ID: 1173428477

View in Genome Browser
Species Human (GRCh38)
Location 20:42963726-42963748
Sequence TTCCCCTGTGCAGGGTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173428477_1173428483 27 Left 1173428477 20:42963726-42963748 CCACCCTACCCTGCACAGGGGAA No data
Right 1173428483 20:42963776-42963798 GACAATTAAAAATAAGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173428477 Original CRISPR TTCCCCTGTGCAGGGTAGGG TGG (reversed) Intronic