ID: 1173423814

View in Genome Browser
Species Human (GRCh38)
Location 20:42926112-42926134
Sequence CTGTGGGTCTGACCTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173423807_1173423814 -3 Left 1173423807 20:42926092-42926114 CCTCAACAGACCAGGCCAGCCTG 0: 1
1: 0
2: 1
3: 24
4: 280
Right 1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 233
1173423805_1173423814 14 Left 1173423805 20:42926075-42926097 CCACTGACTCGGGGCTGCCTCAA 0: 1
1: 0
2: 0
3: 3
4: 123
Right 1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 233
1173423804_1173423814 15 Left 1173423804 20:42926074-42926096 CCCACTGACTCGGGGCTGCCTCA 0: 1
1: 0
2: 0
3: 12
4: 85
Right 1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173423814 Original CRISPR CTGTGGGTCTGACCTGCAGA GGG Intronic
900151228 1:1180122-1180144 CTGTGGGCCGGACCTGGAGGGGG + Exonic
900590350 1:3456679-3456701 CTGTGTGTCTGTCCTACAGCGGG + Intronic
900703198 1:4060678-4060700 CTCTGGGCTTGGCCTGCAGAAGG + Intergenic
900791116 1:4681505-4681527 CTGGGCTTCTGGCCTGCAGAAGG + Intronic
903123355 1:21231304-21231326 CTGTGGGGCTCACCTGGAGGAGG - Intronic
904006128 1:27364211-27364233 CTGTGGGTGTGGCCTCCAGCAGG + Exonic
904114862 1:28154372-28154394 CTGTGTGCCTTACCTGCAGTTGG - Intronic
904329764 1:29750920-29750942 CTGTGGTTCTGCCCTCCACAGGG - Intergenic
904615640 1:31748143-31748165 TTGTGGGGCTGGCCAGCAGATGG - Intronic
904843968 1:33394445-33394467 CTGTGGTTCTGATTTGCAGCTGG - Intronic
905916182 1:41685943-41685965 CAGTGGATCTGACCAGCAAATGG + Intronic
906665887 1:47621758-47621780 GTGTGGAGCTGGCCTGCAGACGG + Intergenic
909498723 1:76309727-76309749 CTGGGGGCCTGAGCTGCAGAAGG + Intronic
909698320 1:78491699-78491721 CTGTGAGTAAGACCTGGAGAAGG + Intronic
912745130 1:112239697-112239719 CTGTGGGAGTGACATGCAGTGGG + Intergenic
915894256 1:159799137-159799159 CTCTGGGTCTGGCCTACAGAGGG - Intergenic
918340851 1:183566985-183567007 CTGTGGTGCTGCACTGCAGAAGG - Exonic
918703351 1:187632313-187632335 AGGTGGGTCTGGCATGCAGATGG + Intergenic
919724814 1:200874598-200874620 CAGGGGGTCTGACTTGGAGAAGG - Intergenic
1063289811 10:4733830-4733852 TTGGGGGTCTGACTGGCAGAAGG + Intergenic
1063360875 10:5456868-5456890 ATGTGGCTCTGGCATGCAGATGG + Exonic
1064717634 10:18193390-18193412 CTGTGGGTGTGAAGTGCAGGTGG + Intronic
1067545159 10:47187682-47187704 CTGTGGGACTGCCCTGCAGCGGG - Intergenic
1069910009 10:71753170-71753192 CTGCGTGTCTGTCCAGCAGATGG + Intronic
1074313239 10:112340473-112340495 CTGTGGGTGAGAACTGTAGATGG - Intergenic
1076207172 10:128612522-128612544 CTGTGGGGCTGAGCCGCATAGGG + Intergenic
1076597989 10:131637809-131637831 CTTTGGGTCTGACTTGAGGAAGG - Intergenic
1076987913 11:252792-252814 TTGTGGGTCTCTCCTGCAGAGGG + Exonic
1077015364 11:396872-396894 CCGTGGATCTGAGCTGCAGTCGG + Exonic
1077043429 11:534447-534469 CTGTGGGTTTGCCCTTCAGATGG - Intronic
1077391101 11:2301008-2301030 CTGGGGGCCAGAGCTGCAGAGGG + Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1081691282 11:45080270-45080292 CTGTCAGGCTCACCTGCAGAGGG - Intergenic
1081867350 11:46367026-46367048 CTGTGGGTCTGGCCTGGGCATGG + Intronic
1083994274 11:66264519-66264541 CTGAGGGCCTGCCCTGCTGAGGG - Intronic
1084491349 11:69480275-69480297 CTCAGGGTCAGGCCTGCAGAAGG - Intergenic
1085467718 11:76735539-76735561 CAGTGGGTCTGTCCTGCTCAAGG - Intergenic
1088755706 11:112883489-112883511 CAGTGACTCTGACCTGCATATGG - Intergenic
1089499480 11:118923981-118924003 TTGTGGTCCTGACCTGGAGAAGG + Intronic
1090753650 11:129769790-129769812 CTGGGTCTCTGACTTGCAGATGG - Intergenic
1093231120 12:16543141-16543163 CTGAGAATCTGACATGCAGAAGG + Intronic
1093876440 12:24354353-24354375 CAGTGGGTCTGCTCTGCAGAAGG + Intergenic
1094010699 12:25806450-25806472 CTGGGGGACTGACCTGCAAAGGG + Intergenic
1094054654 12:26256653-26256675 CTGTGGGTTGGACCTGGAAAGGG + Intronic
1094650084 12:32367774-32367796 CTATGGATCTGACATGCAGCTGG - Intronic
1096362534 12:51000585-51000607 CTGTGGCTCTCACCTGGAGAAGG + Intronic
1096685247 12:53284118-53284140 CTGTCAGTCGGACCTGCAGCAGG + Exonic
1096845233 12:54402993-54403015 CTGTGTGCCTGACCTGCAGCTGG - Exonic
1096919329 12:55067345-55067367 ATGAGGGTCTGAACTGCAGCTGG - Intergenic
1101961671 12:109255580-109255602 CTGTGGCTCTGACCAGGAGGGGG - Intronic
1102032849 12:109753012-109753034 CTGTGGGTCTCAACTGCTCAGGG + Intronic
1102826595 12:115952237-115952259 GTGTCGGGCTGACCTGCAGGGGG + Intergenic
1103506109 12:121443161-121443183 CTGTCGGTCAGACGTGGAGATGG - Intronic
1104859445 12:131916864-131916886 ATGTGTGTCTGGCCTGCAGAGGG + Intronic
1104931252 12:132340596-132340618 CAGAAGGTCTGCCCTGCAGAAGG + Intergenic
1107079343 13:36357511-36357533 CTGTGGGTGTGACTTGCTGCAGG - Intronic
1107951445 13:45465422-45465444 CTGTGGGGGTGTCCTGCAGCTGG + Intronic
1108042803 13:46355197-46355219 CTGTATGTCTGACCTGCAAAAGG - Intronic
1113529405 13:111010307-111010329 CAGTGGGACAGACCTGGAGATGG + Intergenic
1113765922 13:112881226-112881248 CTGTGGGTCTGACCAGCAAGGGG - Intronic
1114325246 14:21582300-21582322 CTCTGGGACTGACTTGAAGAGGG + Intergenic
1114570612 14:23664775-23664797 CTGTGGCTCTGACCTCCACCAGG + Intergenic
1118442861 14:65827798-65827820 CTCTGGGCCTGACCTGGAGGTGG + Intergenic
1118476328 14:66120853-66120875 CTGTGGTTCTGACAGGCATAGGG + Intergenic
1119572760 14:75690654-75690676 CTGTGGTTCTGGGCTACAGAGGG - Intronic
1120121068 14:80680632-80680654 ATGTGGGTATGGACTGCAGAGGG - Intronic
1121245164 14:92456782-92456804 CTGTGGGTTAGAGCTGCAGTGGG + Intronic
1121660272 14:95630045-95630067 CTGTGGGTTTGACCAGCTGAAGG + Intergenic
1121691105 14:95877389-95877411 ATGTGGGTTTGACATGCAGGCGG + Intergenic
1122060915 14:99136189-99136211 CTGGGAGCCTGGCCTGCAGAGGG + Intergenic
1122350444 14:101086937-101086959 CTGAGGGTCACACCTGCAAAGGG + Intergenic
1122424249 14:101596472-101596494 AAGTGGGTCTGAGCAGCAGACGG + Intergenic
1123119295 14:105909423-105909445 CTGTGGGCCTGACCTCGAGCAGG - Intergenic
1124188931 15:27554588-27554610 TTGTGGGTCTTATTTGCAGAAGG + Intergenic
1125606768 15:40943919-40943941 CTGTGGCTCTACCCTGCAGGGGG - Intergenic
1128333553 15:66771681-66771703 CTTTGGGTCTGTCCTGAGGATGG + Intronic
1130353531 15:83110739-83110761 CTGTGGGGATGAGCTGAAGAAGG - Intronic
1130952272 15:88602142-88602164 CAGTGGGTCTTTCCAGCAGAAGG + Intergenic
1130971793 15:88739516-88739538 CTGTGGGTCTAACAGGCAGTGGG + Intergenic
1131348284 15:91671953-91671975 CTGAGGGTGTGAACTGCAGCAGG - Intergenic
1132227579 15:100154462-100154484 CGGCGAGTCTCACCTGCAGATGG - Intronic
1132714567 16:1284336-1284358 CTGTGGGGCTGACCTCCAACAGG + Intergenic
1132863609 16:2083229-2083251 CTGTGGGTCTGGCTTGGAGTTGG + Intronic
1133258451 16:4533306-4533328 CTATGGGTCTGACTGGGAGATGG - Intronic
1133279344 16:4656218-4656240 CTGTGGCTAAGACATGCAGAAGG + Intronic
1133301834 16:4787440-4787462 CTGTGGGTCTGTCCTGCCGTGGG + Intronic
1133318918 16:4901047-4901069 CTTTGGGACTGACCTGCCGCTGG - Exonic
1133343609 16:5055370-5055392 CTGGGGGGCAGGCCTGCAGAGGG - Intronic
1134092347 16:11398327-11398349 GGGTGAGTCTGCCCTGCAGAAGG - Exonic
1134608020 16:15586619-15586641 CAGTGGGGCTGGGCTGCAGATGG + Intronic
1135930032 16:26728476-26728498 CTGAGGGTCTGACCGGATGATGG - Intergenic
1137544550 16:49392021-49392043 GTGTGGGTGTGACCTGCCCAAGG - Intronic
1137792794 16:51188981-51189003 CTGTGGGGCTGAGGTGTAGATGG - Intergenic
1137811805 16:51359664-51359686 CAGTGGGTCTGAGCAGCAGGTGG - Intergenic
1141482420 16:84315374-84315396 CTGTGGGGCTGACCTTCAAGTGG - Intronic
1141616673 16:85213831-85213853 CTGTGAGTCTGAGCTGCCTATGG - Intergenic
1142114938 16:88351652-88351674 CTGTGGATCTGAGGTCCAGACGG + Intergenic
1143393897 17:6576746-6576768 CAGTGGGTCTGAAAGGCAGAAGG - Intergenic
1144642068 17:16943111-16943133 CTTGGGGTCTGTCATGCAGATGG - Intronic
1144794455 17:17881615-17881637 CTGTGGGCTTGACAGGCAGATGG - Intronic
1146883762 17:36457682-36457704 CTGTGGGGCTGACTCCCAGAAGG + Intergenic
1147498197 17:40937494-40937516 GTGTGTCTGTGACCTGCAGAGGG + Intronic
1148103182 17:45105133-45105155 CTGCTGGTCTGGCCAGCAGAGGG - Intronic
1148764050 17:50027297-50027319 CTGTGGGTCAGTCCTGCAGCTGG + Intergenic
1148792520 17:50181397-50181419 CTGTGGGTCAGGGCTGCAGCGGG - Intergenic
1149636691 17:58176805-58176827 CTGTGTGTGTGTGCTGCAGAGGG + Intergenic
1151959998 17:77400769-77400791 CTGTGGGTCTGGCCTGGGGAAGG + Intronic
1152255574 17:79237498-79237520 CTGTGGGTGAGACAGGCAGATGG - Intronic
1152398173 17:80047902-80047924 CTGTGGTACCGACCTGCAGCCGG + Intronic
1153066716 18:1053666-1053688 CTGTGGGTCAGAACTGGGGACGG + Intergenic
1153676952 18:7464245-7464267 CAATGGGACTGACCTGCAAAGGG - Intergenic
1153893137 18:9536501-9536523 CTGTGGTTTAGAACTGCAGAAGG - Exonic
1155819811 18:30361545-30361567 CTGTGGATTTGACTTGCAGTTGG - Intergenic
1156447786 18:37249875-37249897 CTTTGGGTCTGACCTATACAGGG - Intronic
1158106917 18:53895811-53895833 ATGTGAGTCTGACCTTCAGGAGG + Intergenic
1160117913 18:76099350-76099372 CTGTGGTGCTGTGCTGCAGACGG - Intergenic
1160928557 19:1558840-1558862 CTGGGGGTCTGACCTGGTGAGGG + Intronic
1161906375 19:7159836-7159858 CTCTGGCCCTGACCTGCTGAAGG - Intronic
1163334063 19:16660247-16660269 AAGGGGGTCTGGCCTGCAGAGGG - Intronic
1163737396 19:18989978-18990000 ATGTGGGGCTCACCTGCAGGGGG - Intergenic
1164836654 19:31359324-31359346 CAGTGGGTGTGCCCCGCAGATGG + Intergenic
1165137644 19:33679978-33680000 CTGTCGGAGTGTCCTGCAGAAGG - Intronic
1165299968 19:34962595-34962617 CTGTGGGTCTGACAGACAGCAGG + Intronic
1166099063 19:40560290-40560312 CTGTGGAGCTGACATGCAGGCGG - Exonic
1166848950 19:45748521-45748543 CTGTTGATCTTACCTTCAGAAGG + Intronic
926198515 2:10777672-10777694 CTGTCGGTCTGCCCCGCAGCAGG - Exonic
930101578 2:47607572-47607594 CTGATGTTCTGACCTGGAGACGG - Intergenic
930416420 2:51095711-51095733 ATGTGGGTTTGAACTGCACAAGG - Intergenic
932277135 2:70459984-70460006 CAGTGGGTCTCACCTACAGTTGG + Intronic
933103090 2:78284568-78284590 CTGTAGGTCTTACTTTCAGAAGG + Intergenic
933648024 2:84828097-84828119 CTGTTGGGCTAATCTGCAGAGGG - Intronic
935150205 2:100427198-100427220 CTGTGGTTTAGAACTGCAGAAGG - Intergenic
935338193 2:102036105-102036127 CTGTGGCTCTAATCAGCAGAGGG - Intergenic
935340478 2:102055363-102055385 CTGTGGGTCTCACTTGGAAATGG - Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937095426 2:119232360-119232382 CACAGGGTTTGACCTGCAGAAGG - Intronic
937227834 2:120379744-120379766 CAGTGGGTCTGTCCTCCAGTAGG + Intergenic
937285148 2:120746009-120746031 CTGAGGGTTGCACCTGCAGAAGG - Intronic
938743891 2:134259219-134259241 AGATGGGGCTGACCTGCAGAGGG - Intronic
940995571 2:160145826-160145848 CTGGCTTTCTGACCTGCAGAAGG + Intronic
941102195 2:161308595-161308617 TTCTGGGTCTTACCTGAAGACGG - Exonic
941716271 2:168766755-168766777 CTGTGGGCCTGACCTGCCTGGGG + Intronic
941892790 2:170599011-170599033 CACTGGGCCTGACCTGCAGTAGG - Intronic
943511914 2:188836556-188836578 CTTTGGTTCTGACCTGCAGTGGG - Intergenic
946033723 2:216725270-216725292 CAGTGGCTCCAACCTGCAGAGGG + Intergenic
947643457 2:231720851-231720873 CTGTGGGTCTGACTTGTGGGTGG - Intergenic
1168771916 20:421022-421044 CTGGGGGCCGCACCTGCAGAAGG - Exonic
1168914012 20:1471805-1471827 CTCTAGGTCTAACCTGCAGGGGG + Intronic
1169236011 20:3930542-3930564 CTGAGAGGCTAACCTGCAGAAGG + Intronic
1169577321 20:6979565-6979587 CTGTTTGTCTGAGCTGCAGAAGG + Intergenic
1171562688 20:26139828-26139850 TTGTGGGTCTGACCTCAGGACGG + Intergenic
1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG + Intronic
1173575204 20:44108755-44108777 ATGAGGGTCTCACCTGCAGTTGG + Intergenic
1173779041 20:45738004-45738026 CTGTGGGGCTGAACAGGAGAGGG - Intergenic
1174157661 20:48527106-48527128 CTGTGTCGCTGGCCTGCAGAAGG - Intergenic
1174600981 20:51724624-51724646 CTGTGGGGCTGACATTCAGAAGG - Intronic
1174784805 20:53422358-53422380 CTGTTGGTCTCACCTGCATTAGG + Intronic
1175268255 20:57715346-57715368 CTTGGGGTCTGGCCTGCAGTGGG + Intergenic
1175331740 20:58169303-58169325 CTGTGGGTCAGAAATCCAGATGG - Intergenic
1175596906 20:60242344-60242366 CTGTGGGTCCCACCCACAGATGG + Intergenic
1175928823 20:62484078-62484100 CTGGGGCACTGACCTCCAGATGG + Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179478727 21:41664594-41664616 CTGGGGGTGTCACCCGCAGAGGG + Intergenic
1180077117 21:45468559-45468581 GTGTGGGTCTGGCCTGCACCTGG - Exonic
1180621632 22:17166472-17166494 CTGTGGTTCTTGCCTTCAGAAGG - Intergenic
1180926279 22:19557298-19557320 CTGAGGGACTGACCTGATGAAGG + Intergenic
1181047536 22:20222738-20222760 CTTGGGGTCTGACCTGGAGGAGG + Intergenic
1181306746 22:21921400-21921422 CTGTGGCTTGGCCCTGCAGATGG + Exonic
1182619335 22:31610255-31610277 CTGTGTGTGTGACCTCCAGCAGG + Intronic
1183195840 22:36352780-36352802 CTGGGGCTCTGACCTTCAGCTGG - Intronic
1183371462 22:37434914-37434936 CTCAGGGTCTGGCATGCAGATGG + Intergenic
1184459308 22:44628110-44628132 AAGACGGTCTGACCTGCAGAGGG - Intergenic
1185249237 22:49791093-49791115 CTGTGGGACGGATCTGCAGCTGG - Intronic
1185330523 22:50250205-50250227 GTGTGGGTATGGCCTGCAAAGGG - Intronic
952492254 3:33883968-33883990 CTGTGTTTCTAACCTGAAGAAGG - Intergenic
953386769 3:42510826-42510848 CTGTGTGTCTGTGCTGCTGAGGG + Intronic
954132804 3:48568856-48568878 CTGTGGGAGTGACCAGGAGAGGG + Intronic
954892043 3:53939618-53939640 CTGGGGGTCTGTCATGAAGATGG - Intergenic
961345061 3:126258910-126258932 CTGTGAATCTGTCCTGCAGAAGG - Intergenic
961601388 3:128064911-128064933 CTGTGCGTGTGGCCAGCAGATGG - Exonic
961918636 3:130403341-130403363 CTGTGGGTCTCATCTGCTGGTGG + Intronic
962375835 3:134857980-134858002 CTGTGGGTCTGACCTGGTCAGGG + Intronic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
963001743 3:140688058-140688080 CTGTGGGTCAGGCCTGTAGGTGG - Exonic
966474264 3:180325629-180325651 CTGTGGTTTAGAACTGCAGAAGG - Intergenic
969449455 4:7264776-7264798 CTCAGGGTCTGGCCTGCAGCTGG - Intronic
969486933 4:7477591-7477613 CTGGGGGTCAGACAAGCAGAGGG - Intronic
969590135 4:8117351-8117373 CTGTAGGTGTGACTTGCAGTGGG - Intronic
970436111 4:16037078-16037100 CTGTGAGTCTGAGCTGGAGCTGG - Intronic
970690462 4:18613557-18613579 CTGTAGGTCTGATATGGAGAGGG + Intergenic
971999079 4:34006554-34006576 TTGTGGGTCTGACCTCAGGACGG - Intergenic
975715007 4:77197189-77197211 CTGTAGGTCTGATCTTCAGTTGG + Intronic
981654251 4:147093908-147093930 CTGTGGGCCAGCCTTGCAGAAGG + Intergenic
982337965 4:154260817-154260839 CTCAGGGTCTGGCCTCCAGAAGG + Intronic
983505459 4:168548115-168548137 CTTTGGGTCTGACGTGTAGTTGG - Intronic
983792508 4:171814393-171814415 CTGTGCGTTTGTTCTGCAGATGG + Exonic
985635840 5:1035574-1035596 CTCTAGGTCAGACCTGCAGGGGG + Intronic
986416268 5:7531064-7531086 CTGAGGGTCTGAGCTCCTGAAGG + Intronic
987104728 5:14626879-14626901 CTGTGGATCTGGCCTGGAAATGG - Intergenic
988846009 5:35129029-35129051 CTGTGGGTCTTCACTGCAAAGGG + Intronic
990181140 5:53162170-53162192 CTGTCTTCCTGACCTGCAGATGG + Intergenic
990791697 5:59487966-59487988 CTGTGTGTCTGATGTGCAGAGGG - Intronic
991925840 5:71704227-71704249 CTGTGGGTCAGGGCTGCTGATGG - Intergenic
994110047 5:95992046-95992068 CTATAGTTCTTACCTGCAGAAGG - Intergenic
996243473 5:121230208-121230230 CTGAGGGTCTGACCTTTACATGG - Intergenic
997437359 5:133885142-133885164 CTGTGACTGTGACCTTCAGAGGG - Intergenic
997657610 5:135566990-135567012 CTGTTGGTCTGACTGCCAGACGG - Intergenic
1000238930 5:159390977-159390999 GTGTGGGTTTGAACTGCACAGGG + Intergenic
1000382945 5:160645296-160645318 CTGGGGACCTGAACTGCAGAAGG + Intronic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1002089541 5:176796334-176796356 CTCTGGGGCTGCCCTGCAGGTGG + Intergenic
1003844480 6:10158836-10158858 CTGTGGGTCTGACAGGCACTGGG - Intronic
1005364197 6:25061000-25061022 CTGTGCCTCTAACTTGCAGATGG + Intergenic
1006368504 6:33630336-33630358 CTGAGGGTCTGCCCTGCTGAGGG + Intronic
1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG + Intronic
1007167064 6:39836124-39836146 CTGTGAATCTGGCCGGCAGAGGG - Intronic
1011763736 6:90595921-90595943 CTCTGGGTCTGTCCTCCGGAGGG + Intergenic
1012701003 6:102457752-102457774 CTCTGTGTTTAACCTGCAGATGG + Intergenic
1013119267 6:107126840-107126862 GGCTGGATCTGACCTGCAGATGG - Intergenic
1013140539 6:107329457-107329479 CTGTGAGGCTGGCCTGTAGATGG + Intronic
1018469195 6:164081274-164081296 CTGTAAGGATGACCTGCAGATGG - Intergenic
1022183854 7:27948038-27948060 GGGTGGGTGTGGCCTGCAGATGG + Intronic
1024224480 7:47315205-47315227 CTCTGGGTCTGAGCAGCAAAGGG - Intronic
1025275117 7:57575575-57575597 TTGTGGGTCTGACCTCAGGACGG - Intergenic
1025606296 7:63042137-63042159 CAGTGGCCCTGACCTGCAGGTGG + Intergenic
1027911469 7:84257322-84257344 CAGTAGATCTGAACTGCAGATGG - Intronic
1030663779 7:112251158-112251180 CTCTGGGTCTGACAAGTAGAGGG - Intronic
1032019959 7:128401869-128401891 CTGTTGGCCTGACCCTCAGAGGG - Intronic
1032466555 7:132149483-132149505 ATGTGTGTCTGACATGCACATGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034540520 7:151755201-151755223 CTGTGGGTGTGACAGACAGATGG - Intronic
1036638659 8:10568464-10568486 TTGAGGGTCTGACCTGAAAATGG + Intergenic
1037671850 8:21021974-21021996 CTGAGGGTCAGACCTGCATTGGG + Intergenic
1038411414 8:27362342-27362364 CTCTGGGTCTCACCAGCATAAGG - Intronic
1039294169 8:36131130-36131152 CTGTCTTTCTGACTTGCAGATGG - Intergenic
1039474662 8:37833368-37833390 CAGTGGGTCTGAATAGCAGAGGG - Intronic
1039790829 8:40874342-40874364 CTTTGGGGCTCACCTGAAGATGG + Intronic
1042211264 8:66382865-66382887 CTGTGGGTGTGAACTCCTGATGG - Intergenic
1042351708 8:67783719-67783741 CTGTGGGTGAGACCTGGAAAGGG + Intergenic
1045052609 8:98340769-98340791 CCATGGGTCTGTCCTCCAGAGGG - Intergenic
1046827993 8:118712593-118712615 CTGTGTGTCAGCCCTGCAGGAGG - Intergenic
1048640651 8:136355766-136355788 CTATGTGTCTGAGCTGCACAAGG - Intergenic
1048995038 8:139788889-139788911 ACTTTGGTCTGACCTGCAGAAGG - Intronic
1049573781 8:143381393-143381415 GTGTGGCTCTGACCAGCACATGG + Intronic
1052895153 9:33740815-33740837 CTGGGTCTCTGACTTGCAGATGG - Intergenic
1052984769 9:34478862-34478884 CTCTGGGTCTGGTCTACAGAAGG - Intronic
1056132492 9:83600138-83600160 CTGTGGGTCTGCCGTGGGGAAGG - Intergenic
1059710510 9:116863600-116863622 GTGTGTGTCTGACCGGCAGGTGG - Exonic
1060302535 9:122383673-122383695 CCGTGTGTGTGACCTGCTGAAGG + Exonic
1061919366 9:133774312-133774334 CTGTGTGCCTGGCCTGCAGGAGG - Intronic
1061957488 9:133971245-133971267 AAGTGGGTCTGACCCCCAGAGGG - Intronic
1061971791 9:134049137-134049159 CTGTGGGTGTGTCCTGGGGACGG + Intronic
1203626383 Un_KI270750v1:29397-29419 TTGTGGGTCTGACCTCAGGACGG - Intergenic
1189328547 X:40128726-40128748 CTGAGGGTATGACTTGCATAGGG - Intronic
1192729059 X:73784196-73784218 CTGTGAGTCTAATTTGCAGATGG - Intergenic
1195211312 X:102654009-102654031 CCTTGGGTCTGACCACCAGAGGG - Exonic
1195217461 X:102714965-102714987 CCTTGGGTCTGACCACCAGAGGG - Exonic
1196052889 X:111324146-111324168 TTATGGGTCTGACATCCAGAAGG + Intronic
1198075707 X:133191004-133191026 CTCTGGGGCTGAGCAGCAGATGG + Intergenic