTGGGGGG - Intronic
1183075669 22:35425053-35425075 ATCAGTAAACTGGAGATGGGGGG + Exonic
1183329555 22:37212065-37212087 GGATGTGTCCTGGAGATGGGGGG - Exonic
1183830995 22:40418356-40418378 AGCAGGTACCTGGGTATGGGAGG - Exonic
1184109504 22:42386854-42386876 AGCTGCCACCAGGAGATGGCTGG + Intronic
1184220888 22:43099160-43099182 ACCTGGAACCTGGAGGTGGGTGG - Intergenic
949897888 3:8783750-8783772 AGCAGTGACATGGAGATGGAGGG - Intronic
950790291 3:15466332-15466354 AGCTCTTACCTGCAGGTGGGGGG + Exonic
951805039 3:26634591-26634613 GGCTGTTCCCTTGAGATGGGGGG + Intronic
953854838 3:46493395-46493417 AGGTCTTTTCTGGAGATGGGTGG - Intergenic
954110213 3:48429356-48429378 AGCTGTTACCCGGAGACCGAGGG + Exonic
954308734 3:49747871-49747893 CGCTGTTCCCGGGAGATGAGGGG + Exonic
956176756 3:66480280-66480302 AGATGTTGCCGGGGGATGGGAGG + Intronic
957813330 3:85257023-85257045 AGCTGTCACCTAGAGATGTTAGG - Intronic
958583290 3:96053353-96053375 AAATGTTACCAGGAGTTGGGTGG - Intergenic
958597812 3:96252485-96252507 AGCTGTTTCCTTGAAATGGAAGG - Intergenic
962384648 3:134923046-134923068 TGCTGTGAAGTGGAGATGGGGGG + Intronic
963389888 3:144647608-144647630 AGCGGTTGCCAGGAGCTGGGAGG + Intergenic
963453042 3:145509129-145509151 AACTGTTACCTAGAAATGGGGGG + Intergenic
967862817 3:194165469-194165491 AGCTGTTGCCTAGAGACTGGGGG + Intergenic
969578166 4:8048461-8048483 AGCTTTCACATGGAGATGAGAGG - Intronic
969649240 4:8454017-8454039 AGCTGGTACCTGGAGACAGCTGG + Intronic
969955756 4:10889107-10889129 ATCTGATACCTGGAGAGAGGAGG + Intergenic
971049410 4:22844451-22844473 AGCTGTTATTTGGAGTCGGGGGG - Intergenic
973374864 4:49279626-49279648 AGGTGATATCTGGAGATGGTTGG + Intergenic
973382547 4:49330615-49330637 AGGTGATATCTGGAGATGGTTGG - Intergenic
975443318 4:74436850-74436872 AGCTGCTGCTTGGAGGTGGGGGG + Intergenic
975691114 4:76964482-76964504 AGCTGTGACCTGGGGAAGGAGGG + Intronic
976145819 4:82042241-82042263 AGCTCCTACCTCTAGATGGGTGG + Intronic
976766815 4:88606450-88606472 ATCAGTTACCTGGGGAGGGGAGG + Intronic
979604745 4:122625957-122625979 AGCTGTTACCTGAACATCGTTGG - Intergenic
980750042 4:137076833-137076855 AGCTGGTAGCTGGAGATGACAGG - Intergenic
981524639 4:145697526-145697548 AGTGGTTACCTGGAGGTGTGAGG - Intronic
984731889 4:183076098-183076120 AGCTGTGAGATGGAGATGAGGGG + Intergenic
987691072 5:21267813-21267835 AGCTCCTAACTGGAGATGAGGGG - Intergenic
992233630 5:74686004-74686026 AGCTGTTACCAGGAGATGTGAGG - Intronic
995252672 5:110012251-110012273 AGCTGTTACTTGAAAATGTGAGG - Intergenic
996615344 5:125434972-125434994 TGCTGTTAAATGGAGATGGGAGG - Intergenic
998363556 5:141612613-141612635 AGTGGTAATCTGGAGATGGGAGG + Intronic
998696265 5:144643249-144643271 AGCAGTTACCAGGCAATGGGGGG - Intergenic
998706291 5:144765682-144765704 AACAGTTCCTTGGAGATGGGTGG + Intergenic
998772689 5:145564490-145564512 AACTGAAACCTGGAGATGAGAGG - Intronic
1001136030 5:169103626-169103648 TGCTGTTACCGGGAGGTGGGTGG + Intronic
1001900431 5:175422400-175422422 TGCTGTGGCCTGGGGATGGGAGG + Intergenic
1003524598 6:6887089-6887111 AGCTGCTGTCTGAAGATGGGAGG + Intergenic
1004011507 6:11692810-11692832 AGCTGTCACGTGGTGGTGGGAGG + Intergenic
1005310203 6:24551749-24551771 AGCTGAGACCTGTAGATAGGTGG - Intronic
1005681749 6:28215746-28215768 AGCTGTTACCAGGGGCTGGGAGG - Intergenic
1005808229 6:29495012-29495034 AACTGTTACATGAAGATGGTGGG - Intergenic
1006594523 6:35183045-35183067 ATGGGTTACCTGGAGATGGAGGG - Intergenic
1006718562 6:36135692-36135714 AGCTCTGACCTGGGGCTGGGTGG + Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007345637 6:41227846-41227868 AGATGTTCCCTGGAAATGGTGGG - Intergenic
1009742054 6:67758608-67758630 ACCTGTTACCTGGAGCTGTGGGG - Intergenic
1010068498 6:71714486-71714508 AGCTAAAACCTGGAAATGGGAGG + Intergenic
1011325818 6:86149204-86149226 AGCTGTTTCCTGCTGATAGGGGG + Intergenic
1011386412 6:86802778-86802800 GGCTGCTTCCAGGAGATGGGAGG + Intergenic
1012132515 6:95515087-95515109 AGTGGTTACCAGGAGCTGGGGGG + Intergenic
1012170764 6:96015325-96015347 AGCTGTTGCCTGGGCAGGGGTGG - Intergenic
1012824249 6:104126875-104126897 AGCTGCTCCCAGGGGATGGGAGG + Intergenic
1013804696 6:113984305-113984327 AGTGGTTGCTTGGAGATGGGAGG + Intronic
1014708769 6:124781466-124781488 AGCTGTTACCAGGATGTGAGGGG + Intronic
1015182604 6:130377339-130377361 CCTTGTTACCTGGAGATGGATGG - Intronic
1016016019 6:139186928-139186950 GGTGGTTGCCTGGAGATGGGTGG + Intergenic
1017240609 6:152164063-152164085 AGATGGTGCCTGGAGATGGAAGG - Intronic
1023848235 7:44135405-44135427 AGCTGTTGCCTGGCAATGGCTGG + Intergenic
1024986227 7:55195320-55195342 CTCTGTTACCCAGAGATGGGAGG + Intronic
1024995695 7:55271751-55271773 TGCTGGGACCTGGAAATGGGAGG + Intergenic
1028109568 7:86922988-86923010 GGCTATTCCTTGGAGATGGGAGG - Intronic
1028851560 7:95543565-95543587 ATCTGTGACCTGAAGAGGGGTGG + Intergenic
1028909543 7:96192526-96192548 AGCTGACACCTGGAGGAGGGAGG + Intronic
1030707304 7:112707196-112707218 AGTGGTTACCAGGGGATGGGTGG + Intergenic
1032101469 7:128982096-128982118 AGCTGTTACCTGAAGTTCTGGGG - Intronic
1032224014 7:130016141-130016163 AGCTGGTCCTTGGAGATGAGTGG - Intergenic
1032519287 7:132531050-132531072 AGCGGTTACCCAGAGCTGGGAGG + Intronic
1033779598 7:144652867-144652889 TGCAGTTATATGGAGATGGGTGG - Intronic
1035029702 7:155849114-155849136 AGCTGTTCCCAGGGGCTGGGAGG + Intergenic
1035203829 7:157282040-157282062 CTCTGTGACATGGAGATGGGAGG + Intergenic
1035939887 8:3887299-3887321 AACTATCACCTGGCGATGGGGGG - Intronic
1037581289 8:20247331-20247353 TGCTCTTTCCTGGAGTTGGGGGG + Exonic
1037947371 8:22997756-22997778 AGCTGGTCTCTGGAGGTGGGTGG + Intronic
1038027885 8:23608473-23608495 AGCTGTTCTCTGGAGCTGAGAGG - Intergenic
1038620536 8:29138629-29138651 AGGTGTTACCTGGGGGAGGGAGG - Intronic
1040915284 8:52562608-52562630 AGATGTGAGCTGGAGGTGGGGGG - Intronic
1042652602 8:71059775-71059797 CCCTTTTACCTGGAGAGGGGAGG + Intergenic
1045063416 8:98426784-98426806 AGCTGTCACCGGGGGATGGTCGG + Intronic
1047595600 8:126374838-126374860 AGCTGTTATCTAGAGACCGGAGG - Intergenic
1049289884 8:141796199-141796221 ACCTGTCACCTGGAGGAGGGAGG - Intergenic
1049686143 8:143940038-143940060 CGCTGATACCTGGCGAGGGGAGG + Intronic
1050286115 9:4104108-4104130 AGATGTTACCTAGAAATAGGTGG + Intronic
1050361105 9:4831849-4831871 AGTTGTAACTTGGAGATGGCTGG + Intronic
1050734712 9:8749558-8749580 AGCTGTCACATAGAGATTGGTGG - Intronic
1054777683 9:69137754-69137776 AGCTGTGACCAGGAGATCTGGGG - Intronic
1055435754 9:76290461-76290483 AGCTGTTATCTGCTCATGGGAGG - Intronic
1055890158 9:81115661-81115683 AGGTCCTACCTGGTGATGGGAGG - Intergenic
1057451177 9:95161793-95161815 AGTGGTTACCTTGGGATGGGAGG - Intronic
1057944641 9:99314641-99314663 AGTTGTTTCCTGGGGATGGATGG + Intergenic
1059144397 9:111885294-111885316 AGTAGTTACCAGGAGCTGGGGGG + Intergenic
1061358507 9:130124632-130124654 AGCTGTAACCTGGCTATGGTGGG - Intronic
1061926224 9:133807368-133807390 AGCTGTGACCTTGAGAGGGTGGG - Intronic
1061941308 9:133885649-133885671 AGCTGTTAGATGGAAATTGGAGG - Intronic
1062667680 9:137685269-137685291 AGGGGTTACCAGGAGCTGGGAGG - Intronic
1203548682 Un_KI270743v1:151125-151147 AGGTGAAATCTGGAGATGGGTGG + Intergenic
1185713689 X:2324559-2324581 AGCTTTCACCTGGGGCTGGGCGG - Intronic
1186858818 X:13651592-13651614 AGATGTCACCTGGAGGTTGGTGG - Intergenic
1190258636 X:48784113-48784135 AGTGGTTACCAGCAGATGGGAGG + Intergenic
1193980898 X:88180724-88180746 AGCTGGTACCTGAAGTTAGGTGG + Intergenic
1195632608 X:107074365-107074387 AGCTGCTACCTGGTGAATGGTGG + Intronic
1195704057 X:107725914-107725936 AGCTGGTTCCTGTAGAAGGGAGG - Intronic
1200239673 X:154486913-154486935 AGCTGGGACATGGAGAAGGGAGG + Intergenic